Literature DB >> 30682176

Mouse models of GNAO1-associated movement disorder: Allele- and sex-specific differences in phenotypes.

Huijie Feng1, Casandra L Larrivee2, Elena Y Demireva3, Huirong Xie3, Jeff R Leipprandt1, Richard R Neubig1.   

Abstract

BACKGROUND: Infants and children with dominant de novo mutations in GNAO1 exhibit movement disorders, epilepsy, or both. Children with loss-of-function (LOF) mutations exhibit Epileptiform Encephalopathy 17 (EIEE17). Gain-of-function (GOF) mutations or those with normal function are found in patients with Neurodevelopmental Disorder with Involuntary Movements (NEDIM). There is no animal model with a human mutant GNAO1 allele.
OBJECTIVES: Here we develop a mouse model carrying a human GNAO1 mutation (G203R) and determine whether the clinical features of patients with this GNAO1 mutation, which includes both epilepsy and movement disorder, would be evident in the mouse model.
METHODS: A mouse Gnao1 knock-in GOF mutation (G203R) was created by CRISPR/Cas9 methods. The resulting offspring and littermate controls were subjected to a battery of behavioral tests. A previously reported GOF mutant mouse knock-in (Gnao1+/G184S), which has not been found in patients, was also studied for comparison.
RESULTS: Gnao1+/G203R mutant mice are viable and gain weight comparably to controls. Homozygotes are non-viable. Grip strength was decreased in both males and females. Male Gnao1+/G203R mice were strongly affected in movement assays (RotaRod and DigiGait) while females were not. Male Gnao1+/G203R mice also showed enhanced seizure propensity in the pentylenetetrazole kindling test. Mice with a G184S GOF knock-in also showed movement-related behavioral phenotypes but females were more strongly affected than males.
CONCLUSIONS: Gnao1+/G203R mice phenocopy children with heterozygous GNAO1 G203R mutations, showing both movement disorder and a relatively mild epilepsy pattern. This mouse model should be useful in mechanistic and preclinical studies of GNAO1-related movement disorders.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30682176      PMCID: PMC6347370          DOI: 10.1371/journal.pone.0211066

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Neurodevelopmental Disorder with Involuntary Movements (NEDIM) is a newly defined neurological disorder associated with mutations in GNAO1. It is characterized by “hypotonia, delayed psychomotor development, and infantile or childhood onset of hyperkinetic involuntary movements” (OMIM 617493). NEDIM is monogenetic and associated with GOF mutations in GNAO1 [1]. The GNAO1 gene has also been associated with early infantile epileptic encephalopathy 17 (EIEE17; OMIM 615473). However, 36% of patients showed both epilepsy and movement disorder phenotypes (G40R, G45R, S47G, I56T, T191_F197del, L199P, G203R, R209C, A227V, Y231C and E246G) [2]. GNAO1 encodes Gαo, the most abundant membrane protein in the mammalian central nervous system [3]. Gαo is the α-subunit of the Go protein, a member of the Gi/o family of heterotrimeric G proteins. Gi/o proteins couple to many important G protein-coupled-receptors (GPCRs) involved in movement control like GABAB, dopamine D2, adenosine A1 and adrenergic α2A receptors [4-7]. Upon activation, Gαo and Gβγ separate from each other and modulate separate downstream signaling pathways. Gαo mediates inhibition of cyclic AMP (cAMP), and Gβγ mediates inhibition of cAMP and N-type calcium channels and activation of G-protein activated inward rectifying potassium channels (GIRK channels) [8]. Go is expressed mainly in the central nervous system and it regulates neurotransmitter release by modulating intracellular calcium concentrations in pre-synaptic cells [9]. It has also been suggested that Go plays a role in neurodevelopmental processes like neurite outgrowth and axon guidance [10, 11]. Consequently, Go is an important modulator of neurological functions. Previously, we defined a functional genotype-phenotype correlation for GNAO1 [1]. GOF mutations are found in patients with movement disorders, while loss-of-fuction (LOF) mutations are associated with epilepsy [1]. An updated mechanistic review of this genotype-phenotype correlation was recently published [2]. The experimental study of mutant alleles, however, was done with human GNAO1 mutations expressed in HET293T cells, which lack a complex physiological content. Therefore, it would be important to see whether mouse models with GNAO1 mutations would share clinical characteristics of the human patients. Such a result would verify the previously reported genotype-phenotype correlation and would provide a preclinical testing model for possible new therapeutics. Previously, we studied heterozygous Gnao1+/G184S mice carrying a human-engineered GOF mutation (G184S). This mutation blocks the binding of the regulation of G protein signaling (RGS) proteins and results in GOF [12, 13]. Those mice showed heightened sensitization to pentylenetetrazol (PTZ) kindling and had an elevated frequency of interictal epileptiform discharges on EEG [14]. In this report, we tested whether the Gnao1+/G184S mice also exhibit movement disorders. The G184S is a GOF mutation but has not been found in human. G203R is a GOF mutation that is one of the more common GNAO1 mutations found clinically [2, 15–19]. Most patients with this mutation exhibit both seizures and movement disorders [2, 15–19]. We wanted to develop a mouse model with that mutation (Gnao1+/G203R) to see if it replicated the clinical phenotype of GNAO1 G203R-associated neurological disorders. If so, it would be a valuable tool to understand neural mechanisms underlying the complex phenotypic spectrum of patients with GNAO1 mutations. In this report, we show that mice carrying two Gαo GOF mutations Gnao1+/G203R and Gnao1+/G184S have sex-specific motor impairment and seizures. These two mouse models present the possibility of studying GNAO1-associated neurological defects in animal models.

Materials and methods

Animals

Animal studies were performed in accordance with the Guide for the Care and Use of Laboratory Animals established by the National Institutes of Health. All experimental protocols and personnel were approved and trained by the Michigan State University Institutional Animal Care and Use Committee. Mice were housed on a 12-h light/dark cycle and had free access to food and water. They were studied between 8–12 weeks old.

Generation of Gnao1 mutant mice

Gnao1+/G184S mutant mice were generated as previously described [1, 13, 14, 20] and used as N10 or greater backcross on the C57BL/6J background. Gnao1G203R mutant mice were generated using CRISPR/Cas9 genome editing on the C57BL/6NCrl strain. gRNA targets within exon 6 of the Gnao1 locus (ENSMUSG00000031748) were used to generate the G203R mutation (Fig 1A). Synthetic single-stranded DNA oligonucleotides (ssODN) were used as repair templates carrying the desired mutation and short homology arms (Table 1). CRISPR reagents were delivered as ribonucleoprotein (RNP) complexes. RNPs were assembled in vitro using wild-type S.p. Cas9 Nuclease 3NLS protein, and synthetic tracrRNA and crRNA (Integrated DNA Technologies, Inc.). TracrRNA and crRNA were denatured at 95°C for 5 min and cooled to room temperature in order to form RNA hybrids, which were incubated with Cas9 protein for 5 min at 37°C. RNPs and ssODN templates were electroporated into C57BL/6NCrl zygotes as described previously [21], using a Genome Editor electroporator (GEB15, BEX CO, LTD). C57BL/6NCrl embryos were implanted into pseudo-pregnant foster dams. Founders were genotyped by PCR (Table 1) followed by T7 endonuclease I assay (M0302, New England BioLabs) and validated by Sanger sequencing.
Fig 1

Development of Gnao1+/G203R mouse model.

(A) Targeting of the Gnao1 locus. The location of the gRNA target protospacer and the PAM, and double stranded breaks following Cas9 cleavage are indicated on the WT allele. Deleted or modified sequences are highlighted in blue. The resulting edited allele sequence and translation are presented along with the sequences used as references for ssODN synthesis. (B) Heterozygous Gnao1+/G203R mutant mice are largely normal in size and behavior. Photo comparing mutant mouse with its littermate control is shown. (C) Gnao1+/G203R mice have a relatively normal survival; while homozygous Gnao1G203R/G203R mice die perinatally (P0-P1). (D) Gnao1+/G203R mice develop normally and gain weight similarly to their WT littermate controls.

Table 1

Location, sequence and genotyping of gRNA targets in Gnao1 locus.

Gnao1 G203R
DSB locationchr 8: 93,950,314
gRNA target5’ TGCAGGCTGTTTGACGTCGG GGG 3’ (+)
ssODN5’ ATGGCCGTGACATCCTCAAAGCAGTGGATCCACTTCTTGCGTTCAGATCGCTGGCCGCGGACGTCAAACAGTTTGCAGGGAGTCAGGGAAAGCTGT 3’
PCR primersFwd: 5’ GACAGGTGTCACAGGGGATG 3’Rev: 5’ TCCTAGCCAAGACCCCAACT 3’PCR product = 462bp
GenotypingSacII site created by G203R mutation

gRNA target– 20bp protospacer and PAM sequences are listed, strand orientation indicated by (+) or (-). Sequence of ssODN used as repair template is listed. For G203R, mutated codon is highlighted in bold. DSB–double stranded break. PAM–protospacer adjacent motif.

Development of Gnao1+/G203R mouse model.

(A) Targeting of the Gnao1 locus. The location of the gRNA target protospacer and the PAM, and double stranded breaks following Cas9 cleavage are indicated on the WT allele. Deleted or modified sequences are highlighted in blue. The resulting edited allele sequence and translation are presented along with the sequences used as references for ssODN synthesis. (B) Heterozygous Gnao1+/G203R mutant mice are largely normal in size and behavior. Photo comparing mutant mouse with its littermate control is shown. (C) Gnao1+/G203R mice have a relatively normal survival; while homozygous Gnao1G203R/G203R mice die perinatally (P0-P1). (D) Gnao1+/G203R mice develop normally and gain weight similarly to their WT littermate controls. gRNA target– 20bp protospacer and PAM sequences are listed, strand orientation indicated by (+) or (-). Sequence of ssODN used as repair template is listed. For G203R, mutated codon is highlighted in bold. DSB–double stranded break. PAM–protospacer adjacent motif. The likelihood of an off-target site being edited is very low. Based on the number and position of mismatches, several predictive algorithms were used to assign guide specificity scores from 0 to 100 (100 = best) to rank gRNAs by specificity with respect to off-target modifications occurring [22-24]. The gRNA target used for this experiment has a specificity score of 94, which is the highest seen in over 40 similar targeting experiments done by the MSU Transgenic and Genomic Editing Facility. This greatly reduces the probability of off-target edits. After examining the off-target lists (S5 Table), we did not identify any off-target loci with less than 3 mismatches or with an off-target binding score > 0.5 which we deem as thresholds for further validation. We also did not identify any off-target loci with significant scores that were on the same chromosome and would be less likely to be removed from the genome after breeding of several generations. Furthermore, the RNP (ribonucleoprotein) approach that we employed to deliver CRISPR reagents to mouse embryos further lowers the risk of off-target events [25]. Nevertheless, we directly validated several predicted off-target loci for the G203 gRNA target (TGCAGGCTGTTTGACGTCGG GGG) that occur within coding regions. One potential off-target site with 4 mismatches and a score of 0.52 was validated for locus ENSMUSG00000041390. We also analyzed two other off-target candidates with 4 mismatches ENSMUSG00000086805 and ENSMUSG00000097637 and scores of 0.15 and 0.069 respectively. They were predicted to occur on the same chromosome (chr 8) as Gnao1. To test these 3 off-target candidates, DNA from WT and founder animals was analyzed by PCR and sequencing and we found that no off-target effects had occurred for all 3 off-target loci analyzed (see Supplemental Materials).

Genotyping and breeding

Heterozygous Gnao1+/G203R mutant founder mice were crossed against C57BL/6J mice to generate Gnao1+/G203R heterozygotes (N1 backcross). Further breeding was done to produce N2 backcross heterozygotes while male and female N1 heterozygotes were crossed to produce homozygous Gnao1G203R/G203R mutants. Studies were done on N1 or N2 G203R heterozygotes with comparisons to littermate controls. All mice had ears clipped before weaning. DNA was extracted from earclips by an alkaline lysis method [26]. The G203R allele of Gαo was identified by Sac II digests (wt 462 Bp and G203R 320 & 140Bp) of genomic PCR products generated with primers (Fwd 5' GACAGGTGTCACAGGGGATG 3'; Rev 5' TCCTAGCCAAGACCCCAACT 3'). Reaction conditions were: 0.8μl template, 4μl 5x Promega PCR buffer, 0.4μl 10mM dNTPs, 1μl 10μM Forward Primer, 1μl 10μM Reverse Primer, 0.2μl Promega GoTaq and 12.6 μl DNase free water (Promega catalog # M3005, Madison WI). Samples were denatured for 4 minutes at 95 oC then underwent 32 cycles of PCR (95 oC for 30 seconds, 60°C for 30 seconds, and 72 oC for 30 seconds) followed by a final extension (7 minutes at 72°C). After PCR, samples were incubated with Sac II restriction enzyme for 2 hrs.

Behavioral studies

Researchers conducting behavioral experiments were blinded until the data analysis was completed. Before each experiment, mice were acclimated in the testing room for at least 10 min. The timeline of behavioral protocols is described in Fig 2. Two female experimenters conducted all behavioral studies.
Fig 2

The timeline for utilizing animals in this study.

Open field, Rotarod and Grip strength tests were performed on the same group of 8-week-old animals in this as showed above. DigiGait tests were done on naïve 8-week-old animals. After completion of the motor behavior studies, animals were used for the PTZ kindling study.

The timeline for utilizing animals in this study.

Open field, Rotarod and Grip strength tests were performed on the same group of 8-week-old animals in this as showed above. DigiGait tests were done on naïve 8-week-old animals. After completion of the motor behavior studies, animals were used for the PTZ kindling study.

Open field

The Open Field test was conducted in a Fusion VersaMax 42 cm x 42 cm x 30 cm arenas (Omnitech Electronics, Inc., Columbus, OH). Mice and their littermate controls were placed in the arena for 30 minutes to observe spontaneous activities. Using the Fusion Software, distance traveled (cm) was evaluated for novel (first 10 minutes), sustained (10–30 minutes), and total (0–30 minutes) activity. Center Time was also measured. Center Time was defined as the time spent in the center portion (20.32cm x 20.32cm) of the Open Field cage.

RotaRod

Motor skills were assessed using an Economex accelerating RotaRod (Columbus Instruments, Columbus, OH). The entire training and testing protocol took two days. On day 1, mice were trained for three 2-minute sessions, with a 10-minute rest between each training period. During the first two sessions, the RotaRod was maintained at a constant speed of 5 rpm. In the third training session, the rod was started at 5 rpm and accelerated at 0.1 rpm/sec for 2 minutes. On day 2, mice were trained with two more accelerating sessions for 2 minutes each with a 10-minute break in between. The final test session was 5 minutes long, starting at 5 rpm then accelerating to 35 rpm (0.1 rpm/sec). For all training and test trials, the time to fall off the rod was recorded. RotaRod learning curves were done on a separate group of mice with 10 tests in one day with a 5-min rest between each test. The learning rate of each group of animals was calculated as described [27].

Grip strength

Mouse grip strength data was collected following a protocol adapted from Deacon et al [28] using seven home-made weights (10, 18, 26, 34, 42, 49, 57 grams). Briefly, the mouse was held by the middle/base of the tail and lowered to grasp a weight. A total of three seconds was allowed for the mouse to hold the weight with its forepaws and to lift the weight until it was clear of the bench. Three trials were done starting with the 10 g weight to permit the mice to lift the weights with a 10-second rest between each trial. If the mouse successfully held a weight for 3 seconds, the next heavier weight was given; otherwise the maximum time/weight achieved was recorded. A final total score was calculated based on the heaviest weight the mouse was able to lift up and the time that it held it [28]. The final score was normalized to the body weight of each mouse, which was measured before the trial.

DigiGait

Mouse gait data were collected using a DigiGait Imaging System (Mouse Specifics, Inc., Framingham, MA) [29]. The test is used for assessment of locomotion as well as the integrity of the cerebellum and muscle tone/equilibrium [30]. Briefly, after acclimation, mice were allowed to walk on a motorized transparent treadmill belt. A high-speed video camera was mounted below to capture the paw prints on the belt. Each paw image was treated as a paw area and its position recorded relative to the belt. Seven speeds (18, 20, 22, 25, 28, 32 and 36 cm/s) were tested per animal with a 5-minute rest between each speed. An average of 4–6 s of video was saved for each mouse, which is sufficient for the analysis of gait behaviors in mice [30]. For each speed, left & right paws were averaged for each animal while fore and hind paws were evaluated separately. Stride length was normalized to animal body length. We eliminated data points at speed 36 cm/s since many mice cannot run at that speed, which increased the variability.

PTZ kindling susceptibility

A PTZ kindling protocol was performed as described before [14] to assess epileptogenesis. Briefly, PTZ (40 mg/kg, i.p. in 5 mg/ml) was administered every other day starting at 8 weeks of age. Mice were monitored and scored for 30 minutes for signs of behavioral seizures as described [14, 31, 32]. Kindling is defined as death or the onset of a tonic-clonic seizure on two consecutive treatment days. The number of injections for each mouse to reach the kindled state was reported in survival curves. This experiment lasted up to 4 weeks with a maximum of 12 doses. Each animal in the study was checked every day for health and seizure development. Animals were humanely euthanized with CO2 immediately after kindling or after 12 PTZ injections and observation. In total, 40 animals were used for this study, among which 27 died of tonic-clonic seizures and 13 were euthanized after 12 doses of PTZ injections.

Data analysis

All data was analyzed using GraphPad Prism 7.0 (GraphPad; La Jolla, CA). Data are presented as mean ± SEM and a p value less than 0.05 was considered significant. All statistical tests are detailed in Figure Legends. Multiple comparison correction of the dataset from DigiGait was performed via a false discovery rate (FDR) correction at a threshold value of 0.01 in an R environment using the psych package.

Results

Gnao1+/G203R mice showed normal viability and growth

Genotypes of offspring of Gnao1+/G203R x WT crosses (N1—C57BL/6NCrl x C57BL/6J) were observed at the expected frequency (29 WT and 27 heterozygous). All three homozygous mice from Gnao1+/G203R x Gnao1+/G203R crosses died by P1. The small numbers of offspring observed from these crosses so far, however, were not significantly different from expected frequencies (4 wt, 14 het, and 3 homozygous). Heterozygous Gnao1+/G203R mice did not show any growth abnormalities compared to Gnao1+/+ mice (Fig 1B & 1D) and they had relatively normal survival. There were two spontaneous deaths (~5–7 weeks) seen for Gnao1+/G203R mice out of 33 (Fig 1C). This is reminiscent of the spontaneous deaths seen previously with the Gnao1+/G184S GOF mutant mice [14]. Gnao1+/G203R mice did not exhibit any obvious spontaneous seizures or abnormal movements.

Female Gnao1+/G184S and male Gnao1+/G203R mice show impaired motor coordination and reduced grip strength

Since GOF alleles of GNAO1 in children result primarily in movement disorder, we tested motor coordination in two mouse lines. One carried an engineered GOF mutant G184S, designed to block RGS protein binding [12, 13, 33]. The other is the G203R GOF mutant, which has been seen in at least 7 children (1, 2). First, we used a two-day training and testing procedure on the RotaRod (Fig 3A & 3B). Gnao1+/G184S and Gnao1+/G203R mice were compared to their same-sex littermate controls. Female Gnao1+/G184S mice exhibited a reduced retention time on the accelerating RotaRod (unpaired t-test, p<0.001, Fig 3A) while male mice remained unaffected. In contrast, male Gnao1+/G203R mice exhibited reduced time to stay on the rotating rod (unpaired t-test, p<0.05, Fig 3B) while female Gnao1+/G203R mice did not show any abnormalities. Results from all the RotaRod training and testing sessions are shown in S1 Fig. Neither Gnao1+/G184S nor Gnao1+/G203R mice showed a significant difference in learning rate on RotaRod (S3 Fig), suggesting that the differences we observed in the RotaRod study were due to movement deficits rather than learning difficulties.
Fig 3

Female Gnao1+/G184S mice and male Gnao1+/G203R mice show reduced time on RotaRod and reduced grip strength.

(A&B) Quantification of RotaRod studies. (A) Female Gnao1+/G184S mice lose the ability to stay on a RotaRod (unpaired t-test; ***p<0.001), while male Gnao1+/G184S mice appeared unaffected. (B) Male Gnao1+/G203R also showed reduced motor coordination on RotaRod (unpaired t-test, *p<0.01). (C&D) Quantification of grip strength results. Scores for each mouse were normalized to body weight. (C) Female Gnao1+/G184S mice are less capable of lifting weights compared to their Gnao1+/+ siblings (unpaired t-test, *p<0.05). (D) Both male and female Gnao1+/G203R mice showed reduced ability to hold weights (unpaired t-test, *p<0.05). Data are shown as mean ± SEM.

Female Gnao1+/G184S mice and male Gnao1+/G203R mice show reduced time on RotaRod and reduced grip strength.

(A&B) Quantification of RotaRod studies. (A) Female Gnao1+/G184S mice lose the ability to stay on a RotaRod (unpaired t-test; ***p<0.001), while male Gnao1+/G184S mice appeared unaffected. (B) Male Gnao1+/G203R also showed reduced motor coordination on RotaRod (unpaired t-test, *p<0.01). (C&D) Quantification of grip strength results. Scores for each mouse were normalized to body weight. (C) Female Gnao1+/G184S mice are less capable of lifting weights compared to their Gnao1+/+ siblings (unpaired t-test, *p<0.05). (D) Both male and female Gnao1+/G203R mice showed reduced ability to hold weights (unpaired t-test, *p<0.05). Data are shown as mean ± SEM. Grip strength was assessed as described [28]. This test is widely done in combination with the RotaRod motor coordination test. This may be relevant to the hypotonia, seen in many GNAO1 patients [17, 18, 34–46]. Similar to the RotaRod results, female Gnao1+/G184S mice also showed reduced forepaw grip strength compared to their littermate controls (unpaired Student’s t-test, p<0.05, Fig 3C) while males did not exhibit a significant difference (Fig 3C). In contrast, both male and female Gnao1+/G203R mice displayed reduced forepaw grip strength (unpaired t-test, p<0.05, Fig 3D).

Gnao1+/G184S mice show reduced activity in the open field arena

The open field test provides simultaneous measurements of locomotion, exploration and surrogates of anxiety. It is a useful tool to assess locomotive impairment in rodents [47], however, environmental salience may reduce the impact of the motor impairment on behaviors [48]. Therefore, we divided the 30-min open field measurements into two periods, with the first 10 minutes assessing activity in a novel environment and the 10–30 minute period designated as sustained activity (Fig 4C & 4D). The novelty measurement showed a significant difference between Gnao1+/G184S mice and their littermate controls for both male and female mice (2-way ANOVA, p<0.01 for female, p<0.05 for male, Fig 4C). Female, but not male, Gnao1+/G184S mice showed reduced activity in the sustained phase of open field testing (Fig 4C, 2-way ANOVA, *p<0.05, **p<0.01, ****p<0.0001). Both male and female Gnao1+/G184S mice also showed reduced total activity (2-way ANOVA, p<0.001, Fig 4A & 4C). Neither male nor female Gnao1+/G203R mice performed differently in the open field arena compared to their littermate controls (Fig 4B & 4D). No significant difference was observed in the time mice spent in the center of the arena (S2 Fig).
Fig 4

G184S mutant mice showed reduced activities in open field test but G203R mutants don’t.

(A&C) Female and male Gnao1+/G184S mice showed decreased activity in the open field test. A total of 30 min activity was recorded which was divided into a Novelty (0–10 min) and a Sustained (10–30 min) period. (A) Representative heat map of overall activity comparing Gnao1+/+ and Gnao1+/G184S mice of both sexes. (C) Quantitatively, both male and female Gnao1+/G184S travelled less in the open field arena (2-way ANOVA; ****p< 0.0001, **p<0.01, *p<0.05). (B & D) Neither male nor female Gnao1+/G203R mice showed abnormalities in the open field arena. (B) Sample heat map tracing of female and male mouse movement in open field. (D) Quantification showed no difference between Gnao1+/+ and Gnao1+/G203R mice in distance traveled (cm) in the open field arena (2-way ANOVA; n.s.). Data are shown as mean ± SEM. Numbers of animals are indicated on bars.

G184S mutant mice showed reduced activities in open field test but G203R mutants don’t.

(A&C) Female and male Gnao1+/G184S mice showed decreased activity in the open field test. A total of 30 min activity was recorded which was divided into a Novelty (0–10 min) and a Sustained (10–30 min) period. (A) Representative heat map of overall activity comparing Gnao1+/+ and Gnao1+/G184S mice of both sexes. (C) Quantitatively, both male and female Gnao1+/G184S travelled less in the open field arena (2-way ANOVA; ****p< 0.0001, **p<0.01, *p<0.05). (B & D) Neither male nor female Gnao1+/G203R mice showed abnormalities in the open field arena. (B) Sample heat map tracing of female and male mouse movement in open field. (D) Quantification showed no difference between Gnao1+/+ and Gnao1+/G203R mice in distance traveled (cm) in the open field arena (2-way ANOVA; n.s.). Data are shown as mean ± SEM. Numbers of animals are indicated on bars.

Female Gnao1+/G184S mice and male Gnao1+/G203R mice exhibit markedly abnormal gaits

In addition to the above behavioral tests, we also performed gait assessment on Gnao1+/G184S and Gnao1+/G203R mice of both sexes. Gait is frequently perturbed in rodent models of human movement disorders even when the actual movement behavior seen in the animals does not precisely phenocopy the clinical movement pattern [49, 50]. The multiple parameters assessed in DigiGait allow it to pick up subtle neuromotor defects and make it more informative than the RotaRod test. The gait analysis largely confirmed the sex differences between the two strains in RotaRod tests. Thirty-seven parameters were measured for both front and hind limbs. Given the large number of measurements, we used false discovery rate (FDR) analysis with a Q of 1% as described in Methods to reduce the probability of Type I errors (S4 and S5 Figs, S1–S4 Tables). Gnao1+/G184S female mice showed 22 significant differences (Q<0.01) and males showed 8 (S4 Fig, S3 and S4 Table). For Gnao1+/G203R mice, the opposite sex pattern was seen with 27 parameters in females and 8 parameters in males showing significant differences from WT (S5 Fig, S1 and S2 Tables). Two of the most highly significant parameters and ones that had face validity in terms of clinical observations (stride length and paw angle variability) were chosen for further analysis. Across the range of treadmill speeds, female Gnao1+/G184S mice showed significantly reduced stride length (2-way ANOVA, p<0.01, Fig 5A) and increased paw angle variability (2-way ANOVA, p<0.0001, Fig 5E) compared to WT littermates. Male Gnao1+/G184S mice only had a difference in paw angle variability (2-way ANOVA, p<0.0001), not in stride length (Fig 5C & 5G). These results are consistent with the results of RotaRod and grip strength measurements in that female Gnao1+/G184S mice showed a stronger phenotype than males. In contrast to the Gnao1+/G184S mice, male Gnao1+/G203R mice appeared to be more severely affected in gait compared to female Gnao1+/G203R mice. Male Gnao1+/G203R mice had highly significantly reduced stride length (2-way ANOVA, p<0.0001, Fig 5D) and increased paw angle variability (2-way ANOVA, p<0.05, Fig 4H). In contrast, female Gnao1+/G203R mice did not show any significant differences in stride length or paw angle variability (Fig 5B & 5F).
Fig 5

DigiGait imaging system reveals sex-specific gait abnormalities in Gnao1+/G184S mice and Gnao1+/G203R mice.

(A-D) Female Gnao1+/G184S mice showed significant gait abnormalities, while female Gnao1+/G203R mice remain normal. (A & B) Female Gnao1+/G184S mice showed reduced stride length (2-way ANOVA with Bonferroni multiple comparison post-test) while female Gnao1+/G203R mice were not different from control (2-way ANOVA; n.s.). (C) Female Gnao1+/G184S mice also showed increased paw angle variability (2-way ANOVA, p<0.0001) while female Gnao1+/G203R mice showed normal paw angle variability. (E-H) Male Gnao1+/G203R and Gnao1+/G184S mutant mice showed distinct gait abnormalities. (E & G) Male Gnao1+/G184S mice showed significantly increased paw angle variability (2-way ANOVA p <0.0001 overall with significant Bonferroni multiple comparison tests; **p<0.01 and *p<0.05). There was no effect on stride length. (F & H) In contrast, male Gnao1+/G203R mice showed markedly reduced stride length (2-way ANOVA p<0.0001 with Bonferroni multiple comparison post-test; ***p<0.001, **p<0.01, and *p<0.05) and modestly elevated paw angle variability (overall p<0.05). (I) Gnao1+/G184S mice did not show significant differences in the highest treadmill speed successfully achieved. (J) Both male and female Gnao1+/G203R mice showed reduced capabilities to run on a treadmill at speeds greater than 25 cm/s (Mann-Whitney test; *p<0.05).

DigiGait imaging system reveals sex-specific gait abnormalities in Gnao1+/G184S mice and Gnao1+/G203R mice.

(A-D) Female Gnao1+/G184S mice showed significant gait abnormalities, while female Gnao1+/G203R mice remain normal. (A & B) Female Gnao1+/G184S mice showed reduced stride length (2-way ANOVA with Bonferroni multiple comparison post-test) while female Gnao1+/G203R mice were not different from control (2-way ANOVA; n.s.). (C) Female Gnao1+/G184S mice also showed increased paw angle variability (2-way ANOVA, p<0.0001) while female Gnao1+/G203R mice showed normal paw angle variability. (E-H) Male Gnao1+/G203R and Gnao1+/G184S mutant mice showed distinct gait abnormalities. (E & G) Male Gnao1+/G184S mice showed significantly increased paw angle variability (2-way ANOVA p <0.0001 overall with significant Bonferroni multiple comparison tests; **p<0.01 and *p<0.05). There was no effect on stride length. (F & H) In contrast, male Gnao1+/G203R mice showed markedly reduced stride length (2-way ANOVA p<0.0001 with Bonferroni multiple comparison post-test; ***p<0.001, **p<0.01, and *p<0.05) and modestly elevated paw angle variability (overall p<0.05). (I) Gnao1+/G184S mice did not show significant differences in the highest treadmill speed successfully achieved. (J) Both male and female Gnao1+/G203R mice showed reduced capabilities to run on a treadmill at speeds greater than 25 cm/s (Mann-Whitney test; *p<0.05). In addition to these quantitative gait abnormalities a qualitative defect was seen. A significant number of Gnao1+/G203R mice of both sexes failed to run when the belt speed exceeded 22 cm/s (Mann-Whitney test, female and male p<0.05, Fig 5J). For reasons that are not clear such a difference was not seen for Gnao1+/G184S mice (Fig 5I).

Male Gnao1+/G203R mice are sensitized to PTZ kindling

Epilepsy has been observed in 100% of patients with GNAO1 G203R mutations [2, 15–17, 19, 51]. Also in the Gnao1+/G184S GOF mutant mice, we previously reported spontaneous lethality as well as increased susceptibility to kindling by the chemical anticonvulsant PTZ for both males and females [14]. Kindling is a phenomenon where a sub-convulsive stimulus, when applied repetitively and intermittently, leads to the generation of full-blown convulsions [52]. To determine if the G203R GOF mutant mice mimicked the G184S mutants and phenocopied the human epilepsy pattern of children with the G203R mutation, we assessed PTZ-induced kindling in Gnao1+/G203R mutant mice. As expected for C57BL/6 mice, females were more prone to kindling than male mice. Half of the mice kindled at 4 and 8–10 injections for females and males, respectively (Fig 6A & 6B). Despite the increased sensitivity of females in general, female Gnao1+/G203R mice did not show significantly higher sensitivity to PTZ compared to their littermate controls (Fig 6A). On the contrary, male Gnao1+/G203R mice were more sensitive to PTZ kindling than controls (Fig 6B, Mantel-Cox Test, p<0.05). Also, three spontaneous deaths were seen (two male and one female) among the 33 G203R mice observed for at least 100 days, similar to the early lethality seen in G184S mutant mice [14]. We cannot, however, attribute those deaths to seizures at this point.
Fig 6

Gnao1+/G203R male mice have an enhanced Pentylenetetrazol (PTZ) kindling response.

(A) Female Gnao1+/G203R mice did not show heightened sensitivity to PTZ injection. (B) Male Gnao1+/G203R mice developed seizures earlier than WT littermates after repeated PTZ injections (Mantel-Cox Test; p<0.05).

Gnao1+/G203R male mice have an enhanced Pentylenetetrazol (PTZ) kindling response.

(A) Female Gnao1+/G203R mice did not show heightened sensitivity to PTZ injection. (B) Male Gnao1+/G203R mice developed seizures earlier than WT littermates after repeated PTZ injections (Mantel-Cox Test; p<0.05).

Discussion

In this report, we describe the first mouse model carrying a human GNAO1 mutation associated with disease and we provide evidence to support the concept that GOF mutations are associated with movement disorder [1]. Heterozygous mice carrying the G203R mutation in Gnao1 exhibit both a mild increase in seizure propensity and evidence of abnormal movements. This fits precisely with the variable seizure pattern of the children who carry this mutation as well as their severe choreoathetotic movements [2, 15–17, 19, 51, 53]. Also, we examined a possible movement phenotype in mice carrying the RGS-insensitive GOF mutant (Gnao1+/G184S) that we reported previously to have a mild seizure phenotype [14]. This mutation has not been reported in humans to our knowledge. As predicted from our mechanistic model [1, 2], the Gnao1 G184S mutant mice also show movement abnormalities. In mouse models of movement disorders, the mouse phenotype is usually not as striking or as easily observed as the clinical abnormalities in the patients [54, 55], however they are often informative about mechanism and therapeutics. For the patient-derived Gnao1+/G203R mutant mouse, neither the seizure propensity nor the movement abnormality was obvious without a stress being applied. Male Gnao1+/G203R mice showed decreased motor ability on RotaRod, decreased fore paw strength, and gait abnormalities at higher speeds of walking/running. No spontaneous seizures were observed but there was a substantial increase in sensitivity to PTZ-induced seizures in the kindling model in males. This very closely replicates the mild seizure phenotype of female Gnao1+/G184S mice [14]. We now show that the female Gnao1+/G184S mice also exhibit gait and motor abnormalities. Both the GNAO1 G203R and the G184S mutations show a definite but modest GOF phenotype in biochemical measurements of cAMP regulation [1]. In each case, the maximum percent inhibition of cAMP is not greatly increased but the potency of the α2A adrenergic agonist, used in those studies to reduce cAMP levels, was increased about 2-fold. This effectively doubles signaling through these two mutant G proteins at low neurotransmitter concentrations (i.e. those generally produced during physiological signaling). This, however, does not prove that cAMP is the primary signal mechanism involved in pathogenesis of the disease. The heterotrimeric G protein, Go, of which the GNAO1 gene product, Gαo, is the defining subunit, can signal to many different effector mechanisms [2, 10, 56]. We recently reviewed the mutations associated with genetic movement disorders and identified both cAMP regulation and control of neurotransmitter release as two GNAO1 mechanisms that seem highly likely to account for the pathophysiology of GNAO1 mutants [2]. Since many Go signaling effectors (including cAMP and neurotransmitter release) can be mediated by the Gβγ subunit released from the Go heterotrimer, other effectors could also be involved in the disease mechanisms. A recent hypothesis has also been raised that intracellular signaling by Gαo may be involved [57]. The observation that one of the most common movement disorder-associated alleles (R209H and other mutations in Arg209) does not markedly alter cAMP signaling in in vitro models, does suggest that the mechanism is more complex than a simple GOF vs LOF distinction at cAMP regulation. We observed a striking sex difference in the phenotypes of our two mouse models. Female Gnao1+/G184S mice and male Gnao1+/G203R mice showed much more prominent movement abnormalities than male G184S and female G203R mutants. However, the patterns of changes in the behavioral tests did not exactly overlap. Only G184S mutants showed significant changes in open field tests while only the G203R mutants showed the striking reduction in ability to walk/run at higher treadmill speeds. For both mutant alleles, the seizure phenotype was also worse in the sex with the more prominent movement disorder. GNAO1 encephalopathy is slightly more prevalent (60:40) in female than male patients [2]. It is not uncommon to have sex differences in epilepsy or movement disease progression. One possible explanation is that estrogen prevents dopaminergic neuron depletion by decreasing the uptake of toxins into dopaminergic neurons in Parkinson’s disease (PD) animal model induced by neurotoxin [58]. The Gi/o coupled estrogen receptor, GPR30, also contributes to estrogen physiology and pathophysiology [59]. PD is more common in male than female human patients [60], therefore, the pro-dopaminergic properties of estrogen may exacerbate conditions mediated by hyper-dopaminergic symptoms like chorea in Hungtington’s disease (HD; 58). Chorea/athetosis is the most prevalent movement pattern seen in GNAO1-associated movement disorders [2] so the female predominance correlates with that in HD. Clearly mechanisms of sex differences are complex including differences in synaptic patterns, neuronal densities and hormone secretion [58, 61, 62], but it is beyond the scope of this report to explain how the molecular differences contribute to the distinct behavioral patterns. Since GNAO1 encephalopathy is often associated with developmental delay and cognitive impairment [2], it would be interesting to see whether the movement phenotype we have seen in female Gnao1+/G184S and male Gnao1+/G203R mice is due to a neurodevelopmental malfunction or to ongoing active signaling alterations. Go coupled GPCRs play an important role in hippocampal memory formation [63, 64]. Additional behavioral tests will be valuable to assess the learning and memory ability of the Gnao1 mutant mice. With the increasing recognition of GNAO1-associated neurological disorders, it is important to learn about the role of Go in the regulation of central nervous system. The novel Gnao1 G203R mutant mouse model reported here, and further models under development, should facilitate our understanding of GNAO1 mechanisms in the in vivo physiological background rather simply in in vitro cell studies. The animal models can also be used for preclinical drug testing and may permit a true allele-specific personalized medicine approach in drug repurposing for the associated movement disorders.

RotaRod test was conducted with 5 training sessions and 1 test session over two consecutive days.

(A) Female Gnao1+/G184S mice showed significantly motor abnormalities in test trial at day 2 (unpaired t-test; ***p<0.001). (B) Male Gnao1+/G184S mice did not show any significance in any training or test session. (C) Female Gnao1+/G203R mice did not exhibit any motor abnormalities in any RotaRod trial or test session. (D) Male Gnao1+/G203R mice showed significantly decreased capability in motor balance (unpaired t-test; *p<0.05). (TIFF) Click here for additional data file.

Time spent at the center in the open field test.

A) No significant differences were observed between Gnao1+/G184S mice and their littermate controls. B) No significant differences were observed between Gnao1+/G203R mice and their littermate controls. (TIFF) Click here for additional data file.

RotaRod learning curve was collected in 10 consecutive tests with a 5-min break between each test.

(A, C & E) Short-term learning curve comparison between Gnao1+/+ and Gnao1+/G203R in both sexes. (A & C) Both male and female Gnao1+/G203R mice showed reduced capability of keeping balance on RotaRod. (E) No significant difference in either sexes between Gnao1+/+ and Gnao1+/G203R mice was observed comparing the rate of learning. (B, D & F) Short-term learning curve comparison between Gnao1+/+ and Gnao1+/G184S in both sexes. (B & D) Both male and female Gnao1+/G184S mice showed reduced capability of keeping balance on RotaRod. (F) No significant difference in either sexes between Gnao1+/+ and Gnao1+/G184S mice was observed comparing the rate of learning. (TIFF) Click here for additional data file.

False discovery rate (FDR) calculation probed through all the parameters given by DigiGait in Gnao1+G184S mice.

All parameters showed significance at belt speed 25 cm/s are plotted. A&B) Female Gnao1+/G184S and their littermate controls showed parameters with significance detected by the FDR analysis. C&D) Male Gnao1+/G184S and their littermates controls showed parameters with significance detected by the FDR analysis. FDR is calculated by a two-stage step-up method of Benjamini, Krieger and Yekutiel. Significant values are defined as q < 0.01. (TIFF) Click here for additional data file.

False discovery rate (FDR) calculation probed through all the parameters given by DigiGait in Gnao1+/G203R mice.

All parameters that showed significance are plotted here. A&B) Female Gnao1+/G203R and their littermate controls showed 9 parameters with significance detected by the FDR analysis. C&D) Male Gnao1+/G203R and their littermates controls exhibited 27 parameters with significance detected by the FDR analysis in fore and hind limb data combined. FDR is calculated by a two-stage step-up method of Benjamini, Krieger and Yekutiel. Significant values are defined as q < 0.01. (TIFF) Click here for additional data file.

Gait analysis parameters Male Gnao1 G203R mutants.

(PDF) Click here for additional data file.

Gait analysis parameters Female Gnao1 G203R mutants.

(PDF) Click here for additional data file.

Gait analysis parameters Male Gnao1 G184S mutants.

(PDF) Click here for additional data file.

Gait analysis parameters Female Gnao1 G184S mutants.

(PDF) Click here for additional data file.

Benchling off-target list for Gnao1 G203 gRNA.

Row 1 includes the on-target gRNA for the Gnao1 G203 site. Off-target hits are scored and ranked by an inverse likelihood of off-target binding. If an off-target is predicted to occur within a coding region of a gene, the Ensembl number of the affected locus is listed in the Gene column. Analysis was performed on the Benchling platform using reference genome GRCM38 (MM10, Mus Musculus), guide length of 20bp, and an NGG PAM. (PDF) Click here for additional data file.
  62 in total

Review 1.  Sex differences in Parkinson's disease and other movement disorders.

Authors:  Kara M Smith; Nabila Dahodwala
Journal:  Exp Neurol       Date:  2014-03-28       Impact factor: 5.330

Review 2.  Regulation of neurite outgrowth by G(i/o) signaling pathways.

Authors:  Kenneth D Bromberg; Ravi Iyengar; John Cijiang He
Journal:  Front Biosci       Date:  2008-05-01

Review 3.  Expanding Phenotype of De Novo Mutations in GNAO1: Four New Cases and Review of Literature.

Authors:  David C Schorling; Tobias Dietel; Christina Evers; Katrin Hinderhofer; Rudolf Korinthenberg; Daniel Ezzo; Carsten G Bönnemann; Janbernd Kirschner
Journal:  Neuropediatrics       Date:  2017-06-19       Impact factor: 1.947

4.  GNAO1-related movement disorder with life-threatening exacerbations: movement phenomenology and response to DBS.

Authors:  Michaela Waak; Shekeeb S Mohammad; David Coman; Kate Sinclair; Lisa Copeland; Peter Silburn; Terry Coyne; Jim McGill; Mary O'Regan; Richard Selway; Joseph Symonds; Padraic Grattan-Smith; Jean-Pierre Lin; Russell C Dale; Stephen Malone
Journal:  J Neurol Neurosurg Psychiatry       Date:  2017-07-01       Impact factor: 10.154

5.  [Recurrent convulsion and pulmonary infection complicated by psychomotor retardation in an infant].

Authors:  Juan Xiong; Jing Peng; Hao-Lin Duan; Chen Chen; Xiao-Le Wang; Shi-Meng Chen; Fei Yin
Journal:  Zhongguo Dang Dai Er Ke Za Zhi       Date:  2018-02

6.  Phenotypic spectrum of GNAO1 variants: epileptic encephalopathy to involuntary movements with severe developmental delay.

Authors:  Hirotomo Saitsu; Ryoko Fukai; Bruria Ben-Zeev; Yasunari Sakai; Masakazu Mimaki; Nobuhiko Okamoto; Yasuhiro Suzuki; Yukifumi Monden; Hiroshi Saito; Barak Tziperman; Michiko Torio; Satoshi Akamine; Nagahisa Takahashi; Hitoshi Osaka; Takanori Yamagata; Kazuyuki Nakamura; Yoshinori Tsurusaki; Mitsuko Nakashima; Noriko Miyake; Masaaki Shiina; Kazuhiro Ogata; Naomichi Matsumoto
Journal:  Eur J Hum Genet       Date:  2015-05-13       Impact factor: 4.246

7.  Measuring the strength of mice.

Authors:  Robert M J Deacon
Journal:  J Vis Exp       Date:  2013-06-02       Impact factor: 1.355

8.  DNA targeting specificity of RNA-guided Cas9 nucleases.

Authors:  Patrick D Hsu; David A Scott; Joshua A Weinstein; F Ann Ran; Silvana Konermann; Vineeta Agarwala; Yinqing Li; Eli J Fine; Xuebing Wu; Ophir Shalem; Thomas J Cradick; Luciano A Marraffini; Gang Bao; Feng Zhang
Journal:  Nat Biotechnol       Date:  2013-07-21       Impact factor: 54.908

9.  No unexpected CRISPR-Cas9 off-target activity revealed by trio sequencing of gene-edited mice.

Authors:  Vivek Iyer; Katharina Boroviak; Mark Thomas; Brendan Doe; Laura Riva; Edward Ryder; David J Adams
Journal:  PLoS Genet       Date:  2018-07-09       Impact factor: 5.917

10.  Gain-of-function mutation in Gnao1: a murine model of epileptiform encephalopathy (EIEE17)?

Authors:  Jason M Kehrl; Kinshuk Sahaya; Hans M Dalton; Raelene A Charbeneau; Kevin T Kohut; Kristen Gilbert; Madeline C Pelz; Jack Parent; Richard R Neubig
Journal:  Mamm Genome       Date:  2014-04-05       Impact factor: 2.957

View more
  6 in total

1.  Gαo is a major determinant of cAMP signaling in the pathophysiology of movement disorders.

Authors:  Brian S Muntean; Ikuo Masuho; Maria Dao; Laurie P Sutton; Stefano Zucca; Hideki Iwamoto; Dipak N Patil; Dandan Wang; Lutz Birnbaumer; Randy D Blakely; Brock Grill; Kirill A Martemyanov
Journal:  Cell Rep       Date:  2021-02-02       Impact factor: 9.423

2.  Caenorhabditis elegans provides an efficient drug screening platform for GNAO1-related disorders and highlights the potential role of caffeine in controlling dyskinesia.

Authors:  Martina Di Rocco; Serena Galosi; Enrico Lanza; Federica Tosato; Davide Caprini; Viola Folli; Jennifer Friedman; Gianfranco Bocchinfuso; Alberto Martire; Elia Di Schiavi; Vincenzo Leuzzi; Simone Martinelli
Journal:  Hum Mol Genet       Date:  2022-03-21       Impact factor: 6.150

3.  Magnetic Resonance Imaging Investigation of Neuroplasticity After Ischemic Stroke in Tetramethylpyrazine-Treated Rats.

Authors:  Xue-Feng Feng; Jian-Feng Lei; Man-Zhong Li; Yu Zhan; Le Yang; Yun Lu; Ming-Cong Li; Yu-Ming Zhuang; Lei Wang; Hui Zhao
Journal:  Front Pharmacol       Date:  2022-04-26       Impact factor: 5.988

Review 4.  Motor, epileptic, and developmental phenotypes in genetic disorders affecting G protein coupled receptors-cAMP signaling.

Authors:  Serena Galosi; Luca Pollini; Maria Novelli; Katerina Bernardi; Martina Di Rocco; Simone Martinelli; Vincenzo Leuzzi
Journal:  Front Neurol       Date:  2022-08-08       Impact factor: 4.086

Review 5.  Overlaps, gaps, and complexities of mouse models of Developmental and Epileptic Encephalopathy.

Authors:  Wanqi Wang; Wayne N Frankel
Journal:  Neurobiol Dis       Date:  2020-12-07       Impact factor: 5.996

6.  Genetic modeling of GNAO1 disorder delineates mechanisms of Gαo dysfunction.

Authors:  Dandan Wang; Maria Dao; Brian S Muntean; Andrew C Giles; Kirill A Martemyanov; Brock Grill
Journal:  Hum Mol Genet       Date:  2022-02-21       Impact factor: 6.150

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.