Draft Genome Sequence of Serratia sp. 1D1416.

This work reports the draft genome of Serratia sp. 1D1416. The assembled genome contains a 5,552,016-bp circular chromosome. The strain was discovered in a mixed culture from a gall isolated from Euonymus japonicas.

ANNOUNCEMENT

Although strains of Serratia are often associated with human infections, such as Serratia marcescens and the Serratia liquefaciens complex, other Serratia spp. (“unusual” serratiae) are isolated from the environment (1, 2). Published unusual Serratia spp. include Serratia ficaria, Serratia fonticola, Serratia odorifera, Serratia plymuthica, and Serratia rubidaea (3). Serratia ficaria was the first nonpathogen microbe associated with plant growth and was characterized in 1979 as an important part of the fig tree ecosystem (4). Serratia plymuthica, S. liquefaciens, and S. rubidaea have been observed as part of the rhizosphere microbiome (5, 6) and may have antibacterial or antifungal properties or both (7). The recently isolated strain Serratia sp. 1D1416 appears to have low-level resistance to tetracycline but is susceptible to chloramphenicol, kanamycin, and gentamicin. This is a typical feature of Serratia spp. and may include the entire genus Serratia (3). Here we present the novel genome from Serratia sp. 1D1416, isolated from a mixed culture along with an Agrobacterium tumefaciens isolated from a Euonymus japonicus (Japanese spindle) gall within the UC Davis microbe collection of Dr. Kobe. The strain was grown in Luria broth at 30°C with shaking at 200 rpm.

Genomic DNA was isolated from our strains (8) using the Qiagen blood and cell culture DNA Maxi kit (number 13362) and genomic DNA buffer set (number 19060) (9). DNA samples were evaluated with gel electrophoresis and quantified with a 2100 Nanodrop spectrophotometer (Thermo Fisher Scientific) and a Qubit fluorimeter (Invitrogen) with the Qubit dsDNA HS assay kit (Invitrogen). The genomic DNA was sheared with g-TUBE (Covaris). A 20-kb DNA library was constructed according to the manufacturer’s instructions and the BluePippin size selection system, and it was sequenced using single-molecule real-time (SMRT) sequencing technology on a PacBio RS system. SMRT sequencing data were generated at an average coverage of 88.53×, with a mean read length of 16,608 bp. De novo genome assembly was conducted with the sequence reads using the Hierarchical Genome Assembly Process (HGAP) workflow (SMRT Portal; Pacific Biosciences), protocol RS_HGAP_Assembly.3 (10), and SMRTAnalysis_2.3.0 software (https://www.pacb.com/wp-content/uploads/2015/09/SMRT-Analysis-Software-Installation-v2.3.0.pdf). This allowed the generation of a single contig with an N50 contig length of 5,577,755 bp. The linear DNA was manually circularized with a 25,739-bp chimeric overlap. The circular chromosome is composed of 5,552,016 bp, with a GC content of 59.6%. Assembled and raw read sequences were entered into the National Center for Biotechnology Information (NCBI), and BLAST was used for identification (http://blast.ncbi.nlm.nih.gov/). During genome comparison with other published Serratia, a unique cluster of opine genes were detected. We used this gene cluster to develop primers as a marker to identify specifically the Serratia sp. 1D1416 genome. Primers STNop 5304 F61 5′ ggtgctgaaaagataatgaatccgcacagg and STNop 5304 R61 5′ cctggttggaaatgaagaaattcaggtaagcactg were used to produce a unique 1,560-bp amplicon from a unique ABC transporter substrate-binding protein gene. Automated annotation was performed with the Rapid Annotation Using Subsystem Technology (RAST) Pipeline for annotation of the genome (11). Serratia sp. 1D1416 contains 5,234 predicted coding sequences, 570 subsystems, and 118 predicted RNA-coding genes.

Data availability.

The whole-genome assembly for Serratia sp. 1D1416 has been deposited in DDBJ/ENA/GenBank under the accession number CP032738, BioProject accession number PRJNA493633, and SRA accession number SRX5036357.