Literature DB >> 30689773

De novo whole-genome assembly in Chrysanthemum seticuspe, a model species of Chrysanthemums, and its application to genetic and gene discovery analysis.

Hideki Hirakawa1, Katsuhiko Sumitomo2, Tamotsu Hisamatsu2, Soichiro Nagano1,3, Kenta Shirasawa1, Yohei Higuchi4, Makoto Kusaba5, Masaji Koshioka6, Yoshihiro Nakano2, Masafumi Yagi2, Hiroyasu Yamaguchi2, Kenji Taniguchi5, Michiharu Nakano5, Sachiko N Isobe1.   

Abstract

Cultivated chrysanthemum (Chrysanthemum morifolium Ramat.) is one of the most economically important ornamental crops grown worldwide. It has a complex hexaploid genome (2n = 6x = 54) and large genome size. The diploid Chrysanthemum seticuspe is often used as a model of cultivated chrysanthemum, since the two species are closely related. To expand our knowledge of the cultivated chrysanthemum, we here performed de novo whole-genome assembly in C. seticuspe using the Illumina sequencing platform. XMRS10, a C. seticuspe accession developed by five generations of self-crossing from a self-compatible strain, AEV2, was used for genome sequencing. The 2.72 Gb of assembled sequences (CSE_r1.0), consisting of 354,212 scaffolds, covered 89.0% of the 3.06 Gb C. seticuspe genome estimated by k-mer analysis. The N50 length of scaffolds was 44,741 bp. For protein-encoding genes, 71,057 annotated genes were deduced (CSE_r1.1_cds). Next, based on the assembled genome sequences, we performed linkage map construction, gene discovery and comparative analyses for C. seticuspe and cultivated chrysanthemum. The generated C. seticuspe linkage map revealed skewed regions in segregation on the AEV2 genome. In gene discovery analysis, candidate flowering-related genes were newly found in CSE_r1.1_cds. Moreover, single nucleotide polymorphism identification and annotation on the C. × morifolium genome showed that the C. seticuspe genome was applicable to genetic analysis in cultivated chrysanthemums. The genome sequences assembled herein are expected to contribute to future chrysanthemum studies. In addition, our approach demonstrated the usefulness of short-read genome assembly and the importance of choosing an appropriate next genome sequencing technology based on the purpose of the post-genome analysis.
© The Author(s) 2019. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Entities:  

Keywords:  zzm321990 Chrysanthemum seticuspezzm321990 ; flowering genes; genome sequence assembly; linkage map

Mesh:

Year:  2019        PMID: 30689773      PMCID: PMC6589549          DOI: 10.1093/dnares/dsy048

Source DB:  PubMed          Journal:  DNA Res        ISSN: 1340-2838            Impact factor:   4.458


1. Introduction

Cultivated chrysanthemum (Chrysanthemum morifolium Ramat.), which is produced either as cut flowers or potted and garden plants, is an herbaceous perennial in the family Asteraceae (Compositae). Chrysanthemum was first cultivated in China and developed for horticultural purposes in East Asia. Soon after the discovery of the response of plants to day length, i.e. ‘photoperiodism’, it was determined that the flowering time of this short-day (SD) plant could be controlled for year-round commercial production by manipulating the day length using blackouts or artificial lighting. Chrysanthemum has also been used in classical physiological studies of photoperiodism, leading to the proposal that floral stimuli (florigens) and floral repressors (antiflorigens) are synthesized in the leaves under inductive/non-inductive photoperiods., Recent studies have demonstrated that FLOWERING LOCUS T (FT) and its orthologues act as florigens in several species, including chrysanthemum. In 2013, an antiflorigen (CsAFT) was first discovered in a wild chrysanthemum by using a reverse-genetic approach. An ultra-dense linkage map was recently constructed in cultivated chrysanthemum,, but the complex genome structure of the cultivated chrysanthemum, such as hexaploidy (2n = 6x = 54), along with the large genome size and self-incompatibility, have obstructed genetic studies on horticulturally and physiologically important characteristics. The genus Chrysanthemum found in Japan includes 32 species ranging from diploid (2n = 2x = 18) to decaploid (2n = 10x = 90). Diploid C. seticuspe (Maxim.) Hand.-Mazz., a wild relative of chrysanthemum, is closely related to cultivated chrysanthemum, with both plants being herbaceous perennial, SD responsive and self-incompatible. Although C. seticuspe is generally not thought to be a direct progenitor of the cultivated chrysanthemum, since it is suggested that cultivated chrysanthemum is derived from hybridization between other chrysanthemum species,, it is considered a model species of cultivated chrysanthemum and is thus used for molecular-genetic and physiological analysis. The recent advances in next genome sequencing (NGS) technology have brought de novo whole-genome sequencing to various organisms. The sequencing cost has been dramatically decreasing while the quality of the assembled sequences has been increasing along with the growth of long-read sequencing technologies. However, de novo whole-genome sequencing is still costly in species with large genomes, and thus many of these species have not benefitted from the new NGS technologies. In this study, we performed de novo whole-genome assembly in C. seticuspe by using only the Illumina sequencing platform to achieve low cost assembly. Based on the assembled genome, gene discovery analysis was conducted for genes related to flowering, which is the most important trait in chrysanthemum. Genetic analysis was also performed such as linkage map construction, comparative phylogenetic investigation between C. seticuspe and other species, and identification of single nucleotide polymorphisms (SNPs) of cultivated chrysanthemum. Our approach suggests a potential strategy for advancing genetic and genomic studies in species that are not candidates for high quality de novo whole-genome assembly due to biological or other difficulties.

2. Materials and methods

2.1. Plant materials

Three C. seticuspe accessions, AEV2, NIFS-0 and NIFS-3, were used in this study. AEV2 is a natural self-compatible mutant that was selfed for five generations to reduce genomic heterogeneity. The resultant line, XMRS10, was used for the whole-genome DNA sequencing. Linkage maps were constructed based on an F1 mapping population generated from a cross between NIFS-0 and AEV2. NIFS-3 was used for genome size estimation by flow cytometry and for transcript sequencing for simple sequence repeat (SSR) marker development for linkage map construction. The genome size of NIFS-3 was estimated in comparison with those of Arabidopsis thaliana ‘Columbia’, Oryza sativa ‘Nipponbare’, Dianthus caryophyllus ‘Francesco’, Ipomoea nil ‘Murasaki’, Eustoma grandiflorum ‘Piccorosa snow’ and Zea mays ‘Honey Bantam Peter 610’ by flow cytometry. Nuclei suspensions of young leaves were prepared using a solution of CyStain PI Absolute P (Partec GmbH, Münster, Germany) added to 2% PVP (polyvinylpyrrolidone)and 15 mM DTT (dithiothreitol) according to the manufacturer’s instructions and analysed with a PAS flow cytometer with 532 nm laser excitation.

2.2 Whole-genome sequencing and assembly

Total cellular DNA of XMRS10 was extracted from young leaves by using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used for construction of paired-end (PE) and mate-pair (MP) libraries. The expected insert size of the PE libraries was 500 bp, and sequences were generated by Illumina HiSeq 2000 and MiSeq (Illumina, San Diego, CA, USA) with read lengths of 101 and 301 nt, respectively (Supplementary Table S1a). Four MP libraries were constructed with expected insert sizes of 2, 5, 10 and 15 Kb and sequenced by HiSeq 2000 with a read length of 101 nt. Sequenced bases with quality scores less than 10 were filtered by PRINSEQ 0.20.4 (see Supplementary Table S2 for information on the bioinformatic tools used in this study), and adaptor sequences in the reads were trimmed using fastx_clipper from the FASTX-Toolkit 0.0.13. The genome size of XMRS10 was estimated by using Jellyfish ver. 1.1.6 based on a k-mer = 17 frequency. The MiSeq PE reads were assembled by SOAPdenovo2 rev 240 with k-mer = 127, and the gaps were closed by GapCloser 1.10 (P = 31, Supplementary Fig. S1). The resultant sequences were subjected to scaffolding with the MP reads using SSPACE2.0 with the parameters of −k 3 and −x 0. The gaps of the scaffolds were closed by GapFiller with the HiSeq PE reads. Potential contaminated sequences on the assembled scaffolds were identified and removed using BLASTN searches against the chloroplast and mitochondrial genome sequence of A. thaliana (accession numbers: NC_000932.1 and NC_001284.2), against the human (hg19, https://genome.ucsc.edu/), fungal and bacterial genome sequences registered in NCBI (http://www.ncbi.nlm.nih.gov), against vector sequences from UniVec (http://www.ncbi.nlm.nih.gov/tools/vecscreen/univec/) and against PhiX (NC_001422.1) sequences with E-value cutoffs of 1E-10 and length coverage > 10%. The resultant draft genome sequences were designated CSE_r1.0. Assembly quality was assessed by benchmarking universal single-copy orthologs (BUSCOs) using BUSCO v3.0 software. Known repetitive sequences registered in Repbase and de novo repetitive sequences defined by RepeatModeler 1.0.11 were identified by RepeatMasker 4.0.7.

2.3. Transcript sequencing, gene prediction and annotation

Total RNAs were extracted from a total of 35 samples of XMRS10 grown under various conditions (Supplementary Table S3). Total RNA was extracted from shoot tips, leaves, young buds, flowers and roots using RNAiso Plus (Takara Bio, Shiga, Japan) followed by an RNeasy Mini Kit (Qiagen) for purification according to the manufacturer’s instructions and LiCl precipitation for the polysaccharide removal if necessary. Libraries were constructed by using a TruSeq standard mRNA HT sample prep kit (Illumina), and sequences were obtained by HiSeq 2000. Evidence-based gene prediction was first performed by BRAKER1 with the obtained transcript reads and the assembled genome sequences (Supplementary Fig. S2). The predicted genes were used as a training set for ab initio gene prediction by Augustus in the MAKER-P pipeline, along with the additional training sets derived from the following amino acid sequences: A. thaliana (TAIR10, https://www.arabidopsis.org/); D. caryophyllus (DCA_r1.0); Petunia axillaris (v1.6.2); Solanum lycopersicum (ITAG3.2); Populus trichocarpa (v3.0); O. sativa (IRGSP-1.0); Solanum tuberosum (PGSC DM v3.4); and Nelumbo nucifera (http://lotus-db.wbgcas.cn, downloaded June 2016). In parallel, evidence-based gene prediction was performed by mapping the C. seticuspe transcript reads onto the assembled genome sequences using the Tophat-Cufflinks pipeline and merged with the results of ab initio gene prediction by the MAKER-P pipeline. The resultant sequences were filtered by sequence length and annotation edit distance (AED) score, and then subjected to homology searches against the NCBI NR database (http://www.ncbi.nlm.nih.gov) and A. thaliana in TAIR11 using BLASTP with an E-value cut-off of 1E-20. Domain search was conducted by InterProScan against the InterPro database with an E-value cutoff of 1.0. Transposable elements (TEs) were identified by BLAST searches against the NCBI NR database and domain searches against InterPro and GyDB 2.0 with an E-value cutoff of 1.0. The sets of sequences showed significant similarity against the databases, with the exception that TEs were designated as CSE_r1.1_cds. Functional analysis of coding DNA sequences (CDSs) in CSE_r1.1_cds was performed by classifying the sequences into the plant gene ontology (GO) slim categories and the ‘euKaryotic clusters of Orthologous Groups’ (KOG) categories, and mapping onto the Kyoto Encyclopaedia of Genes and Genomes (KEGGs) reference pathways. Transfer RNA genes were predicted using tRNAscan-SE ver. 1.23 with default parameters. rRNA genes were predicted by BLAST searches with an E-value cutoff of 1E-10. The A. thaliana 5.8S and 25S rRNAs (accession number: X52320.1) and 18S rRNA (accession number: X16077.1) were used as query sequences.

2.4. Gene discovery analysis related to flowering

The genes related to flowering of C. seticuspe were identified based on the BLAST searches and OrthoMCL analysis (see below). The amino acid sequences of flowering pathway genes of Arabidopsis were used as query for tblastn search against CSE_r1.1_cds and CSE_r1.1_maker_cds. The phylogenetic tree of the phosphatidylethanolamine-binding proteins (PEBPs) was constructed using the Neighbour-Joining method in MEGA7 software based on the amino acid sequences of PEBP from the plant species, Al: Arabidopsis lyrate, Am: Antirrhinum majus, At: A. thaliana, Bv: Beta vulgaris, Ci: Citrus unshiu, Cs: Chrysanthemum seticuspe; Ej: Eriobotrya japonica, Fv: Fragaria vesca, Gm: Glycine max, In: Ipomoea nil, Le: Lycopersicon esculentum, Lp: Lolium perenne, Md: Malus × domestica, Nt: Nicotiana tabacum, Os: O. sativa, Pc: Pyrus communis, Pn: Populus nigra, Pp: Physcomitrella patens, Ps: Pisum sativum, Ro: Rosa chinensis, Sm: Selaginella moellendorfii, Ta: Triticum aestivum and Vv: Vitis vinifera. Bootstrap values for 1,000 resampling are shown on each branch. Of the investigated candidate genes, three genes—CEN-like (Cse_sc005398.1_g060.1), CsAFL1 and CsFL—were subjected to gene expression analysis in rosette-forming C. seticuspe line NIFS-3. The rosette-forming plants were divided into two groups, a non-chilled group and a chilled (5°C, 4 weeks) group. After growing the plants under the respective conditions (Supplementary Fig. S3), shoot tips from each group were sampled for RNA extraction. Total RNA were extracted with an RNA extraction plant mini kit (Qiagen). The expression levels of the three genes were investigated using quantitative real-time PCR. The primers used were as follows. For the CEN-like gene: qRT-f, AGGATTCATCAATCCATGTG; and qRT-r, CCTCCGTGAATATCAACCCG; for CsAFL1 (the AP1/FUL-like gene): CsAFL1-QF, TGATCCCTACATCAGTGCTCCA; and CsAFL1-QR: CAAGGGGGCAAGACTATTGATG; and for CsFL (a homologue of LEAFY): CsFL-QF, CTTTGTCATGCTGAACGGAGTG; and CsFL-QR, GAGCATATGACCAACACCACCA. CsACTIN (AB770470) was used as an internal standard to normalize raw data.

2.5. Linkage-map construction

Linkage maps were constructed based on a F1 mapping population generated as a cross between NIFS-0 and AEV2. SNP genotyping by ddRAD-Seq analysis was performed for 84F1 individuals and the parental lines as described by Shirasawa et al. The ddRAD-Seq libraries were constructed with a combination of restriction enzymes, PstI and MspI and sequenced by MiSeq with a read length of 251 nt. The reads were mapped onto CSE_r1.0 by Bowtie2, and variant calls were performed by SAMtools 0.1.19 and VarScan 2.3 as described by Shirasawa et al. The candidate SNPs were filtered under the following conditions: exclude in/dels, minimum depth = 5, minimum quality = 10, max missing = 0.5, minor allele frequency = 0.2, polymorphic between the parental lines, and exclude AEV2 = Alt (alternative) homozygous. Segregation analysis was also performed using the SSR markers developed in this study. A total of 4,056,757 transcript sequences of leaves and shoot apices of NIFS-3 were obtained by Roche 454 FLX (Roche Diagnostics, Indianapolis, IN, USA) and assembled by Newbler 2.6 (Roche Diagnostics). SSR motifs on the assembled sequences were identified using SciRoKo software and the Fuzznuc tool from EMBOSS. Primers were designed by Primer3 for the SSRs that had 8, 5, 4, 3 and 3 repeats in the di-, tri-, tetra-, penta- and hexa-motifs, respectively. Polymorphic analysis of the SSR markers was performed using an ABI 3730xl fluorescent fragment analyser (Applied Biosystems, Foster City, CA, USA) or 10% polyacrylamide gel electrophoresis according to Isobe et al. For linkage analysis, the segregating SNPs were grouped using MSTmap with the following parameters: cut-off P-value = 1, no map size = 0; the SSR loci were separately grouped by JoinMap 4. Then, correspondent SNP and SSR linkage groups (LGs) were identified and integrated based on segregation patterns in the mapping population. The segregation data was categorized into two parent-specific datasets and ordered by JoinMap 4 under the following conditions: Kosambi’s mapping function, LOD (logarithm of the odds) >1.0, REC frequency < 0.4, goodness of fit jump threshold for removal of loci = 5.0, number of added loci after which a ripple is performed = 1, and third round = yes.

2.6. Comparative and phylogenetic analysis

The translated protein sequences of CSE_r1.1_cds were clustered by OrthoMCL with those of A. thaliana (Araport11, https://www.araport.org/data/araport11/), S. lycopersicum (tomato, ITAG3.2),Lactuca sativa (lettuce, Lsativa_467_v5, http://lgr.genomecenter.ucdavis.edu/) and Helianthus annuus (sunflower, Ha412v1r1_port_v1.0) with the parameters c = 0.6 and aL = 0.9. The phylogenetic analysis was performed by MEGA 7.0.9 beta and TIMETREE based on the single copy genes conserved in C. seticuspe and the four species. The divergence time of 104 MYA between A. thaliana and S. lycopersicum was used for calibration. The published sequence read archive (SRA) transcripts for six cultivated chrysanthemum (C. × morifolium) varieties were mapped onto CSE_r1.0 by TopHat v2.1.1 (Supplementary Table S1b) in order to investigate the mapped ratios and identify variants. Variants were called based on the mapping result using SAMtools 0.1.19 and subsequently filtered using VarScan 2.3. SNP effects on gene function were predicted by using SnpEff ver.4.0.

3. Results and discussion

3.1. Whole-genome sequencing and assembly of C. seticuspe

A total of 94.2 Gb of MiSeq PE and 137.5 Gb of HiSeq PE reads were subjected to k-mer frequency analysis (Supplementary Fig. S4). Two peaks were observed in the distribution of the number of distinct k-mers at a given multiplicity distribution. Based on the multiplicity value of the higher peak (multiplicity = 67), the genome size of XMRS10 was estimated as 3.06 Gb. This estimated genome size was close to 2.90 ± 0.03 Gb, which was the estimated genome size of NIFS-3 by flow-cytometry analysis. The large difference in height between the two peaks (multiplicity = 67 and 134) suggests that most of the XMRS10 genome is homozygous; however, heterozygous regions still remain after selfing five times from AEV2. The 94.2 Gb MiSeq PE reads were assembled by SOAPdenovo2 (k-mer = 127) and GapCloser, and 6,480,313 scaffolds were generated with a total length of 3,189, 146,773 bp (Supplementary Table S4). Then, the sequences were further scaffolded by SSPACE2.0 with MP reads, and gaps were filled with HiSeq PE reads by GapFiller. After excluding contaminated sequences and those shorter than 500 bp, the remaining 354,212 sequences were designated as a draft genome sequence, CSE_r1.0, and subjected to analysis (Table 1). The total and N50 lengths of CSE_r1.0 were 2,721, 839,164 and 44,741 bp, respectively. The assembled sequences covered 89.0% of the XMRS10 genome when the genome size was estimated as 3.06 Gb. The CSE_r1.0 sequences were mapped onto the 1, 440 BUSCOs to assess the sequence quality. The number of complete BUSCOs was 1, 279 (88.8%), including 1,153 (80.1%) single copy genes and 125 (8.7%) duplicated genes. The numbers of fragmented and missing BUSCOs were 40 and 121, respectively (Supplementary Table S5). Although the assembled genome sequences were fragmented, the BUSCO results suggested that the CSE_r1.0 had an acceptable quality for gene prediction and annotation.
Table 1

Statistics of the C. seticuspe genome assembly and CDS

CSE_r1.0CSE_r1.1_maker_cdsCSE_r1.1_cds
GenomeCDSCDS (after filtering)
Number of sequences354,212158,37571,057
Total length (bp)2,721,839,164188,275,93589,043,396
Average length (bp)7,6841,1891,253
Maximum length (bp)447,58216,48216,482
Minimum length (bp)500300300
N50 length (bp)44,7411,5601,584
GC%36.041.140.8
Repeat %72.5
Number of complete genes15,79615,304
Number of partial genes142,57955,753
TEs55,741
Statistics of the C. seticuspe genome assembly and CDS The total length of repetitive sequences in CSE_r1.0 was 1, 774 Mb, and these sequences occupied 72.5% of the C. seticuspe genome (CSE_r1.0, Supplementary Table S6). The ratio of repeat sequences was similar to that for lettuce (77.5%), which has an estimated genome size of 2.5 Gb. The ratio of unknown repeat sequences in CSE_r1.0 was higher than those in the sunflower and lettuce genomes. The total length of known repeats was 928 Mb, and Class I (long terminal repeat) elements were most frequently observed.

3.2. Gene prediction and functional analysis

A total of 717,973 genes were identified by the MAKER-P pipeline. Because the number of predicted genes was large, it was considered that a large number of suspicious gene sequences were included in the results. The AED score was therefore calculated for each gene, and filtering of the gene sequences was performed by AED score (<0.5) and sequence length (≥300 bp). The resultant number of predicted genes was 158,374 and designated as CSE_r1.0_maker_cds. The gene sequences with more accurate estimations were further selected by means of a BLASTP search against the NCBI NR database and InterProScan. The remaining 71,052 putative genes were designated as CSE_r1.0_cds. The number of identified tRNA- and rRNA-encoding genes was 2,738 and 100, respectively (Supplementary Table S7). In order to investigate the quality of the predicted genes, a BLASTN search (E-value cut-off of 1E-10 and length coverage > 10%) was performed for 47 previously identified genes involved in flowering-time regulation in C. seticuspe NIFS-3.,,, A total of 44 genes were found in CSE_r1.0_maker_cds, and three were missing (Supplementary Table S8). Of the 44 identified genes, four were tagged as TE, and not included in CSE_r1.0_cds. Thirteen sequences predicted by BRAKER1 showed higher similarity than those in CSE_r1.0_maker_cds. CsFTL2, one of the three missing genes, was found adjacent to CsFTL1 in one scaffold. PCR and Sanger sequencing showed that the physical distance between these genes was 2.5 kbp (Supplementary Fig. S5). The CDS identity of these genes was 96.4%. By using GeneScan, CsFTL2 was successfully predicted. The sequences or tags were replaced or added, and the revised sets of gene sequences were designated CSE_r1.1_maker_cds and CSE_r1.1_cds (Table 1). The results of gene prediction often differ according to the methods used, and there is no single best solution. Therefore, we combined multiple methods for gene prediction by MAKER-P and filtered the suspicious sequences. Although some genes were miss-classified as TE and the results of BRAKER1 were sometimes better than those of MAKER-P, the number of missing genes was only three of 47. In addition, there was a possibility that the two genes that were not identified by GeneScan do not exist in the XMRS10 genome. Hence, we concluded that CSE_r1.1_maker_cds covered most of the genes in XMRS10, but some of the genes might have been missed in CSE_r1.1_cds. The numbers of complete and partial genes in CSE_r1.1_cds were 15,304 and 55,753, respectively, while those in CSE_r1.1_maker_cds were 15,796 and 142,579 (Table 1). The putative genes (CDSs) having similarity to TE made up 35.2% of CSE_r1.1_maker_cds (Supplementary Table S9). The CDSs were tagged with ‘f’, ‘p’ and ‘d’ according to their level of similarity against the NR database (f: E-values ≤ 1E-20 and identity ≥ 70%; p: E-values ≤ E-20 and identity <70%) and InterPro (d: E-values ≤ 1.0). Of the 71,057 CSE_r1.1_cds, 55,197 (77.7%) CDSs were tagged ‘f’ (15,304 CDSs) or ‘p’ (39,893 CDSs). The number of CDSs tagged ‘d’ was 65,317. Functional analysis was performed for CSE_r1.1_cds by classifying the putative genes into the GO, KOG and KEGG databases. A total of 33,372 (47.0%) genes were annotated with GO categories, including 19,116 genes involved in biological processes, 6,780 genes coding for cellular components and 29,988 genes associated with molecular function (Supplementary Fig. S6). The ratio of annotated genes was less than in the other four compared species, i.e. sunflower, lettuce, tomato and A. thaliana. The genes in these four species were predicted based on pseudomolecules, while the C. seticuspe genes were predicted based on 354,212 scaffolds. Hence, it was considered that the C. seticuspe genes predicted in this study were more fragmented than the genes of the four other species used for comparison, and the fragmentation caused the lower ratio of annotated genes. A total of 54,735 genes showed significant similarity to genes in the KOG database, and the distributions of the KOG functional categories were similar to those of the compared species (Supplementary Fig. S7). The total number of mapped genes on the KEGG pathway was 4,941 (Supplementary Table S10).

3.3. Gene discovery analysis related to flowering

Photoperiodic flowering is an important characteristic controlling the flowering time in the commercial production of chrysanthemums. In contrast to the model plant species such as Arabidopsis and rice, photoperiodic flowering of chrysanthemums is dependent on the absolute duration of darkness and is sensitive to light exposure at midnight. The majority of the photoperiod-dependent flowering pathway genes found in Arabidopsis, such as photoreceptors, circadian clock components or clock-controlled transcription factor genes, have been identified in the C. seticuspe genome (Supplementary Table S11). This indicates that the basic components in the photoperiodic flowering pathway are well conserved even among species with different photoperiodic responses, but that the regulation of each gene might be different or that a unique, alternative pathway might also exist in chrysanthemums. Photoperiodic floral initiation of chrysanthemums is regulated by the antagonistic action of two homologous FT/TERMINAL FLOWER 1 (TFL1)-like proteins. Three FT-like genes (CsFTL1, CsFTL2 and CsFTL3) and two TFL1/BFT-like genes (CsAFT and CsTFL1) were identified in C. seticuspe in previous reports., Two additional TFL1-like genes and one MFT-like gene were newly identified in this study, but no additional FT-like genes were found in the C. seticuspe genome (Fig. 1A). Phylogenetic analysis and amino acid alignment using the PEBPs from other plant species suggested that only three FT-like genes (CsFTL1, 2 and 3) have floral promoter activity, while four TFL1/CEN/BFT-like genes have floral repressor activity (Fig. 1B).
Figure 1

Gene discovery analysis related to flowering. (A) Phylogenetic tree of PEBP family proteins from the plant species including C. seticuspe homologues. The tree was constructed using the Neighbor-Joining method in MEGA7 software. Bootstrap values for 1,000 re-samplings are shown on each branch. Black and red dots represent C. seticuspe homologues identified in previously and the present studies, respectively. (B) Amino acid alignment of FT/TFL1 family proteins at the conserved positions that determine inducer or repressor activities. (C) Effects of chilling on expression of the newly identified CEN-like gene (Cse_sc005398.1_g060.1) and a floral meristem identity gene, CsFL (a homologue of LEAFY) in the rosette-forming plants. Data are means ± SE (n = 5). The value of a non-chilled plant at the start of the experiment was set to one.

Gene discovery analysis related to flowering. (A) Phylogenetic tree of PEBP family proteins from the plant species including C. seticuspe homologues. The tree was constructed using the Neighbor-Joining method in MEGA7 software. Bootstrap values for 1,000 re-samplings are shown on each branch. Black and red dots represent C. seticuspe homologues identified in previously and the present studies, respectively. (B) Amino acid alignment of FT/TFL1 family proteins at the conserved positions that determine inducer or repressor activities. (C) Effects of chilling on expression of the newly identified CEN-like gene (Cse_sc005398.1_g060.1) and a floral meristem identity gene, CsFL (a homologue of LEAFY) in the rosette-forming plants. Data are means ± SE (n = 5). The value of a non-chilled plant at the start of the experiment was set to one. Chrysanthemum plants form rosettes by cessation of shoot elongation in autumn. This habit of chrysanthemum is considered to be a type of dormancy adaptation in the annual cycle between growth and dormancy of herbaceous perennials. Flowering is blocked in dormant rosette-forming chrysanthemums even under floral inductive day-length conditions. This flowering incompetence is reversed by chilling, somewhat as in a vernalization response. It is noteworthy that the newly identified CEN-like gene (Cse_sc005398.1_g060.1) is highly expressed in the shoot tips of rosette-forming dormant plants that are incompetent to initiate flowering (Fig. 1C). In the chilled plants where expression of the CEN-like gene was suppressed to a low level, the expression of two floral meristem identity genes (CsAFL1 and CsFL) of C. seticuspe were up-regulated within three weeks after the transfer from the non-inductive NB to inductive SD conditions (Fig. 1C and Supplementary Fig. S3). The expression pattern of the CEN-like gene indicates that this gene might be involved in the seasonal change of flowering competence in chrysanthemum.

3.4. Linkage map construction

In order to demonstrate an application of the assembled C. seticuspe genome to genetic analysis, C. seticuspe linkage maps were constructed based on an F1 mapping population derived from a cross between AEV2 and NIFS-0 based on ddRAD-Seq and SSR markers. The total bases of the ddRAD-Seq reads in each F1 individual were 43.8 Mb (203, 321 reads) on average. The reads were mapped onto CSE_r1.0 with a mean mapped ratio of 83.4%, and a total of 5,206 SNPs were identified. Meanwhile, a total of 66,438 assembled sequences were generated by Newbler2.6 from 2,626,286 454/FLX transcript sequences. Based on the 66,438 sequences, 9,605 primer pairs were designed on the flanking regions of SSRs identified by Fuzznuc (Supplementary Table S12). The existence of SSRs between the primer sequences was further investigated by SciRoKo, and the confirmed 3,140 SSR markers were subjected to the subsequent polymorphic analysis. Parent-specific linkage maps were generated for AEV2 and NIFS-0 with nine LGs in each. The number of mapped loci was 2,124 in the AEV2 map, while that in the NIFS-0 map was 2,239 (Supplementary Tables S13 and S14). The number of bins (non-identical locus positions) in AEV2 and NIFS-0 was 581 and 615, respectively. A higher ratio of segregation distortion was observed in the AeG5 and AeG6 LGs in the AEV2 map (Fig. 2). The reference alleles were more frequently observed at the distorted loci, particularly on AeG5, suggesting the existence of a biological bias in meiosis or chromosome pairing in AEV2.
Figure 2

AEV2 (left) and NIFS-0 (right) bin linkage maps. Blue, red and green bars show locus positions mapped by SNPs, SSR markers and both types of markers. Grey bars represent regions where mapped loci showed significant segregation distortion (P ≤ 0.05).

AEV2 (left) and NIFS-0 (right) bin linkage maps. Blue, red and green bars show locus positions mapped by SNPs, SSR markers and both types of markers. Grey bars represent regions where mapped loci showed significant segregation distortion (P ≤ 0.05).

3.5. Comparison with other plant species at the gene level

The translated protein sequences in CSE_r1.1_cds were clustered and compared with the protein sequences in other plant species (sunflower, lettuce, tomato and A. thaliana) at the amino acid level by OrthoMCL. Of the 71,057 genes in CSE_r1.1_cds, 59,927 genes were classified into 16,098 clusters and 2,405 were classified into C. seticuspe-specific clusters. A total of 19,979 (33.3%) of the genes were clustered with all four of the plant species compared (Fig. 3, Supplementary Fig. S8). The finding that a larger percentage of C. seticuspe genes was clustered exclusively with sunflower genes (10.0%) compared to the percentage clustered exclusively with lettuce genes (3.5%) suggested that, between these two species in the family Asteraceae, sunflower showed the greater similarity to C. seticuspe. The family Asteraceae has been classified into 12 subfamilies, and the genera Chrysanthemum and Helianthus belong to the subfamily Asyeroideae, while the genus Lactuca belongs to the subfamily Cichorioideae. These results agree with the previous taxonomy studies.
Figure 3

Venn diagram showing numbers of gene clusters in C. seticuspe, sunflower (H. annuus), lettuce (L. sativa), tomato (S. lycopersicum) and A. thaliana.

Venn diagram showing numbers of gene clusters in C. seticuspe, sunflower (H. annuus), lettuce (L. sativa), tomato (S. lycopersicum) and A. thaliana. Phylogenetic analysis was further performed with the 2,280 single copy genes observed in the four Asterids species (C. seticuspe, H. annuus, L. sativa and S. lycopersicum) and A. thaliana, as A. thaliana was used for the outgroup (Fig. 4). Our results showed that the subfamilies Asterodeae and Cichorioideae diverged ∼48.67 MYA, and this estimate agreed with the previous study. The divergence time between super tribes Asterodeae and Helianthodae was estimated as ∼45.99 MYA, 2.68 MYA after the divergence of the subfamilies Asterodeae and Cichorioideae.
Figure 4

A phylogenetic tree based on the 2,280 common single-copy genes of the four Asterids species and A. thaliana.

A phylogenetic tree based on the 2,280 common single-copy genes of the four Asterids species and A. thaliana.

3.6. SNP mining and identification of variants in hexaploid-cultivated chrysanthemums

Despite their importance as ornamental plants, cultivated chrysanthemums (C. × morifolium) are rather difficult to study at a genetic level due to their autohexaploidy, large genome size and self-incompatibility. Diploid genome sequences are often used as references of genetic and genomic analysis in polyploid species, such as rose (Rosa hybrida), strawberry (Fragaria × ananassa) and sweetpotato (Ipomoea batatas). The genome sequence of C. seticuspe, a diploid wild relative, can shed light on the complex nature of the cultivated chrysanthemum genome as a reference plant for chrysanthemum species. The transcript sequences of the six cultivated chrysanthemums (Supplementary Table S1b) were mapped onto the genome sequences of C. seticuspe and variants were identified in order to investigate the usefulness of the C. seticuspe genome for genetic studies in cultivated chrysanthemums. A total of 20.4–156.9 M reads of each variety were mapped onto CSE_r1.0. The mapped ratio of the reads ranged from 56.7% (Jinba) to 82.5% (Nannongxunzhang) (Supplementary Table S15a). Two factors were considered as the causes of the large difference in the mapped ratios: read length differences in the six cultivars (49∼100 nt; Supplementary Table S1b) and different sequence similarities against C. seticuspe. The total number of SNPs identified among the six varieties was 954,706, and 294,601 SNPs were identified in all six varieties (Supplementary Table S15b). The remaining 660,105 SNPs (69%) were missing in one to five of the varieties, implying the existence of large gene sequence variation among cultivated chrysanthemums. The SNP genotype call was performed for the 294,601 SNPs that were identified in all six varieties with consideration for the percentages of reads having reference (Ref) and alternative (Alt) bases. SNPs with Alt read ratios of 8.35–91.65 were designated as hetero SNPs. A total of 27, 855 SNPs exhibited a uniform genotype among the six varieties (Supplementary Table S15c). These SNPs were considered to represent the variants between C. seticuspe, XMRS10, and cultivated chrysanthemum. The functions of the SNPs were annotated by SnpEff based on their positions in the mapped gene sequences (Supplementary Table S16 and Fig. S9). Of the total 22,470 genes, 14,741 were identified as SNPs with multiple impacts and 533 were identified as high-impact SNPs. As a result of breeding, cultivated chrysanthemums possess a wider variety of characteristics than C. seticuspe—including with respect to flowering time, flower shape and colour. Causative variants for the characteristics of cultivated chrysanthemums might be identified by further analysis of the functions of the SNPs. The results described above showed that the C. seticuspe genome is applicable to genetic and gene functional analyses in cultivated autohexaploid chrysanthemums. In autohexaploid sweetpotatoes, single-dose SNP markers were detected by using the genome sequence of diploid I. trifida and selected according to the allelic dose for each SNP locus, and a high density genetic map consisting of single-dose SNP markers was constructed. The technique is also applicable to high-density mapping for genetic improvement in cultivated chrysanthemums. A large number of genome-wide SNP markers are expected to be produced by mapping RAD-seq or other sequence data of cultivated chrysanthemum onto the assembled genome sequences, CSE_r1.0.

4. Conclusions

In this study, de novo whole-genome assembly was performed in the genus Chrysanthemum with Illumina reads only. Various NGS technologies have recently become available at reasonable cost, although some of these technologies are still expensive for organisms with large genomes. Illumina reads are the lowest-cost NGS technology, and unlike long-read technologies, Illumina does not require large computer resources for assembly. Although in this study the numbers of assembled sequences and predicted genes indicated that the sequences were still fragmented, the generated draft genome and linkage maps revealed the features of the C. seticuspe genome. In addition, a candidate flowering-related gene, the CEN-like gene (Cse_sc005398.1_g060.1), was newly discovered based on the assembled genome. Moreover, our results demonstrated the applicability of the C. seticuspe genome for genetic and gene functional analysis in cultivated autohexaploid chrysanthemums (C. × morifolium). The genome and gene sequences generated in this study are thus expected to contribute to future chrysanthemum investigations. In addition, our approach demonstrated the usefulness of short reads genome assembly and the importance of choice of NGS technologies depending on the purpose of post-genome analysis.

5. Data availability

The genome assembly data, annotations, gene models and SSRs on the linkage map are available at the MumGARDEN (http://mum-garden.kazusa.or.jp/). The obtained genome sequence reads are available from the DDBJ Sequence Read Archive (DRA) under the accession number DRA005542. The BioProject accession number of the study is PRJDB5536. Click here for additional data file.
  27 in total

1.  The genome of black cottonwood, Populus trichocarpa (Torr. & Gray).

Authors:  G A Tuskan; S Difazio; S Jansson; J Bohlmann; I Grigoriev; U Hellsten; N Putnam; S Ralph; S Rombauts; A Salamov; J Schein; L Sterck; A Aerts; R R Bhalerao; R P Bhalerao; D Blaudez; W Boerjan; A Brun; A Brunner; V Busov; M Campbell; J Carlson; M Chalot; J Chapman; G-L Chen; D Cooper; P M Coutinho; J Couturier; S Covert; Q Cronk; R Cunningham; J Davis; S Degroeve; A Déjardin; C Depamphilis; J Detter; B Dirks; I Dubchak; S Duplessis; J Ehlting; B Ellis; K Gendler; D Goodstein; M Gribskov; J Grimwood; A Groover; L Gunter; B Hamberger; B Heinze; Y Helariutta; B Henrissat; D Holligan; R Holt; W Huang; N Islam-Faridi; S Jones; M Jones-Rhoades; R Jorgensen; C Joshi; J Kangasjärvi; J Karlsson; C Kelleher; R Kirkpatrick; M Kirst; A Kohler; U Kalluri; F Larimer; J Leebens-Mack; J-C Leplé; P Locascio; Y Lou; S Lucas; F Martin; B Montanini; C Napoli; D R Nelson; C Nelson; K Nieminen; O Nilsson; V Pereda; G Peter; R Philippe; G Pilate; A Poliakov; J Razumovskaya; P Richardson; C Rinaldi; K Ritland; P Rouzé; D Ryaboy; J Schmutz; J Schrader; B Segerman; H Shin; A Siddiqui; F Sterky; A Terry; C-J Tsai; E Uberbacher; P Unneberg; J Vahala; K Wall; S Wessler; G Yang; T Yin; C Douglas; M Marra; G Sandberg; Y Van de Peer; D Rokhsar
Journal:  Science       Date:  2006-09-15       Impact factor: 47.728

Review 2.  Move on up, it's time for change--mobile signals controlling photoperiod-dependent flowering.

Authors:  Yasushi Kobayashi; Detlef Weigel
Journal:  Genes Dev       Date:  2007-10-01       Impact factor: 11.361

3.  The value of sampling anomalous taxa in phylogenetic studies: major clades of the Asteraceae revealed.

Authors:  Jose L Panero; V A Funk
Journal:  Mol Phylogenet Evol       Date:  2008-03-28       Impact factor: 4.286

4.  Molecular evidence for multiple polyploidization and lineage recombination in the Chrysanthemum indicum polyploid complex (Asteraceae).

Authors:  Wenhua Yang; Beverley J Glover; Guang-Yuan Rao; Ji Yang
Journal:  New Phytol       Date:  2006       Impact factor: 10.151

Review 5.  Long-distance regulation of flowering time.

Authors:  Colin Turnbull
Journal:  J Exp Bot       Date:  2011-07-21       Impact factor: 6.992

6.  The map-based sequence of the rice genome.

Authors: 
Journal:  Nature       Date:  2005-08-11       Impact factor: 49.962

Review 7.  Leaf-produced floral signals.

Authors:  Jan A D Zeevaart
Journal:  Curr Opin Plant Biol       Date:  2008-08-06       Impact factor: 7.834

8.  Genome sequence and analysis of the tuber crop potato.

Authors:  Xun Xu; Shengkai Pan; Shifeng Cheng; Bo Zhang; Desheng Mu; Peixiang Ni; Gengyun Zhang; Shuang Yang; Ruiqiang Li; Jun Wang; Gisella Orjeda; Frank Guzman; Michael Torres; Roberto Lozano; Olga Ponce; Diana Martinez; Germán De la Cruz; S K Chakrabarti; Virupaksh U Patil; Konstantin G Skryabin; Boris B Kuznetsov; Nikolai V Ravin; Tatjana V Kolganova; Alexey V Beletsky; Andrei V Mardanov; Alex Di Genova; Daniel M Bolser; David M A Martin; Guangcun Li; Yu Yang; Hanhui Kuang; Qun Hu; Xingyao Xiong; Gerard J Bishop; Boris Sagredo; Nilo Mejía; Wlodzimierz Zagorski; Robert Gromadka; Jan Gawor; Pawel Szczesny; Sanwen Huang; Zhonghua Zhang; Chunbo Liang; Jun He; Ying Li; Ying He; Jianfei Xu; Youjun Zhang; Binyan Xie; Yongchen Du; Dongyu Qu; Merideth Bonierbale; Marc Ghislain; Maria del Rosario Herrera; Giovanni Giuliano; Marco Pietrella; Gaetano Perrotta; Paolo Facella; Kimberly O'Brien; Sergio E Feingold; Leandro E Barreiro; Gabriela A Massa; Luis Diambra; Brett R Whitty; Brieanne Vaillancourt; Haining Lin; Alicia N Massa; Michael Geoffroy; Steven Lundback; Dean DellaPenna; C Robin Buell; Sanjeev Kumar Sharma; David F Marshall; Robbie Waugh; Glenn J Bryan; Marialaura Destefanis; Istvan Nagy; Dan Milbourne; Susan J Thomson; Mark Fiers; Jeanne M E Jacobs; Kåre L Nielsen; Mads Sønderkær; Marina Iovene; Giovana A Torres; Jiming Jiang; Richard E Veilleux; Christian W B Bachem; Jan de Boer; Theo Borm; Bjorn Kloosterman; Herman van Eck; Erwin Datema; Bas te Lintel Hekkert; Aska Goverse; Roeland C H J van Ham; Richard G F Visser
Journal:  Nature       Date:  2011-07-10       Impact factor: 49.962

9.  The Sol Genomics Network (solgenomics.net): growing tomatoes using Perl.

Authors:  Aureliano Bombarely; Naama Menda; Isaak Y Tecle; Robert M Buels; Susan Strickler; Thomas Fischer-York; Anuradha Pujar; Jonathan Leto; Joseph Gosselin; Lukas A Mueller
Journal:  Nucleic Acids Res       Date:  2010-10-08       Impact factor: 16.971

10.  CsFTL3, a chrysanthemum FLOWERING LOCUS T-like gene, is a key regulator of photoperiodic flowering in chrysanthemums.

Authors:  Atsushi Oda; Takako Narumi; Tuoping Li; Takumi Kando; Yohei Higuchi; Katsuhiko Sumitomo; Seiichi Fukai; Tamotsu Hisamatsu
Journal:  J Exp Bot       Date:  2011-12-03       Impact factor: 6.992

View more
  27 in total

1.  Identification of 5S and 45S rDNA sites in Chrysanthemum species by using oligonucleotide fluorescence in situ hybridization (Oligo-FISH).

Authors:  Jun He; Sisi Lin; Zhongyu Yu; Aiping Song; Zhiyong Guan; Weimin Fang; Sumei Chen; Fei Zhang; Jiafu Jiang; Fadi Chen; Haibin Wang
Journal:  Mol Biol Rep       Date:  2021-01-17       Impact factor: 2.316

2.  The chrysanthemum lavandulifolium genome and the molecular mechanism underlying diverse capitulum types.

Authors:  Xiaohui Wen; Junzhuo Li; Lili Wang; Chenfei Lu; Qiang Gao; Peng Xu; Ya Pu; Qiuling Zhang; Yan Hong; Luo Hong; He Huang; Huaigen Xin; Xiaoyun Wu; Dongru Kang; Kang Gao; Yajun Li; Chaofeng Ma; Xuming Li; Hongkun Zheng; Zicheng Wang; Yuannian Jiao; Liangsheng Zhang; Silan Dai
Journal:  Hortic Res       Date:  2022-01-18       Impact factor: 6.793

3.  Biogeographic and metabolic studies support a glacial radiation hypothesis during Chrysanthemum evolution.

Authors:  Xi Chen; Haibin Wang; Jiafu Jiang; Yifan Jiang; Wanbo Zhang; Fadi Chen
Journal:  Hortic Res       Date:  2022-04-14       Impact factor: 7.291

4.  Draft Genome of Tanacetum Coccineum: Genomic Comparison of Closely Related Tanacetum-Family Plants.

Authors:  Takanori Yamashiro; Akira Shiraishi; Koji Nakayama; Honoo Satake
Journal:  Int J Mol Sci       Date:  2022-06-24       Impact factor: 6.208

5.  A comparative analysis of the complete chloroplast genomes of three Chrysanthemum boreale strains.

Authors:  Swati Tyagi; Jae-A Jung; Jung Sun Kim; So Youn Won
Journal:  PeerJ       Date:  2020-07-03       Impact factor: 2.984

6.  High-density genetic map construction and identification of loci controlling flower-type traits in Chrysanthemum (Chrysanthemum × morifolium Ramat.).

Authors:  Xuebin Song; Yuhui Xu; Kang Gao; Guangxun Fan; Fan Zhang; Chengyan Deng; Silan Dai; He Huang; Huaigen Xin; Yingying Li
Journal:  Hortic Res       Date:  2020-07-01       Impact factor: 6.793

7.  Agrobacterium-Mediated Transformation of Chrysanthemum with Artemisinin Biosynthesis Pathway Genes.

Authors:  Aleksey Firsov; Tatiana Mitiouchkina; Lyubov Shaloiko; Alexander Pushin; Alexander Vainstein; Sergey Dolgov
Journal:  Plants (Basel)       Date:  2020-04-21

8.  High-density genetic map construction and identification of loci controlling flower-type traits in Chrysanthemum (Chrysanthemum × morifolium Ramat.).

Authors:  Xuebin Song; Yuhui Xu; Kang Gao; Guangxun Fan; Fan Zhang; Chengyan Deng; Silan Dai; He Huang; Huaigen Xin; Yingying Li
Journal:  Hortic Res       Date:  2020-07-01       Impact factor: 6.793

9.  Genome-wide association study overcomes the genome complexity in autohexaploid chrysanthemum and tags SNP markers onto the flower color genes.

Authors:  Katsuhiko Sumitomo; Kenta Shirasawa; Sachiko Isobe; Hideki Hirakawa; Tamotsu Hisamatsu; Yoshihiro Nakano; Masafumi Yagi; Akemi Ohmiya
Journal:  Sci Rep       Date:  2019-09-26       Impact factor: 4.379

10.  CmNAC73 Mediates the Formation of Green Color in Chrysanthemum Flowers by Directly Activating the Expression of Chlorophyll Biosynthesis Genes HEMA1 and CRD1.

Authors:  Jing Luo; Huan Wang; Sijia Chen; Shengjing Ren; Hansen Fu; Ruirui Li; Caiyun Wang
Journal:  Genes (Basel)       Date:  2021-05-08       Impact factor: 4.096

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.