Literature DB >> 30699708

First Report of Meloidogyne graminicola Infecting Banana in China.

X Zhou1, G K Liu1, S Xiao1, S S Zhang1.   

Abstract

Bananas (Musa spp.) are one of world's most popular fruits, and China is the third largest banana-producing country in the world. Root-knot nematodes, Meloidogyne spp., are common pests of banana worldwide, but damage to this crop caused by M. graminicola has not been reported up to now. During a survey of root-knot nematode species infecting banana in Fujian Province, China, swollen, galled primary and secondary root samples of Musa nana cv. Tianbao (AAA) were collected from two commercial fields in Nanjing County in May 2013. The affected plants did not exhibit obvious above-ground symptoms. Seriously infected roots were malformed and dehiscent, with the tissue discolored and rotting. Examination of symptomatic roots revealed one to several females of Meloidogyne sp. within each gall, with egg masses that were often completely embedded within the gall without protruding through the root surface, and with second-stage juveniles (J2) hatched inside the galls. Population densities of this nematode ranged from 452 to 2,056 eggs and J2 per 5 g of fresh roots. Males were rarely observed. Morphological measurements of 25 females and 20 J2 matched the original description of M. graminicola (1). The perineal patterns of females were dorsoventrally ovoid, with low to moderately high and round dorsal arches and lacking obvious lateral lines; striae were smooth and some were broken by a few obvious irregular, zig-zag striae in the dorsal part of the pattern; phasmids were close together (13.1 to 19.7 μm). The J2 had long tapered tails (63.4 to 75.5 μm), with long narrow hyalines (13.1 to 19.9 μm) and marked clavate termini. DNA was extracted from one mature female. The ITS1-5.8S-ITS2 rDNA region was amplified with V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (2) and the COII and IRNA mtDNA genes were amplified with C2F3/MRH106 (GGTCAATG TTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTAGT) (3) and then sequenced. The sequences were subjected to a database search using BLAST to verify the identity. Sequences from the ITS region were 788 bp (GenBank Accession Nos. KM111531 and KM236560) and were 96.8 to 99.1% identical to the known sequences of M. graminicola in Genbank. Sequences from the mtDNA were 666 bp (KM111533 and KM236559) and showed 99.1 to 99.4% homology with the known sequences of M. graminicola (KJ139963 and HG529223). In glasshouse tests, banana plantlets (M. nana cv. Tianbao) about 20 cm high were transplanted in 25-cm-diameter pots and inoculated with 5,000 J2 of each collected population of M. graminicola replicated six times; a noninoculated control was included. After 15 weeks, all inoculated plants were stunted and chlorotic. Galling symptoms on roots were similar to those in the field, and dissection of galled root tissue revealed that different life stages of the nematode were present, with population densities ranging from 1,238 to 6,562 eggs and J2 per 5 g of fresh roots. The noninoculated control plants grew well and had no galling symptoms on the roots. These results confirmed the nematodes' pathogenicity on banana. On the basis of these results, the root-knot nematodes isolated from banana in Nanjing County were confirmed as M. graminicola. To our knowledge, this is the first report of a natural infection of banana with M. graminicola. References: (1) A.M. Golden and W. Birchfield. Plant Dis. Rep. 52:423, 1968. (2) T. C. Vrain et al. Fund. Appl. Nematol. 15:565, 1992. (3) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004.

Entities:  

Year:  2015        PMID: 30699708     DOI: 10.1094/PDIS-08-14-0810-PDN

Source DB:  PubMed          Journal:  Plant Dis        ISSN: 0191-2917            Impact factor:   4.438


  1 in total

1.  On the Close Relatedness of Two Rice-Parasitic Root-Knot Nematode Species and the Recent Expansion of Meloidogyne graminicola in Southeast Asia.

Authors:  Guillaume Besnard; Ngan Thi-Phan; Hai Ho-Bich; Alexis Dereeper; Hieu Trang Nguyen; Patrick Quénéhervé; Jamel Aribi; Stéphane Bellafiore
Journal:  Genes (Basel)       Date:  2019-02-25       Impact factor: 4.096

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.