Literature DB >> 30692609

Urotensin-related gene transcripts mark developmental emergence of the male forebrain vocal control system in songbirds.

Zachary W Bell1,2, Peter Lovell3, Claudio V Mello3, Ping K Yip4, Julia M George1, David F Clayton5.   

Abstract

Songbirds communicate through learned vocalizations, using a forebrain circuit with convergent similarity to vocal-control circuitry in humans. This circuit is incomplete in female zebra finches, hence only males sing. We show that the UTS2B gene, encoding Urotensin-Related Peptide (URP), is uniquely expressed in a key pre-motor vocal nucleus (HVC), and specifically marks the neurons that form a male-specific projection that encodes timing features of learned song. UTS2B-expressing cells appear early in males, prior to projection formation, but are not observed in the female nucleus. We find no expression evidence for canonical receptors within the vocal circuit, suggesting either signalling to other brain regions via diffusion or transduction through other receptor systems. Urotensins have not previously been implicated in vocal control, but we find an annotation in Allen Human Brain Atlas of increased UTS2B expression within portions of human inferior frontal cortex implicated in human speech and singing. Thus UTS2B (URP) is a novel neural marker that may have conserved functions for vocal communication.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30692609      PMCID: PMC6349858          DOI: 10.1038/s41598-018-37057-w

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Vocal learning ability is a distinctive trait shared by humans and songbirds and only a few other animal groups[1]. Songbirds thus provide an important animal model for defining common molecular and physiological features of brain systems needed for vocal learning. In both humans and songbirds, vocal learning is controlled by specialized circuits that share similar connections and molecular properties[2,3]. In songbirds, nucleus HVC (used as a proper name[4]) represents a central control point for learned vocalizations and can be considered an avian analogue of vocal premotor cortex, possibly analogous either to Broca’s area for speech control or to supragranular layers of the laryngeal motor cortex[3,5-8]. Neurophysiological activity in HVC provides timing cues considered important for driving the production of highly stereotyped learned vocal sequences[9-12]. Nucleus HVC and connected forebrain vocal learning nuclei are absent in bird species that lack vocal learning ability, and HVC shows marked sex differences in size and anatomy that parallel sex differences in vocal behaviour[13-17]. In the male zebra finch, HVC begins to emerge as an anatomically distinct nucleus about two weeks after hatching[18-21], and ultimately forms two major projections: one to striatal area X, necessary for learning of vocalizations, and a second to vocal motor robust nucleus of the arcopallium (RA), necessary for production of learned vocalizations[22]. The projection from HVC to RA does not develop in female zebra finches[17] unless they have been treated with gonadal steroids in the first few weeks after hatching[23-25]. The physiological, anatomical, developmental and molecular properties of HVC have been subjects of continuing interest, and several hundred genes have now been identified as local markers of the nucleus based on high-throughput microarray hybridization data[26]. Urotensin II (UTS2 gene) and its paralog URP (Urotensin related protein, UTS2B gene also known as UTS2D; see Table 1) are potent vasoactive peptides which exert biological effects through a canonical family of G protein-coupled receptors (urotensin II receptors, formerly GPR14 orphan receptors[27]). Functionally, the urotensinergic system in other species has been implicated in cardiovascular, renal and immune regulation (reviewed[28]). Intriguingly, the UTS2B RNA is enriched in songbird HVC[26,29], and also reported to be up-regulated there after androgen treatments that promote singing and growth of HVC[29,30]. The potential involvement of urotensin peptides in vocal control, or indeed in higher telencephalic functions in general, is without precedent in studies of other vertebrates: in both rodents and fish, the orthologue is expressed mainly in brainstem nuclei and spinal cord[28], and little or no expression has been described in the telencephalon[31].
Table 1

Nomenclature of Urotensinergic System Genes and Peptides in the Zebra Finch, based on Entrez Gene IDs and the receptor nomenclature of Tostivint[35].

Vertebrate NomenclaturePeptideSynonymsGene ID (chicken)Gene Symbol (chicken)Gene ID (zebra finch)Assigned Gene Symbol (zebra finch)
UTS2 UIIUrotensin-II404535 UTS2 100222633 UTS2
UTS2B URPUTS2D; Urotensin-related peptide; Urotensin-IIB peptide; Urotensin-II related peptide.404534 UTS2B 100218300 UTS2B
UTS2R1 Urotensin-2 Receptor427800 UTS2R 100231339 UTS2R1
UTS2R2 Urotensin-2 Receptor-like101747873 LOC101747873 NAUTS2R2P
UTS2R3 Urotensin-2 Receptor-like771154 UTS2RL NANA
UTS2R5 Urotensin-2 Receptor-like427799 LOC42779 100222682 UTS2R5

NA: not annotated.

Nomenclature of Urotensinergic System Genes and Peptides in the Zebra Finch, based on Entrez Gene IDs and the receptor nomenclature of Tostivint[35]. NA: not annotated. What might be the potential significance of UTS2B expression in the songbird vocal control circuit? Is it expressed in a discrete cell population within HVC? Are urotensinergic receptors also present in HVC or its targets? Is UTS2B expression correlated with adult function of the circuit, or might it have some role in circuit development? To address these questions, we annotated the urotensinergic gene family in the zebra finch and used in situ hybridization (ISH) and immunohistochemistry to map UTS2B expression at the cellular level throughout the zebra finch brain, along with neuronal tract-tracing to determine the identity of UTS2B-expressing cells in HVC. We evaluated expression of the other main elements of the urotensinergic system (UTS2 and the canonical urotensin receptors) and analyzed expression of UTS2B during the developmental period when HVC undergoes marked changes in connectivity and function in concert with changes in vocal/singing behavior. Finally, using data from the Allen Human Brain Atlas[32], we assessed whether UTS2B expression might also occur in regions of the human brain involved in vocal control.

Results

Annotation of urotensinergic family genes in the zebra finch

As a first step in assessing the urotensinergic system in zebra finch, we reviewed the annotation of the peptides and their primary receptors in the zebra finch genome. Current public annotations of zebra finch genes (e.g., Ensembl, NCBI) reference a Sanger sequencing-based haploid genome assembly (Taeniopygia_guttata-3.2.4, GCA_000151805.2)[33], but a preliminary phased diploid assembly using PacBio-based long-read sequencing is now available (Tgut_diploid_1.0, GCA_002008985.2). Though not yet annotated, the Tgut_diploid_1.0 assembly corrects significant gaps and misassemblies in the original reference[34]. However, we found that the two peptide precursor genes, UTS2 (Entrez Gene 100222633) and UTS2B (Entrez Gene 100218300), were already correctly annotated in Taeniopygia_guttata-3.2.4; we confirmed their presence as single genes with two alleles each in Tgut_diploid_1.0 (Supplementary Annotation File). For the receptor genes, we found a more complex situation which was partially resolved by the new Tgut_diploid_1.0 assembly. The urotensin II receptor family has undergone a complex set of expansions and deletions in vertebrates (reviewed[35]) with some species (e.g., mammals) having only one UTS2R gene and others having as many as five. Four UTS2R genes have been identified in chicken: UTS2R1, UTS2R2, UTS2R3, and UTS2R5, according to the nomenclature of Tostivint and colleagues[35] (Table 1), but only two were previously annotated in zebra finch. These genes are adjacent and syntenic on chromosome 18 in both chicken and zebra finch (Fig. 1). We reannotated both genes in the new phased diploid assembly using EST evidence from NCBI and published RNA-Seq data (Methods), obtaining additional 5′ coding sequence for UTS2R5 and evidence for two alleles for each gene (Supplementary Annotation File). These genes encode proteins with 96% and 97% identity to chicken UTS2R1 and UTS2R5, respectively. Based on this evidence we assigned the gene symbol for UTS2R1 to Entrez Gene 100231339, and UTS2R5 to Entrez Gene 100222682.
Figure 1

Syntenic relationships of urotensin receptor genes in birds, based on updated annotations from Table 1. (a) Chicken and zebra finch UTS2R1 and UTS2R5 are syntenic on chromosome 18. (b) UTS2R2 is present on chromosome 14 in chicken. The syntenic locus is annotated as a pseudogene in falcons, and completely absent in zebra finch, great tit, Bengalese finch, and budgerigar. (c) UTS2R3 is present and syntenic in chicken, great tit, and canary, but the syntenic loci in zebra finch, Bengalese finch, and collared flycatcher are disrupted by truncations or deletions and do not predict functional 7-transmembrane domain proteins (Fig. S1).

Syntenic relationships of urotensin receptor genes in birds, based on updated annotations from Table 1. (a) Chicken and zebra finch UTS2R1 and UTS2R5 are syntenic on chromosome 18. (b) UTS2R2 is present on chromosome 14 in chicken. The syntenic locus is annotated as a pseudogene in falcons, and completely absent in zebra finch, great tit, Bengalese finch, and budgerigar. (c) UTS2R3 is present and syntenic in chicken, great tit, and canary, but the syntenic loci in zebra finch, Bengalese finch, and collared flycatcher are disrupted by truncations or deletions and do not predict functional 7-transmembrane domain proteins (Fig. S1). UTS2R2, missing from the taeGut-3.2.4 assembly, is also absent from the newer diploid assembly. Importantly, this is not due to missing sequence, as a gap in the predicted genomic locus (between SMURF1 and RNF216 on chromosome 14) is now completely filled in the newer assembly. Indeed, we could not find UTS2R2 in existing annotations of any songbird or parrot, and the orthologous locus in the closely related Saker and peregrine falcons (Entrez Gene 106630916 and 106112120, respectively) is annotated as “gene type: pseudo” (Fig. 1). By BLAST analysis, the closest match to the falcon UTS2R2 pseudogene sequence in the new diploid Tgut assembly is UTS2R5. Thus we conclude that UTS2R2 was likely lost in this Australaves clade[36]. The UTS2R3 gene is annotated in great tit and canary as UTS2R-like, and syntenic with the chicken gene. However, the zebra finch locus, on chromosome 1A, encodes a truncated protein, lacking helices 4 to 7 of the 7 transmembrane helices typical of G-protein coupled receptors. Truncated proteins are also predicted by the genomic annotations for Bengalese finch (a near relative of zebra finch) and of collared flycatcher (Fig. 1). We carefully annotated two alleles of this gene in the Tgut_diploid_1.0 assembly, and both alleles encoded the same premature stop codon, while otherwise differing slightly; these genomic regions are sequenced at greater than 5X coverage with no gaps. We aligned whole genome sequencing reads from three wild and three domesticated zebra finches[37] and all shared this premature stop codon. We also aligned RNA-Seq reads from five RA libraries[34] and four whole brain libraries[38,39] and observed in total only 7 mapped reads at this locus. Taken together, the extremely low expression and evidence for disruption of the coding sequence indicate that UTS2R3 is not a viable candidate receptor for UTS2B in the brain. We thus focused on just UTS2R1 and UTS2R5 for further study of receptor RNA localization.

Brain distribution of UTS2B in adult zebra finches

Using ISH with digoxigenin-labelled RNA probes, we mapped the expression of UTS2B RNA throughout the adult zebra finch brain, examining sections from 11 males and 16 females euthanized at midday. High densities of UTS2B-labelled cells were identified in several locations in the brainstem (Fig. 2), with no apparent sex differences. Labelled cells were especially abundant in motor nuclei of several cranial nerves, including the tracheosyringeal subdivision of the twelfth nerve nucleus (nXIIts, Fig. 2d), which innervates the syrinx and is thus directly involved in vocal control. We also detected brainstem cells expressing the UTS2 paralog (Fig. 2i). Brainstem expression of both UTS2 and UTS2B was detected early in juvenile development, within 12 h after hatching (Fig. S2).
Figure 2

Brainstem UTS2B and UTS2 gene expression. All photomicrographs are representative of male or female sagittal sections (no sex differences detected, number of observations is given in Table S1), showing UTS2B labelling (except UTS2 in panel i). (a) The nucleus of Edinger-Westphal (EW), the dorsal part of the nucleus of the oculomotor nerve (n3d), the ventral part of the nucleus of the oculomotor nerve (n3v), the nucleus of the trochlear nerve (n4), the red nucleus (Ru); (b) The principal sensory nucleus of the trigeminal nerve (n5p), several unnamed pons nuclei; (c) the magnocellular nucleus, MC; (d) The tracheosyringeal motor nucleus (nXIIts), the supraspinal nucleus (SSp); (e) The nucleus of the abducens nerve, n6; (f) Scattered in the pons; (g) the parvocellular part of the isthmic nucleus, Ipc; (h) the nucleus of the facial nerve, n7; (i) UTS2 expression in the pons; (j,k) Comparison of large UTS2B labelled cells in nXIIts [j] and smaller cells in HVC [k]. Scale bar = 250 μm (a–i) or 25 µm (j,k).

Brainstem UTS2B and UTS2 gene expression. All photomicrographs are representative of male or female sagittal sections (no sex differences detected, number of observations is given in Table S1), showing UTS2B labelling (except UTS2 in panel i). (a) The nucleus of Edinger-Westphal (EW), the dorsal part of the nucleus of the oculomotor nerve (n3d), the ventral part of the nucleus of the oculomotor nerve (n3v), the nucleus of the trochlear nerve (n4), the red nucleus (Ru); (b) The principal sensory nucleus of the trigeminal nerve (n5p), several unnamed pons nuclei; (c) the magnocellular nucleus, MC; (d) The tracheosyringeal motor nucleus (nXIIts), the supraspinal nucleus (SSp); (e) The nucleus of the abducens nerve, n6; (f) Scattered in the pons; (g) the parvocellular part of the isthmic nucleus, Ipc; (h) the nucleus of the facial nerve, n7; (i) UTS2 expression in the pons; (j,k) Comparison of large UTS2B labelled cells in nXIIts [j] and smaller cells in HVC [k]. Scale bar = 250 μm (a–i) or 25 µm (j,k). In the pallium (i.e., cortical homolog), a high density of UTS2B-positive cells occurred in two regions in adults: nucleus HVC, but only in males (Fig. 3a,c); and an arc-like portion of the caudo-dorsal arcopallium outside RA, in both sexes (Fig. 3a,d). In male HVC, labelled cells of <25 µm diameter were observed throughout the extent of the nucleus (1.5–2.9 mm from the midline), varying in staining intensity (Figs 2k, 3c). Labelled cells were also detected scattered throughout the nidopallium and occasionally detected within the mesopallium, lateral striatum and subpallial regions (Fig. 3b). Labelled cells were absent in white matter, including laminae, commissures and major fibre tracts, as well as in blood vessels, choroid plexus, ventricular system and pia mater. In stark contrast to UTS2B, expression of UTS2 was restricted to the brainstem (Fig. 2i).
Figure 3

Male Pallium UTS2B gene expression. (a) In situ hybridization image of lateral sagittal section showing labelled cells scattered throughout the pallium, with concentrations of labelled cells dorsally in HVC and in a caudal portion of the arcopallium excluding RA (rostral to the right, dorsal up). (b) Line drawing of section in panel a labelling major landmarks (A – arcopallium; H – hyperpallium; LSt – lateral striatum; M –mesopallium; N – nidopallium; the lateral ventricle indicated by thick line running adjacent to caudal and dorsal borders); dashed lines indicate insets shown at higher magnification in panels c and d. (c) High UTS2B gene expression within cells localized in HVC. (d) high UTS2B gene expression within cells localized to a caudal portion of the dorsal arcopallium (A), adjacent to the robust nucleus of the arcopallium (RA). Arrowheads point to the pallial/sub-pallial lamina (LPS) running just dorsally to the area of cellular labelling. Number of observations is given in Table S1; scale bar = 500 μm.

Male Pallium UTS2B gene expression. (a) In situ hybridization image of lateral sagittal section showing labelled cells scattered throughout the pallium, with concentrations of labelled cells dorsally in HVC and in a caudal portion of the arcopallium excluding RA (rostral to the right, dorsal up). (b) Line drawing of section in panel a labelling major landmarks (A – arcopallium; H – hyperpallium; LSt – lateral striatum; M –mesopallium; N – nidopallium; the lateral ventricle indicated by thick line running adjacent to caudal and dorsal borders); dashed lines indicate insets shown at higher magnification in panels c and d. (c) High UTS2B gene expression within cells localized in HVC. (d) high UTS2B gene expression within cells localized to a caudal portion of the dorsal arcopallium (A), adjacent to the robust nucleus of the arcopallium (RA). Arrowheads point to the pallial/sub-pallial lamina (LPS) running just dorsally to the area of cellular labelling. Number of observations is given in Table S1; scale bar = 500 μm. Using fluorescent immunohistochemistry with an antibody raised against the cyclic peptide CFWKYC (conserved in URP and UII of humans, rodents and birds) we detected clear evidence of a peptide within HVC (Fig. 4), which we interpret as URP given the robust expression of UTS2B RNA and the lack of UTS2 RNA in HVC. As expected for a neuropeptide, signal was concentrated in cytoplasm of discrete labelled cells in HVC (Fig. 4b) and diffusely present in neuropil (Fig. 4a). With the exception of nucleus RA (Fig. 4g), we detected little or no labelling in areas lacking evidence of RNA expression, such as song nucleus Area X (Fig. 4c), and no non-specific signal (e.g., autofluorescence) when the primary antibody was omitted (Fig. 4d). Conversely, we detected intense immunostaining in cell bodies within brainstem nuclei where the RNA is abundant, such as nXIIts and SSP (Fig. 4e,f). In nucleus RA, despite the absence of mRNA expression, we observed small brightly labelled puncta suggestive of URP concentration in synaptic terminals (Fig. 4g).
Figure 4

URP detection by immunohistochemistry. (a) Parasagittal section of caudal telencephalon showing increased immunostaining for URP in an oval area corresponding to nucleus HVC, immediately beneath the lateral ventricle. (b) Box inside HVC enlarged from panel a, showing cytoplasmic immunostaining pattern of a subset of cells (small inset, Hoechst counterstaining revealing all cell nuclei). (c) Field inside Area X, with negligible immunostaining. (d) Absence of primary antibody demonstrates negligible non-specific fluorescence (field inside HVC as in b). (e) Large labelled cells in brainstem nucleus nXIIts. (f) Large labelled cells in brainstem supraspinal nucleus (SSp). (g) Intense puncta of URP staining suggestive of synaptic terminals in RA. Bar = 100 µm (a) or 50 µm (b–g).

URP detection by immunohistochemistry. (a) Parasagittal section of caudal telencephalon showing increased immunostaining for URP in an oval area corresponding to nucleus HVC, immediately beneath the lateral ventricle. (b) Box inside HVC enlarged from panel a, showing cytoplasmic immunostaining pattern of a subset of cells (small inset, Hoechst counterstaining revealing all cell nuclei). (c) Field inside Area X, with negligible immunostaining. (d) Absence of primary antibody demonstrates negligible non-specific fluorescence (field inside HVC as in b). (e) Large labelled cells in brainstem nucleus nXIIts. (f) Large labelled cells in brainstem supraspinal nucleus (SSp). (g) Intense puncta of URP staining suggestive of synaptic terminals in RA. Bar = 100 µm (a) or 50 µm (b–g).

UTS2B-expressing cells in HVC project to song nucleus RA

Functionally distinct cell classes in HVC can be defined by their projections. To determine which cell classes express UTS2B, we injected a fluorescent tract-tracer (CTB-Alexa 488) into the two major targets of HVC, RA and Area X, to retrogradely label RA- or X-projecting neurons in HVC (Fig. 5, schematics on left). We then examined co-localization with UTS2B-expressing cells using fluorescent in situ hybridization. The vast majority of the identified RA-projecting neurons (97%; n = 117 out of 121 retrogradely-labelled cells from 2 RA-injected birds) showed co-localization with UTS2B expression (Fig. 5a), whereas only 4 cells showed tracer signal only. Furthermore, only 3 UTS2B-expressing cells in the fields examined showed no tracer deposit. Thus, essentially all UTS2B-expressing neurons in HVC correspond to RA-projecting neurons. In contrast, the vast majority of the identified X-projecting cells (97%; 64 out of 66 retrogradely-labelled cells from 2X-injected birds) showed no co-localization with UTS2B-expressing cells (Fig. 5b), whereas in only two cells did the tracer appear to co-localize with UTS2B expression. Conversely, only 2 out of 178 UTS2B-expressing cells in the HVC sections examined appeared to show co-localization with the tracer signal from Area X. Thus, we conclude that UTS2B is selectively expressed in the subpopulation of HVC neurons that project to RA, and not in neurons that project to area X. Because this experiment seemed to account for all UTS2B-expressing cells in HVC, we deemed it unnecessary to perform double-labelling in situs with GAD2 to exclude expression in GABAergic cells.
Figure 5

Selective expression of UTS2B in RA-, but not X-projecting HVC neurons. Schematics on the left depict injections of fluorescent tract-tracer (CTB-Alexa 488) into RA (top) or Area X (bottom), resulting in retrograde labelling of specific populations of projection neurons in HVC. (a) Retrogradely-labelled RA-projecting neurons (a, green) co-localize with UTS2B-expressing cells (a, blue), as confirmed by the merged image (a3). (b) Retrogradely-labelled X-projecting neurons (b1, green) do not co-localize with UTS2B-expressing cells (b, blue), as confirmed by the merged image (b). In all panels, arrowheads indicate location of individual backfilled neurons identified by characteristic donut-shaped cytoplasmic labelling that surrounds a nucleus (red, propidium iodide stain). UTS2B expression is revealed by fluorescent in situ hybridization with antisense riboprobes.

Selective expression of UTS2B in RA-, but not X-projecting HVC neurons. Schematics on the left depict injections of fluorescent tract-tracer (CTB-Alexa 488) into RA (top) or Area X (bottom), resulting in retrograde labelling of specific populations of projection neurons in HVC. (a) Retrogradely-labelled RA-projecting neurons (a, green) co-localize with UTS2B-expressing cells (a, blue), as confirmed by the merged image (a3). (b) Retrogradely-labelled X-projecting neurons (b1, green) do not co-localize with UTS2B-expressing cells (b, blue), as confirmed by the merged image (b). In all panels, arrowheads indicate location of individual backfilled neurons identified by characteristic donut-shaped cytoplasmic labelling that surrounds a nucleus (red, propidium iodide stain). UTS2B expression is revealed by fluorescent in situ hybridization with antisense riboprobes.

Brain distribution of Urotensin-2 Receptor transcripts

We mapped the brain expression of UTS2R1 and 5 with ISH, using adjacent sections from the same series used to map UTS2B expression in Fig. 3. UTS2R5 positive cells were labelled with less intensity in comparison to UTS2B, but high densities of UTS2R5 cells were detected in various brain regions. These areas included the hippocampal formation (Fig. 6b) and the dorsal nucleus of the hyperpallium (DNH) (Fig. 6c); rostral part of the medio-ventral arcopallium (Fig. 6d); the substantia nigra (Fig. 6e); two brainstem nuclei (n5p, Ipc) in which UTS2B was also abundant (Fig. 6f,g); and the lateral cerebellar nucleus (Fig. 6h). The overall distribution was similar in males and females, with no apparent sex differences. Notably, we did not detect expression of UTS2R5 within HVC itself (Fig. 6i), nor in the two song control nuclei that receive the projections from HVC (Fig. 6j,k). Lastly, we did not detect UTS2R1 expression in brain tissue, although the same riboprobe detected UTS2R1 expression in cardiac tissue (not shown). Scale bar = 20 µm.
Figure 6

UTS2R5 gene expression. In situ hybridization analysis. (a) Key for the figure, showing a schematic projection of labelled brain regions onto a 2-dimensional medial sagittal plane (note that these regions are distributed across multiple planes in the third medial-lateral dimension, not represented here); (b) labelling across the hippocampus (HP); (c) dorsal nucleus of the hyperpallium (DNH); (d) ventral medial arcopallium, rostral (AMVr); (e) substantia nigra (SN); (f) principal sensory nucleus of the trigeminal nerve (n5p); (g) the parvocellular part of the isthmic nucleus (Ipc); (h) the lateral nucleus of the cerebellum (CbL); (i–l) All four photomicrographs are from the same male that showed no visible UTS2R5 gene expression in [i] HVC, [j] RA, [k] area X, while having [l] high UTS2B gene expression in HVC. Photomicrographs [b–h] are representative of males and females (no sex differences detected; number of observations is given in Table S1). Scale bar = 250 μm.

UTS2R5 gene expression. In situ hybridization analysis. (a) Key for the figure, showing a schematic projection of labelled brain regions onto a 2-dimensional medial sagittal plane (note that these regions are distributed across multiple planes in the third medial-lateral dimension, not represented here); (b) labelling across the hippocampus (HP); (c) dorsal nucleus of the hyperpallium (DNH); (d) ventral medial arcopallium, rostral (AMVr); (e) substantia nigra (SN); (f) principal sensory nucleus of the trigeminal nerve (n5p); (g) the parvocellular part of the isthmic nucleus (Ipc); (h) the lateral nucleus of the cerebellum (CbL); (i–l) All four photomicrographs are from the same male that showed no visible UTS2R5 gene expression in [i] HVC, [j] RA, [k] area X, while having [l] high UTS2B gene expression in HVC. Photomicrographs [b–h] are representative of males and females (no sex differences detected; number of observations is given in Table S1). Scale bar = 250 μm.

Early emergence of male-specific UTS2B expression in HVC

The evidence presented so far shows that UTS2B is highly expressed not only in brainstem nuclei (as in other vertebrates) but also in a key telencephalic nucleus of the oscine vocal control system, where it marks a specific subset of neurons – those that form the HVC-RA projection, which in the zebra finch is present only in adult males. This provided an opportunity to examine when this subset of neurons first emerges in development. We therefore used ISH to assess UTS2B in both sexes at four ages: post-hatch days 10 and 15, before formation of the projection to RA; day 25, when the projection from HVC to RA is beginning to develop and HVC is morphologically similar in males and females; and adults, after HVC has largely regressed in females[17]. At all juvenile ages and in both sexes, high densities of UTS2B-labelled cells were detected in the caudodorsal arcopallium, as well as low densities in the caudolateral nidopallium. However, only males showed high densities of labelled cells within HVC at any age (Fig. 7). Labelled cells were present in males in the vicinity of the presumptive HVC as early as 10 dph, and the cellular distribution indicates an oval shaped nucleus by 15 dph. Thus male-specific UTS2B expression emerges prior to morphological sexual differentiation, and prior to functional maturation of the nucleus.
Figure 7

Developmental HVC UTS2B gene expression. Representative low power photomicrographs of the caudal forebrain in females (columns 1 and 2) and males (columns 3 and 4). Columns 2 and 4 show high power insets as indicated. Number of observations is given in Table S1; arcopallium – A; mesopallium - M; nidopallium - N; caudolateral nidopallium – NCL. Scale bars = 500 μm.

Developmental HVC UTS2B gene expression. Representative low power photomicrographs of the caudal forebrain in females (columns 1 and 2) and males (columns 3 and 4). Columns 2 and 4 show high power insets as indicated. Number of observations is given in Table S1; arcopallium – A; mesopallium - M; nidopallium - N; caudolateral nidopalliumNCL. Scale bars = 500 μm.

Evidence of UTS2B RNA expression in human inferior frontal cortex

On the basis of both functional criteria and connectivity, HVC has been considered analogous[5-8] to the portions of human inferior frontal cortex implicated in human speech and singing[40], comprising Brodmann areas 44 and 45, or respectively the opercular and triangular parts of the inferior frontal gyrus in the dominant (typically the left) hemisphere[41]. To assess whether UTS2B is expressed or enriched in these areas, we reviewed the microarray data for human brain gene expression made available through the Allen Brain Atlas[32]. Data are available for 55 sub regions of the frontal lobe, and UTS2B is annotated as enriched in three; one of the areas of enrichment is the opercular part of the right inferior frontal gyrus, although no enrichment is recorded for the left opercular or the triangular parts (Table S2).

Discussion

Here, for the first time in an organism with vocal learning ability, we have assessed the brain expression and genome organisation of urotensin family peptide genes and their receptors. Surveying the distribution of the RNA, we found a conserved pattern of UTS2B expression in the brainstem as in other vertebrates, involving many of the same motor nuclei as in rodents[31]. In the forebrain, however, the expression pattern diverged sharply. In the zebra finch we saw scattered UTS2B-positive cells throughout the forebrain with high concentrations in two discrete areas, whereas in the mouse expression has been reported for only occasional cells in a few areas including hypothalamus[31], with no areas of the mouse forebrain showing enriched local expression as we see in the zebra finch. Of particular interest, we observed highly concentrated UTS2B expression in the vocal control nucleus HVC, where UTS2B specifically and comprehensively marked the male-specific neuronal subpopulation that projects to vocal control output nucleus RA. These neurons in HVC form the critical vocal pre-motor projection of the song system, arguably analogous to Broca’s area projection to laryngeal motor cortex[6]. They encode timing features that provide critical temporal cues for learned song[10,42], undergo continuous replacement in adulthood[43-45], and possess a characteristic electrophysiological signature that differentiates them from other specific populations in HVC[46]. Whether UTS2B contributes to any of these particular properties remains to determined. A high density of UTS2B-expressing cells was also detected in the caudo-dorsal arcopallium in both sexes. A similar anatomical domain within arcopallium is defined by cholecystokinin (CCK) gene expression, although CCK and UTS2B expression patterns diverge outside the arcopallium (e.g., CCK RNA is absent from HVC)[47]. The avian arcopallium has complex functions and connections, and its internal organization is not yet well understood. In songbirds, portions of the arcopallium surrounding nucleus RA have been linked to the auditory pathways[48,49] as well as to both courtship behaviour[50] and song learning behaviour[51], although such domains are respectively rostro-ventral and lateral rather than caudal or dorsal to RA. To our knowledge, this caudo-dorsal domain has not yet been investigated in any functional studies, thus a possible role for UTS2B expression in this region remains to be determined. Taking advantage of recent improvements in the zebra finch genome assembly, we confirmed that there is a single UTS2B gene in zebra finch with a single paralog (UTS2) as in other vertebrates. Thus the novel expression of UTS2B in zebra finch telencephalon is not the result of avian lineage-specific gene duplication and divergence. Rather it must involve either an alternative pattern of UTS2B gene regulation, or alternative patterns of UTS2B-expressing cell survival and migration. Using UTS2B expression as a cell type-specific developmental marker, we were able to obtain new insight into mechanisms that underlie the unusual development of the critical HVC-RA projection. This projection forms surprisingly late in brain development, and then only in males, with fibres entering RA from HVC ~25 days after hatching[17,52]. Yet by other measures (Nissl staining, gene expression) HVC is already present as a nucleus in both sexes two weeks before this[18-21], and cells are already forming projections to Area X by 13 days post-hatch[18]. Both sexes initially appear to send fibres in the direction of RA, yet in females no fibres ever enter RA, and the Nissl-defined boundary of the female nucleus eventually recedes[17,52]. Our evidence now suggests a novel cellular explanation for both of these distinctive features, by revealing that the RA projection emerges from a discrete population of neurons that are found only in the male brain, even at early ages when the male and female HVC are superficially similar. It remains to be determined whether cells with equivalent potential are also present at this stage in the female brain (but have not differentiated to produce URP) or whether this represents a truly male-specific cell lineage. Exposure to estrogens in brain is necessary for formation of the projection in males[25], and estrogen treatment in the first few weeks after hatching will masculinize the female HVC ultimately leading to a functional RA projection[24,53]. Thus we hypothesize that sex steroids in the brain must trigger the early production or differentiation of a discrete population of cells in HVC, which are marked by UTS2B expression and responsible for the eventual successful innervation of RA. It will be interesting to determine if early masculinizing estrogen treatment also induces UTS2B expression in the female HVC. The UTS2B gene itself may respond directly to sex steroids; in rodents, its expression is regulated in spinal motor neurons by androgen exposure[54]. It is also one of 17 genes that are commonly up-regulated in HVC in canaries, robins and white crowned sparrows after androgen treatment to promote singing and growth of HVC[29,30]. What might be the function of UTS2B expression within the vocal control system? The UTS2B and UTS2 genes encode cyclic peptides that share a disulphide-linked motif (Cys-Phe-Trp-Lys-Tyr-Cys) and are conserved across vertebrates[35]. The UII peptide has been studied the most with respect to behavioural actions, but URP likely has similar effects since they both act on the same receptor (reviewed in[55] and[56]). Intracerebroventricular injections of UII in rats results in a gradual and long lasting increase in cerebral blood flow[57], an increase in locomotor activity[58] and anxiogenic behaviour[59], and effects on blood pressure and stress responses[58,60,61]. We speculate that UTS2B expression in HVC, and release in RA, might conceivably link vocal activity to vascular regulation. Consideration of UTS2B function and evolution also led us to assess the complement of urotensin receptor sequences expressed in zebra finch brain (Table 1, Fig. 1 and Supplementary Annotation file). Aided by an improved long-read assembly of the zebra finch genome as a reference[34], we obtained missing 5′ sequence for UTS2R5, confirmed the orthology of UTS2R1, and annotated a previously unidentified locus for UTS2R3 (which we classify as a pseudogene as the predicted peptide is truncated). The sole urotensin receptor in placental mammals is orthologous to UTS2R1, and is broadly expressed in the brain[56]. In zebra finch, we did not detect expression of UTS2R1 in brain, whereas UTS2R5 is expressed in brain with a similar broad pattern as the mammalian urotensin receptor. However, we also did not detect UTS2R5 within HVC, RA or Area X. As we do not find evidence of expression of the canonical urotensinergic receptors within HVC or its targets, we suggest that urotensin expressed in HVC may exert its functions through somatostatin receptors which can interact with urotensin peptides e.g.[62]. The RNA for SSTR1, for example, is detectable (though not enriched) in HVC and its major targets RA and X[63], and thus remains a possible mediator of UTS2B actions. Intriguingly, reviewing the data for expression in the human brain available through the Allen Brain Atlas[32], we found evidence for increased local expression of UTS2B RNA in Brodmann Area 44 (inferior frontal gyrus, opercular part, right side), which has been implicated in vocal production of melodic phrases and some aspects of prosody processing[40]. No enrichment is reported for the opercular or triangular parts of the left inferior frontal gyrus, which together are more typically considered as Broca’s area for speech and language generation. We speculate that this local enrichment in the right operculum could represent another example of convergent evolution of vocal control circuits in humans and songbirds[3]. The identification of UTS2B as a specific marker in songbird HVC may afford new experimental opportunities for monitoring and manipulating the development and function of a model vocal learning circuit.

Materials and Methods

Gene annotation

Manual annotation of urotensin receptor genes in the Tgut_diploid_1.0 long-read assembly[34] was conducted using Apollo Genome Annotator v. 2.0.7[64]. Annotations were supported by mRNA sequences retrieved from NCBI EST database[65] and aligned with exonerate version 2.3.0[66] modified to support gff3 output (https://github.com/hotdogee/exonerate-gff3). Additional support was derived from RNASeq evidence: 5 libraries derived from zebra finch song nucleus RA[67] (downloaded from http://gigadb.org/dataset/100311) and 4 brain libraries from NCBI Sequence Read Archive[68] (SRA accession SRX738987, SRX1616454, SRX1616455, SRX1616463), aligned with HiSat2 version 2.1.0[69]. Genomic sequence for the premature stop codon in UTS2R3 was confirmed by aligning genomic sequences from 3 wild and 3 domesticated individuals[37] (ENA[70] accession ERX1092185-ERX1092187 and ERX1092180-ERX1092182) with BWA-MEM version 0.7.17. BAM files were sorted and indexed with SAMtools version 1.6.

Synteny analysis

Synteny comparisons are manually compiled from current annotations for chicken (Gallus_gallus-5.0, GCF_00002315.4, annotation release 104), zebra finch (Taeniopygia_guttata-3.2.4, GCF_000151805.1, annotation release 103, and manual annotation described as above), peregrine falcon (F_peregrinus_v1.0, GCF_000337955.1, annotation release 101), Saker falcon (F_cherrug_v1.0, GCF_000337975.1, annotation release 101), great tit (Parus_major1.1, GCF_001522545.2, annotation release 101), Bengalese finch (also known as white-rumped munia, LonStrDom1, GCF_002197715.1, annotation release 100), budgerigar (Melopsittacus_undulatus_6.3, GCF_000238935.1, annotation release 102), canary (SCA1, GCF_000534875.1, annotation release 101), and collared flycatcher (FicAlb1.5, GCF_000247815.1, annotation release 101), visualised with NCBI Genome Data Viewer v. 4.3[65].

Birds

In the UK, zebra finches (Taeniopygia guttata) were housed at Queen Mary University of London in large free flight social aviaries, kept on a 14 - hour light/10-hr dark cycle and were provided food and water ad libitum. Animal housing and welfare were in compliance with the European directives for the protection of animals used for scientific purposes (2010/63/EU). The Named Animal Care and Welfare Officer for Queen Mary University of London oversaw the housing and routine care. Experiments in UK were performed under Procedures Project License PPL70–8183. In USA, zebra finches were housed at OHSU following NIH guidelines for the use and care of animals in research and all procedures were approved by OHSU’s Institutional Animal Care Use Committee (IACUC).

Surgery and tracer injection (USA)

Two adult male zebra finches were anesthetized by an intramuscular injection of 40 mg/kg Nembutal (Sodium pentobarbital), and then placed in a stereotaxic apparatus. In each bird, tracer injections were made into Area X in one hemisphere, and RA in the opposite hemisphere, with hemispheres alternated across birds, as follows. Feathers were removed from the head, and a midline incision to the skin was made to reveal the skull. Depending upon the injection target, a small craniotomy was made above the tracer injection site. Cholera Toxin Subunit B conjugated to Alexa Fluor 488 (CTB-Alexa; 1% in water), a retrograde tracer, was pressure injected (10–50 nL) through a glass pipette into either nucleus RA or Area X, depending upon the experiment. To maximize the number of backfilled cells in HVC, a series of large injections were made into each nucleus at different depths. Animals were allowed to survive for 4–5 days and then were euthanized by decapitation. Brains were quickly removed, blocked along the midline (parasagittal plane), and flash frozen in TissueTek O.C.T. Compound (Sakura Finetek) in a dry ice/isopropanol bath. Parasagittal (10 µm) brain sections were cut on a cryostat, thawed onto microscope slides (Superfrost plus; Fisher Scientific, Pittsburg, PA), and stored at −80 °C for in situ hybridization.

Sex determination

The sex of juvenile animals taken prior to the age of external sexual differentiation was determined from blood taken post-mortem, by PCR targeting the sex-linked CHD (chromohelicase-DNA-binding) gene, which has different intronic lengths on the two sex chromosomes (Z and W)[71].

Tissue collection and processing

Bird were killed by decapitation, and whole brains were dissected, embedded in O.C.T compound, and rapidly frozen in a slurry of isopropanol and dry ice within 5 minutes. Tissues were stored at −80 °C prior to sectioning. Brains were sectioned in coronal or sagittal planes at 10 µm and collected onto Superfrost Plus slides and fixed with fresh 3% paraformaldehyde in PBS (pH 7.4) for 5 minutes. Slides were then rinsed in PBS (pH 7.4), dehydrated in an ascending ethanol series (70%, 95%, 100%; 2 min each), air dried, and stored at − 80 °C.

Plasmid templates for riboprobe synthesis

A clone (Genbank: DV945629) corresponding to UTS2B was obtained from the ESTIMA zebra finch brain cDNA collection[72]. Templates to produce probes for other targets were cloned via reverse transcription-polymerase chain reaction (RT-PCR) using primers designed with Primer-BLAST[73]: UTS2 (517 bps, Genbank: MH071741) forward primer GACACAACGGAACGTCCAATA and reverse primer CATAGAGTCTAAAGTTTGGCGCTG; UTS2R5 (371 bps, Genbank: MH071743), forward primer GCAACTTCTACAGGTTCACGTC and reverse primer AGGATTTGTCCCGAACTGC; UTS2R1 (517 bps, Genbank: MH071742), forward primer AGCAGTGGGTACTTCCAGAG and reverse primer ACAACTACAAATTTAGCACTGCTGC. Purified RT-PCR products were subcloned into TOPO-pCRII plasmids using the TOPO TA cloning kit (Life Technologies), using zebra finch whole brain RNA (Qiagen RNeasy Kit) as template. UTS2R1 and UTS2R5 probe sequences were aligned with Jalview 2.10.2b1[74]. All clones used for ISH were verified by BLAT or BLAST to align to a single locus in the zebra finch genome.

In Situ Hybridisation (ISH)

Digoxygenin-(DIG)-riboprobes were synthesized and hybridized to brain sections using previously established protocols[75]. In brief, isolated plasmid DNA was restriction enzyme digested (BssHII, BamHI, or EcoRV; New England Biolabs; Ipswich, MA) to release the insert template, and twice purified with Qiagen’s PCR purification kit (Qiagen Inc., Valencia, CA) or GeneJet PCR purification kit (Thermo Fisher Scientific, Loughborough, UK). Antisense and sense probes were synthesized at 37 °C for 2 hours using the appropriate T3 or T7 RNA Polymerase (Promega, Madison, WI), and purified by Sephadex G-50 columns. Probes were applied to sections for overnight hybridization followed by washes, as described[75]. Hybridization specificity was confirmed by demonstration of contrasting patterns obtained with different probes, and absence of signal with omission of labelled probe. For further anatomical analysis, adjacent sections were counterstained using Hematoxylin and Eosin (H&E). All slides were coverslipped with Histomount (ThermoFisher Scientific).

Imaging and Identification of DIG-labelled cells

ISH images were digitised with the NanoZoomer whole slide scanner (Hamamatsu, Japan). NDP.view2 software (Hamamatsu) was used to examine sections as well as to export TIFF images for figures. The ZEBrA finch brain atlas (Oregon Health & Science University, Portland, OR 97239; http://www.zebrafinchatlas.org) was used as a reference to identify annotated sub regions within the telencephalon (pallium, subpallium), diencephalon (thalamus, hypothalamus), mesencephalon (midbrain), metencephalon (pons, cerebellum), and myelencephalon (medulla) for all ISH sagittal sections, ranging 0–4.8 mm from the midline using the right or left hemispheres. Each section was compared to 1 of 18 reference sections in the ZEBrA Atlas in order to determine lateral distance from midline (0–4.8 mm) and the neuroanatomical name of the region. Cells were considered DIG-labelled if dark purple/brown circles (donut-shaped) were seen at high power indicating cytoplasmic labelling.

Fluorescent In situ hybridization (FISH)

The method used for fluorescent ISH was essentially as described[75] except the slides were developed for detection of fluorescent probes (Fig. 5). Briefly, slides were hybridized, washed and blocked[75] for 30 min then incubated for 2 hours in TNB (100 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.3% Triton X-100, 0.1% skim milk) with a horseradish peroxidase conjugated anti-DIG antibody (anti-DIG-HRP; 1:1500; Roche Applied Science). Slides were then washed 3 times for 5 min at RT in TNT (100 mM Tris-HCl pH9.5, 150 mM NaCl, 0.3% Triton X-100), and then incubated at room temperature for 1 hr with Alexa 350-conjugated-tyramide in amplification buffer (1:100 dil.; Invitrogen, Carlsbad, CA) according to the manufacturer’s recommended protocol. Slides were then washed 3 times for 5 min at RT in TNT, counterstained with propidium iodide (1 mg/ml in TNT), and coverslipped with Aquamount (Thermoscientific). Appropriate controls, including using sense strand probes or omitting riboprobes altogether were routinely incorporated to the hybridizations, and yielded no detectable signals.

FISH and retrograde tracer co-localization

To assess the co-localization of UTS2B with HVC’s Area X- and RA-projecting cells we first Nissl stained brain sections obtained from the birds that received retrograde tracer injections into Area X or RA, and identified a range of brain sections that contained nucleus HVC (~1.7–2.7 mm from the midline). We next performed FISH using sections through HVC and antisense riboprobe for UTS2B. Co-localization of fluorescent retrograde tract tracer and in situ signal was assessed under high power (100X) using fluorescence optics on a Nikon E600 microscope and Neurolucida for cell mapping and counts. To assess co-localization, we identified individual retrogradely-labelled neurons based on the presence of characteristic “donut shaped” pattern of labelling, indicative of cytoplasmic distribution, that surrounded a nucleus (in red based on counterstaining with propidium iodide). Next, we assessed whether the UTS2B-expressing cells (blue in situ signal) co-localized with the retrogradely-labelled cells (green retrograde tracer signal). For each hybridization to a brain section obtained from an Area X or RA backfill we counted between 50–100 cells, and calculated the proportion of retrogradely-labelled cells that co-expressed UTS2B. High-power fluorescent photomicrographs (100X) were obtained using a Digital camera (DVC co., Austin, TX) coupled to a Nikon E600 microscope. Photoshop-CC 2018 (Adobe Systems Inc., San Jose, CA) was used to adjust the color, color balance, and contrast of photomicrographs. Figures were prepared in Illustrator CC 2018 (Adobe Systems Inc.) or Powerpoint 2017 (Microsoft).

Immunohistochemistry for URP

The immunostaining was carried out similarly to previously described[76]. Briefly, naïve adult male zebra finches were deeply anaesthetised with sodium pentobarbital, then flushed with saline and perfused intracardially with 4% paraformaldehyde. After at least 2 days submerged in 20% sucrose, the left brain hemisphere was cut sagittally at 20 µm using a cryostat and thaw-mounted onto gelatinised coated slides. Antigen unmasking solution (H-3300, Vector lab) was used prior to overnight incubation with rabbit anti-urotensin II related peptide (1:200, H-071-17, Phoenix Pharmaceuticals, Inc) in a 10 mM phosphate-buffered saline solution containing 0.5% Triton X-100 and 0.05% sodium azide. The secondary antibody, donkey anti-rabbit Alexafluor 488 was incubated for 2 h before washed and coverslipped with Vectashield. Immunofluorescence was captured digitally on a Zeiss microscope using the HiPic 9 software.

Assessment of expression data from Allen Brain Atlas

The human brain microarray dataset[32] was downloaded using the Harmonizome resource[77]. The dataset provides the mean mRNA expression profiles for each of 17979 genes across 414 brain structures, derived from microarray analysis of 6 adult human brain sample sets. As described[32], the structures are identified and classified using an anatomical ontology, and RNAs are identified as locally enriched in a particular area if the expression signal is at least 2-fold higher than measured in surrounding or complementary structures. We filtered the data to extract the 55 structures that comprise the frontal lobe, and present the results in Supplementary Table S2. Supplemental Materials
  76 in total

1.  Estrogen synthesis in the male brain triggers development of the avian song control pathway in vitro.

Authors:  C C Holloway; D F Clayton
Journal:  Nat Neurosci       Date:  2001-02       Impact factor: 24.884

2.  An ultra-sparse code underlies the generation of neural sequences in a songbird.

Authors:  Richard H R Hahnloser; Alexay A Kozhevnikov; Michale S Fee
Journal:  Nature       Date:  2002-09-05       Impact factor: 49.962

3.  Central effects of urotensin-II following ICV administration in rats.

Authors:  J Gartlon; F Parker; D C Harrison; S A Douglas; T E Ashmeade; G J Riley; Z A Hughes; S G Taylor; R P Munton; J J Hagan; J A Hunter; D N Jones
Journal:  Psychopharmacology (Berl)       Date:  2001-06       Impact factor: 4.530

Review 4.  Birdsong and human speech: common themes and mechanisms.

Authors:  A J Doupe; P K Kuhl
Journal:  Annu Rev Neurosci       Date:  1999       Impact factor: 12.449

5.  Human urotensin-II is a potent vasoconstrictor and agonist for the orphan receptor GPR14.

Authors:  R S Ames; H M Sarau; J K Chambers; R N Willette; N V Aiyar; A M Romanic; C S Louden; J J Foley; C F Sauermelch; R W Coatney; Z Ao; J Disa; S D Holmes; J M Stadel; J D Martin; W S Liu; G I Glover; S Wilson; D E McNulty; C E Ellis; N A Elshourbagy; U Shabon; J J Trill; D W Hay; E H Ohlstein; D J Bergsma; S A Douglas
Journal:  Nature       Date:  1999-09-16       Impact factor: 49.962

6.  The sexually dimorphic expression of androgen receptors in the song nucleus hyperstriatalis ventrale pars caudale of the zebra finch develops independently of gonadal steroids.

Authors:  M Gahr; R Metzdorf
Journal:  J Neurosci       Date:  1999-04-01       Impact factor: 6.167

7.  Central control of song in the canary, Serinus canarius.

Authors:  F Nottebohm; T M Stokes; C M Leonard
Journal:  J Comp Neurol       Date:  1976-02-15       Impact factor: 3.215

8.  Revised nomenclature for avian telencephalon and some related brainstem nuclei.

Authors:  Anton Reiner; David J Perkel; Laura L Bruce; Ann B Butler; András Csillag; Wayne Kuenzel; Loreta Medina; George Paxinos; Toru Shimizu; Georg Striedter; Martin Wild; Gregory F Ball; Sarah Durand; Onur Güntürkün; Diane W Lee; Claudio V Mello; Alice Powers; Stephanie A White; Gerald Hough; Lubica Kubikova; Tom V Smulders; Kazuhiro Wada; Jennifer Dugas-Ford; Scott Husband; Keiko Yamamoto; Jing Yu; Connie Siang; Erich D Jarvis; Onur Gütürkün
Journal:  J Comp Neurol       Date:  2004-05-31       Impact factor: 3.215

9.  Urotensin II acts centrally to increase epinephrine and ACTH release and cause potent inotropic and chronotropic actions.

Authors:  Anna M D Watson; Gavin W Lambert; Kathryn J Smith; Clive N May
Journal:  Hypertension       Date:  2003-07-28       Impact factor: 10.190

10.  Intracerebroventricular administration of urotensin II promotes anxiogenic-like behaviors in rodents.

Authors:  Yoshio Matsumoto; Michiko Abe; Takuya Watanabe; Yuka Adachi; Takahiko Yano; Hideki Takahashi; Tsukasa Sugo; Masaaki Mori; Chieko Kitada; Tsutomu Kurokawa; Masahiko Fujino
Journal:  Neurosci Lett       Date:  2004-03-25       Impact factor: 3.046

View more
  1 in total

1.  Cellular transcriptomics reveals evolutionary identities of songbird vocal circuits.

Authors:  Bradley M Colquitt; Devin P Merullo; Genevieve Konopka; Todd F Roberts; Michael S Brainard
Journal:  Science       Date:  2021-02-12       Impact factor: 47.728

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.