A comparative analysis of complete plastid genomes from Prangos fedtschenkoi and Prangos lipskyi (Apiaceae).

Prangos fedtschenkoi (Regel & Schmalh.) Korovin and P. lipskyi Korovin (Apiaceae) are rare plant species endemic to mountainous regions of Middle Asia. Both are edificators of biotic communities and valuable resource plants. The results of recent phylogenetic analyses place them in Prangos subgen. Koelzella (M. Hiroe) Lyskov & Pimenov and suggest they may possibly represent sister species. To aid in development of molecular markers useful for intraspecific phylogeographic and population-level genetic studies of these ecologically and economically important plants, we determined their complete plastid genome sequences and compared the results obtained to several previously published plastomes of Apiaceae. The plastomes of P. fedtschenkoi and P. lipskyi are typical of Apiaceae and most other higher plant plastid DNAs in their sizes (153,626 and 154,143 bp, respectively), structural organization, gene arrangement, and gene content (with 113 unique genes). A total of 49 and 48 short sequence repeat (SSR) loci of 10 bp or longer were detected in P. fedtschenkoi and P. lipskyi plastomes, respectively, representing 42-43 mononucleotides and 6 AT dinucleotides. Seven tandem repeats of 30 bp or longer with a sequence identity ≥90% were identified in each plastome. Further comparisons revealed 319 polymorphic sites between the plastomes (IR, 21; LSC, 234; SSC, 64), representing 43.8% transitions (Ts), 56.1% transversions (Tv), and a Ts/Tv ratio of 0.78. Within genic regions, two indel events were observed in rpoA (6 and 51 bp) and ycf1 (3 and 12 bp), and one in ndhF (6 bp). The most variable intergenic spacer region was that of accD/psaI, with 21.1% nucleotide divergence. Each Prangos species possessed one of two separate inversions (either 5 bp in ndhB intron or 9 bp in petB intron), and these were predicted to form hairpin structures with flanking repeat sequences of 18 and 19 bp, respectively. Both species have also incorporated novel DNA in the LSC region adjacent to the LSC/IRa junction, and BLAST searches revealed it had a 100 bp match (86% sequence identity) to noncoding mitochondrial DNA. Prangos-specific primers were developed for the variable accD/psaI intergenic spacer and preliminary PCR-surveys suggest that this region will be useful for future phylogeographic and population-level studies.

INTRODUCTION

The genus Prangos Lindl. (Apiaceae, Umbelliferae) comprises some 45 species mostly endemic to Asia (Lyskov, Degtjareva, Samigullin, & Pimenov, 2017). They are typically herbaceous, xerophytic plants that perform important roles as edificators of biotic communities. They are also of great economic importance, as many of its members are sources of phytocoumarins, ornamental plants, and fodder for cattle. The plants are diverse morphologically and in their fruit anatomy, resulting in ever‐changing species delimitations and infrageneric classifications (Lyskov et al., 2017).

Prangos fedtschenkoi (Regel & Schmalh.) Korovin and P. lipskyi Korovin are rare species endemic to the mountainous regions of Middle Asia (Shishkin, 1950). P. fedtschenkoi is more common in the Pamir‐Alay than the Tien Shan mountain systems, with several populations occurring in Kyrgyzstan and Tajikistan (Figure 1a). P. lipskyi is an endemic to a narrow geographic area in the Western Tien Shan Mountains and grows on talus slopes (Figure 1b). A recent revision of the genus based on morphological, carpological, and molecular evidence revealed that P. fedtschenkoi and P. lipskyi, along with three other species, unite as monophyletic in Prangos subgen. Koelzella (M. Hiroe) Lyskov & Pimenov (Lyskov et al., 2017). In the Bayesian inference tree of molecular data, these two species form two branches of a trichotomy (with the clade of P. pabularia Lindl. + P. ornata Kuzjmina), suggesting that they may comprise monophyletic sister taxa in other trees. Other molecular systematic studies including Prangos species exist (e.g., Banasiak et al., 2013), however, none included representation of P. fedtschenkoi or P. lipskyi.

Figure 1

A. Prangos fedtschenkoi. Piedmont of the Nuratau range (Pamir‐Alay mountain system), Forish district, Jizzakh region, Uzbekistan. Photo by N. Beshko (04 June 2009). B. Prangos lipskyi. Chatkal range (Western Tien Shan mountain system), Sary ‐ Chelek Nature Reserve, Jalal ‐ Abad Province, Kyrgyzstan. Photo by G. Lazkov (10 July 2015).

Significant declines of both P. fedtschenkoi and P. lipskyi populations have resulted from human activities, such as agriculture, construction, overgrazing, and collection for pharmaceutical and cosmetological purposes (CACILM, 2006; Limin & Zhang, 2012). P. fedtschenkoi is also intensively collected from the wild, as there are currently no plantations of this valuable resource plant. Only limited information is available on the nature of genetic variability in P. fedtschenkoi and P. lipskyi that can be used to inform conservation strategies, management, and species restoration. Recently, six populations of P. fedtschenkoi from Uzbekistan were studied using 10 intersimple sequence repeat (ISSR) markers (Mustafina et al., 2017). A high level of genetic differentiation among populations was detected based on Nei's genetic diversity analysis and AMOVA that was likely caused by range fragmentation as a result of anthropogenic impacts. These factors, along with strong inbreeding, may have decreased within‐population genetic diversity because of low gene flow.

To aid in the development of molecular markers useful for intraspecific phylogeographic and population‐level genetic studies of these rare, but ecologically and economically important plant species, we determined their complete plastid genome sequences, performed a comparative analysis of these data, and compared the results obtained to several previously published plastomes of other Apiaceae species. While the plastomes are typical of Apiaceae and most other eudicot plastid DNAs in their structural organization, gene arrangement, and gene content, variable regions were revealed that will be useful as molecular markers in future studies.

MATERIALS AND METHODS

Plants materials and DNA extraction

Voucher specimens of field‐collected individuals are as follows: Prangos fedtschenkoi, Baysun region, Surkhandarya province, Uzbekistan, 28 June 2015, Turginov 2310 (TASH) and Prangos lipskyi, Chatkal chain, Sari‐Chelek Nature Reserve, Kyrgyzstan, 11 July 2015, Lazkov 266 (FRU). DNA extractions were conducted using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and checked by electrophoresis in a 1.3% agarose gel, stained with ethidium bromide, and run with a DNA ladder (Thermo Scientific, Waltham, MA, USA). Concentration and quality of DNA were checked using a NanoDrop 2000 spectrophotometer (Thermo Scientific).

Sequencing and plastid genome assembly

Plastid genome sequences were obtained using the Illumina HiSeq 2000 sequencing system and standard protocols. A total of 12,484,132 reads of P. fedtschenkoi and 10,849,852 reads of P. lipskyi were analyzed. The filtered sequences were assembled using Bowtie 2 v. 2.2.3 (Langmead & Salzberg, 2012) with Daucus carota subsp. sativus (domesticated carrot; GenBank accession number DQ898156) used as the reference sequence since its plastome has ancestral IR boundaries and no gene rearrangements (Ruhlman et al., 2006). A total of 187,581 reads of P. fedtschenkoi and 389,753 reads of P. lipskyi were mapped to the reference sequence, with an average coverage of 599.5× for P. fedtschenkoi and 1,086× for P. lipskyi.

Chloroplast gene annotation

Gene annotations were performed using BLAST (BLASTN, PHI‐BLAST, BLASTX) and the program Dual Organellar Genome Annotator (DOGMA; Wyman, Jansen, & Boore, 2004). Gene nomenclature followed the Chloroplast Genome Database (http://chloroplast.cbio.psu.edu; Cui et al., 2006). Complete plastid genomes have been deposited in GenBank (P. fedtschenkoi, KY652265; P. lipskyi, KY652266) using Sequin v. 15.50 (6 January 2017). Circular genome maps were drawn using OrganellarGenomeDRAW (Lohse, Drechsel, Kahlau, & Bock, 2013), with nomenclature and arrangement of the plastome's major structural components following convention. Sequences of six Apiaceae plastomes, that is, D. carota, Petroselinum crispum (HM596073), Coriandrum sativum (KR002656), Prangos trifida (NC037852), and the two newly sequenced plastomes of P. fedtschenkoi and P. lipskyi, were compared to align IR single‐copy boundary positions.

Sequence analysis

AT content and codon usage were obtained using MEGA6 v. 6.06 (Tamura, Stecher, Peterson, Filipski, & Kumar, 2013). Plastid genomes were aligned using Mauve v. 2.3.1 (Darling, Mau, & Perna, 2010) and sequences of the protein‐coding genes and intergenic spacer (IGS) regions were extracted. Nucleotide diversity and Ka/Ks values of protein‐coding regions were analyzed using DnaSP v. 5.10.01 (Librado & Rozas, 2009) and MEGA6. Polymorphic sites (Ts and Tv) were analyzed by pairwise comparison of each protein‐coding region, intergenic spacer, and intron using MUSCLE (Edgar, 2004) and the SNP finder program integrated into Geneious v. 10.3 (Kearse et al., 2012). To determine the origin of the novel plastid DNA fragments adjacent to IRa/LSC, these sequences were checked against the NCBI nucleotide DNA database using BLAST.

Prangos‐specific primers

Primers specific for the accD/psaI IGS region in Prangos were developed with software Primer3 v. 2.3.7 (Untergasser et al., 2012) and synthesized by Macrogen, Korea. Three pairs of primers located in the spacer region between accD and psaI were considered, with the goal of identifying those primer pairs yielding the best results. PCR was conducted with the following regime: initial denaturation at 94°C (1 min), followed by 35 cycles of denaturation at 94°C (30 s), annealing at 54°C (40 s), extension at 72°C (40 s), and a final extension at 72°C (45 min). PCR products of the accD/psaI intergenic spacer region were obtained for 46 additional accessions belonging to 16 Middle Asian Prangos species, including those from geographically remote populations. P. fedtschenkoi was represented by 10 accessions (from Kyrgyzstan, Tajikistan, and Uzbekistan) and P. lipskyi was represented by three accessions (from Kyrgyzstan and Uzbekistan).

Repeat and inversion analyses

Short sequence repeats (SSRs) were analyzed with Phobos v. 3.3.12 (Mayer, Leese, & Tollrian, 2010) using the default mismatch and a gap score of −5, with a size threshold ≥10 bp. Repeating sequences were analyzed by REPuter (Kurtz et al., 2001) and Tandem Repeats Finder v. 4.07b (Benson, 1999). Direct and inverted (palindromic) repeats were identified with a size ≥30 bp and a Hamming distance of 3 (limiting hits to sequence identity of ≥90%). Secondary structure was predicted by mFOLD (Zuker, 2003). To survey for the presence of identical tandem repeats and the two small inversions and their associated flanking repeat regions identified in the plastomes of P. fedtschenkoi and P. lipsky in related taxa, the complete plastid genomes of 23 other Apiaceae species (represented by 25 accessions) and two Araliaceae species were downloaded from NCBI's public database. Sequence similarity searches and alignments were carried out using Clustal W (Thompson, Higgins, & Gibson, 1994). Repeating sequences were analyzed by REPuter, and the forms and stabilities of hairpin structures were evaluated by MFOLD.

RESULTS

General plastome features

The plastomes of P. fedtschenkoi and P. lipskyi are typical of most other nonmonocot angiosperm plastid DNAs in their structural organization, gene arrangement, and gene content (Figures 2 and 3). They have two large inverted repeats (IRs), separated by large single‐copy (LSC) and small single‐copy (SSC) regions. A comparison of their major structural features, to each other and to P. trifida and D. carota, is presented in Table 1. The plastomes of P. fedtschenkoi and P. lipskyi range in size from 153,626 bp in P. fedtschenkoi to 154,143 bp in P. lipskyi, with the latter having a substantially larger LSC region. Both plastomes share identical compliments of genes, each with four unique rRNA genes, 30 unique tRNA genes, and 79 unique protein‐coding genes. A list of unique genes present in both plastomes, as represented by P. fedtschenkoi, is presented in Table 2. Allowing for duplication of genes in the IR and open reading frames (ORFs), each plastome contains 134 complete, predicted coding regions. Comparing the Prangos plastome structural features to those of D. carota reveals major differences in sizes of all major structural components and total number of predicted coding regions (Table 1).

Figure 2

Circular plastome map of Prangos fedtschenkoi. Genes are classified into 14 groups according to their biological function and are shown by different colored boxes. Genes transcribed clockwise are shown inside of the circle; genes transcribed counter‐clockwise are shown outside of the circle. The small single‐copy (SSC) region is 17,494 bp in size, the large single‐copy (LSC) region is 85,614 bp in size, and each inverted repeat (IRa, IRb) region is 25,259 bp in size. The internal gray circle indicates GC content and the thin circular line marks the 50% threshold. The nucleotide sequence of the P. fedtschenkoi chloroplast genome appears under the accession number KY652265 in the DDBJ/GenBank databases

Figure 3

Circular plastome map of Prangos lipskyi. Genes are classified into 14 groups according to their biological function and are shown by different colored boxes. Genes transcribed clockwise are shown inside of the circle; genes transcribed counter‐clockwise are shown outside of the circle. The small single‐copy (SSC) region is 17,402 bp in size, the large single‐copy (LSC) region is 86,131 bp in size, and each inverted repeat (IRa, IRb) region is 25,305 bp in size. The internal gray circle indicates GC content and the thin circular line marks the 50% threshold. The nucleotide sequence of the P. lipskyi chloroplast genome appears under the accession number KY652266 in the DDBJ/GenBank databases

Table 1

Comparison of major structural features of the plastomes of Prangos fedtschenkoi, Prangos lipskyi, Prangos trifida, and Daucus carota

Feature	P. fedtschenkoi	P. lipskyi	P. trifida	D. carota
Entire plastome size (bp)	153,626	154,143	153,510	155,911
IR size (bp)	25,259	25,305	24,792	27,051
LSC region size (bp)	85,614	86,131	86,481	84,242
SSC region size (bp)	17,494	17,402	17,445	17,567
Number of coding regions	134	134	134	136
Number of genes	113	113	113	115
Number of protein‐coding genes	79	79	79	81
Number of genes duplicated in the IR	21	21	21	21
Number of pseudogenes	2 (rpl2, ycf1)	2 (rpl2, ycf1)	2 (rpl2, ycf1)	2 (rps19, ycf1)
Number of open reading frames	4	4	4	4
Number of tRNA genes	30	30	30	30
Number of rRNA genes	4	4	4	4
Number of genes with intron(s)	18	18	18	18

Table 2

Unique genes of the Prangos fedtschenkoi plastome

Group of gene	Name of gene	Number of genes
RNA genes
Ribosomal RNAs	rrn4.5 (x2), rrn5 (x2), rrn16 (x2), rrn23 (x2)	4
Transfer RNAs	trnA‐UGC(x2)a, trnC‐GCA, trnD‐GUC, trnE‐UUC, trnF‐GAA, trnfM‐CAU, trnG‐GCC, trnG‐GCCa, trnH‐GUG, trnI‐CAU (x2), trnI‐GAU (x2)a, trnK‐UUUa, trnL‐CAA (x2), trnL‐UAAa, trnL‐UAG, trnM‐CAU, trnN‐GUU (x2), trnP‐UGG, trnQ‐UUG, trnR‐ACG (x2), trnR‐UCU, trnS‐GCU, trnS‐GGA, trnS‐UGA, trnT‐GGU, trnT‐UGU, trnV‐GAC(x2), trnV‐UACa, trnW‐CCA, trnY‐GUA	30
Protein genes
Photosynthesis
Photosystem I	psaA, psaB, psaC, psaI, psaJ, ycf3b	5
Photosystem II	psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ	15
Cytochrome b/f complex	petA, petBa, petDa, petG, petL, petN	6
NADH‐dehydrogenase	ndhAa, ndhB(x2)a, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK	11
ATP synthase	atpA, atpB, atpE, atpFa, atpH, atpI	6
Large subunit of Rubisco	rbcL	1
ATP‐dependent protease	clpPb	1
Envelope membrane protein	cemA	1
Ribosomal proteins
Large units	rpl2 (x2, part)a, rpl14, rpl16a, rpl20, rpl22, rpl23 (x2), rpl32, rpl33, rpl36	9
Small units	rps2, rps3, rps4, rps7 (x2), rps8, rps11, rps12a (x2), rps14, rps15, rps16a, rps18, rps19	12
Transcription/translation
DNA‐dependent RNA polymerase	rpoA, rpoB, rpoC1a, rpoC2	4
Miscellaneous proteins	accD, ccsA, infA, matK	4/75
Hypothetical proteins and Conserved reading frame	ycf1 (x2, part), ycf2 (x2), ycf4	3/4
Total number of unique genes		113

Genes containing one intron.

Genes containing two introns.

In P. fedtschenkoi, 57.62% of the plastome consists of gene‐coding regions (54.02% proteins and 3.6% RNAs). In P. lipskyi, 57.61% of the plastome is gene‐coding (54.01% proteins and 3.6% RNAs). Noncoding regions comprise approximately 42.4% of each plastome (11.3% intron and 31.1% IGS regions). The overall AT content in each Prangos species was 62.3% (Table 3). The AT content of the IR (57.1%) is lower than that of both LSC (64.0%) and SSC (68.7%) regions. Within protein‐coding regions of P. fedtschenkoi, the AT content is higher at the third codon position (63.0%), whereas in P. lipskyi the AT content is lowest at the third codon position (61.7%). The codon usage pattern suggests that codons containing A/T in the third position are given preference in P. fedtschenkoi and P. lipskyi (Supporting Information Tables S1 and S2), in accordance with the codon usage pattern of the majority of eudicot species.

Table 3

Comparison of nucleotide composition between Prangos fedtschenkoi and Prangos lipskyi plastomes

	Nucleotide composition of whole genome (%)						AT content (%)			AT content in codon regions (%)
	T	C	A	G	AT	GC	LSC	IR	SSC	1	2	3
P. fedtschenkoi	31.4	19.2	30.8	18.5	62.3	37.7	64.0	57.1	68.7	61.6	61.9	63.0
P. lipskyi	31.4	19.2	30.8	18.5	62.3	37.7	64.0	57.1	68.7	62.9	62.9	61.7

IR single‐copy boundary positions

A comparison of IR single‐copy boundary positions of the three Prangos species, D. carota, and two additional species of the family Apiaceae (Petroselinum crispum, parsley; Coriandrum sativum, coriander) is presented in Figure 4. In Prangos spp., the IRb/LSC boundary falls in gene rpl2, which results in rpl2 pseudogenes of 567 bp in P. fedtschenkoi and 591 bp in P. lipskyi in IRa adjacent to the IRa/LSC junction. These rpl2 pseudogenes have lost the second exon of the gene. A similar IRb/LSC boundary position in rpl2 occurs in P. trifida and P. crispum. D. carota has the ancestral IRb/LSC boundary position in or near rps19. A considerable contraction of the IR occurs in C. sativum. Here, IRa/LSC is located downstream of trnK‐UUU, the positions of trnH‐GUG and psbA are contained within the IR, and the IRb/LSC border falls downstream of rps12 and trnV‐GAC. In all species, the IRa/SSC boundary position occurs in ycf1, creating ycf1 pseudogenes ranging between 1,674 bp (P. fedtschenkoi) and 1,939 bp (P. trifida) in IRb at the IRb/SSC boundary position.

Figure 4

Schematic comparison of the large single‐copy (LSC), inverted repeat (IRa, IRb), and small single‐copy (SSC) regions among six Apiaceae plastid genomes: Daucus carota, Petroselinum crispum, Coriandrum sativum, Prangos trifida, Prangos fedtschenkoi, and Prangos lipskyi. Genes overlapping or flanking IR single‐copy junctions are identified (their sizes do not correlate with their actual length). Pseudogenes are denoted by Ψ (i.e., Ψycf1, Ψrps19, Ψrpl2)

Plastid genome sequence divergence

The average sequence divergence between entire plastomes of P. fedtschenkoi and P. lipskyi was 0.6%. Average sequence divergences between P. fedtschenkoi and D. carota and between P. lipskyi and D. carota were 9.1% and 9.9%, respectively. The average divergence values of the IR regions between P. fedtschenkoi and P. lipskyi, between P. fedtschenkoi and D. carota, and between P. lipskyi and D. carota were 0.1%, 9.0%, and 9.5%, respectively, while divergence values of the LSC regions were 1.1%, 9.1%, and 11.4%, respectively, and divergence values of the SSC regions were 1.1%, 9.4%, and 9.3%, respectively.

Coding region divergence

Detailed sequence comparisons of 83 protein‐coding genes between P. fedtschenkoi and P. lipskyi are provided in Supporting Information Table S3. Average Ka/Ks ratios for these gene regions were 0.3988 across entire plastomes, 0.2857 for the IRs, and 0.2476 for the LSC and 0.6795 for the SSC regions. Sequence divergence values of each protein‐coding gene region between P. fedtschenkoi and P. lipskyi varied from identity to 1.3% (reaching 0.1% in the IR, 1.3% in the LSC, and 0.7% in the SSC). Genes showing highest sequence divergence included rpoA (1.3%), psbT (1.0%), psbI (0.9%), and ycf1 (0.7%). Genes rpoA, ycf1, and ndhF exhibited length difference in pairwise comparisons resulted from multiple indels and length variation (of 57, 15, and 6 bp, respectively).

Intergenic spacer region divergence

Prangos plastomes contain 108 intergenic spacer regions longer than 10 bp in length (Supporting Information Table S4). Sequence divergence values of these IGS regions ranged from identity to 21.1% (reaching 6.9% in the IR, 21.1% in the LSC, and 19.9% in the SSC). The most divergent IGS regions are accD/psaI (21.1%), psbZ/trnG‐GCC (13.2%), rps16/trnQ‐UUG (8.5%), and rps14/psaB (7.3%) in the LSC, rps19/rpl2 (6.9%) in the IR, and ndhE/ndhG (19.9%) in the SSC.

Small‐ and medium‐sized insertion and deletion events prevailed over long length indels in IGS regions between the P. fedtschenkoi and P. lipskyi plastomes. The total length of all indel events varied from 7 bp in the IR, 119 bp in the SSC, to 641 bp in the LSC, totaling 767 bp. Medium‐sized indel events (20–40 bp) occurred in psbZ/trnG‐GCC (38 bp), accD/psaI (34 bp), and petA/psbJ (23 bp) in the LSC, and in ndhF/rpl32 (20 bp) in the SSC. Longer indel events were observed in rps16/trnQ‐UUG (69 bp) and accD/psaI (57 and 11 bp) in the LSC, and in ndhE/ndhG (50 bp) in the SSC.

Intron region divergence

Detailed sequence comparisons among intron regions in P. fedtschenkoi and P. lipskyi are provided in Supporting Information Table S5. The most conserved intron, showing no variation, is that within 3’rps12 of the IR. Intron diversity levels varied from identity to 7.4% (from identity to 0.9% in the IR, from 0.3% to 7.4% in the LSC, and was 0.4% [ndhA] in the SSC). The most divergent intron regions were those in genes trnL‐UAA (7.4%), rpl16 (2.7%), ycf3 (2.3%), and clpP (2.3%) in the LSC and ndhB (0.9%) in the IR. The length of all intron indel events totaled 118 bp. The majority of indels were less than 20 bp. One longer sized indel was located in the trnL‐UAA intron (32 bp).

Polymorphic sites

Data on polymorphic sites within the two Prangos plastomes are presented in Supporting Information Tables S3, S4 and S5. The total number of polymorphic sites in the protein‐coding regions was 121, including seven in the IR, 68 in the LSC, and 46 in the SSC. Of these, 51.2% are Ts and 48.8% are Tv. The total number of the polymorphic sites in the intergenic spacer regions was 145, including five in IR, 124 in LSC, and 16 in SSC. The total number of the polymorphic sites in all introns is 53, including nine in the IR, 42 in the LSC, and two in the SSC. Overall, the total number of polymorphic sites in all regions of the plastome is 319, including 21 in the IR, 234 in LSC, and 64 in SSC (representing 43.8% Ts and 56.1% Tv).

Development of Prangos‐specific primers

In pairwise comparisons of sequences P. fedtschenkoi and P. lipskyi, the accD/psaI IGS region was deemed most variable, with a level of nucleotide divergence of 21.1%. This region also includes five indel events, of 6, 11, 11, 34, and 57 bp (Supporting Information Table S4). With these high levels of nucleotide and length variation, the region was considered further for future use in low‐level taxonomic and population studies. Of the three pairs of Prangos‐specific primers considered (Table 4), the accD/psaI_3F and accD/psaI_3R primer pair produced the strongest, single product in PCR amplifications of 46 additional accessions belonging to 16 Prangos species from Middle Asia, including those from geographically remote populations (Mustafina et al., unpublished data). Comparisons of protein‐coding genes, intergenic spacer regions, and introns among P. fedtschenkoi, P. lipskyi, and P. trifida plastomes provided evidence of high sequence variability within accD/psaI (16.5%), rps16/trnQ‐UUG (16.5%), and psbZ/trnG‐GCC (11.4%) IGS regions (Supporting Information Tables S6, S7 and S8). In the P. trifida plastome, the petA/psbJ IGS region was also highly variable (26.9%); however, the high variability of this region is a result of a unique 315 bp insertion.

Table 4

Three pairs of Prangos‐specific primers developed for the accD/psaI intergenic spacer region for use in future low‐level taxonomic and population studies. For each primer pair, forward (F) and reverse (R) primers are indicated

Primer	Sequence	Binding region	Tan (°C)	GC (%)
accD/psaI_1F	5’‐TGGGAGATATCATTATTGCC‐3’	59,651–59,670	54.3	40.0
accD/psaI_1R	5’‐ GCAATGGCTTCTTTATTTCT‐3’	60,544–60,563	52.3	35.0
accD/psaI_2F	5’‐CGCTTTCTTTCCTTTGAATC‐3’	59,844–59,863	54.3	40.0
accD/psaI_2R	5’‐GTAGGCTTAGTATTTCCGG‐3’	60,520–60,538	55.2	47.3
accD/psaI_3F	5’‐TTAATCGTACCACGTAATCC‐3’	59,788–59,807	54.3	40.0
accD/psaI_3R	5’‐GCAATGGCTTCTTTATTTCT‐3’	60,544–60,563	52.3	35.0

Binding region: accD/psaI spacer region within Mauve alignment of P. fedtschenkoi and P. lipskyi plastomes; Tan: annealing temperature.

Insertions of novel DNA

Unique, noncoding DNA of 242 bp in P. fedtschenkoi, 596 bp in P. lipskyi, and 443 bp in P. trifida occurs between gene trnH‐GUG (LSC) and the IRa/LSC junction (Figure 4). BLAST searches of these novel DNA sequences did not show any significant similarity to any other known plastid DNA sequence. Instead, the BLAST results revealed small, significant matches to mitochondrial DNA (specifically, to an IGS region adjacent to mitochondrial gene cytochrome b [cob] in D. carota). The results of a BLAST search of the 242 bp novel insert in P. fedtschenkoi are shown in Table 5. Both P. fedtschenkoi and P. lipskyi plastomes showed a 100 bp match having 86% sequence similarity to this mtDNA region. The P. trifida plastome showed a 102 bp match having 88.2% sequence similarity to this same region. Alignment of these Prangos novel DNA fragments showing similarities to D. carota mtDNA (i.e., positions 147–242 bp in P. fedtschenkoi, 501–596 bp in P. lipskyi, and 348–443 bp in P. trifida) with a 101 bp fragment of the IGS region adjacent to D. carota mitochondrial gene cob showed 85 identical sites across the four sequences compared (Supporting Information Figure S1).

Table 5

Results of BLAST searches of the nucleotide database (as of 3 October 2018) querying the 242 bp novel insertion sequence in Prangos fedtschenkoi. Only hits with lengths ≥100 bp and a percent similarity at least 86% are shown

Accession	Species	Location	Length of match (bp)	Percent similarity
AY007816	Daucus carota	cytochrome b (cob); ORF25 (orf25)	100	86
AY007821	Daucus carota	ATPase8 (ATP8); cytochrome b (cob)	100	86
JQ248574	Daucus carota subsp. sativus	cytochrome b (cob); ORF25 (orf25)	100	86

Repeat analysis

Repeat analysis identified 49 short motif SSRs in P. fedtschenkoi and 48 SSRs in P. lipskyi plastomes having repeat lengths ≥10 bp (Table 6). In P. fedtschenkoi, 43 of these were mononucleotides and six were AT dinucleotides, and in P. lipskyi 42 were mononucleotides and six were AT dinucleotides. Repeat lengths of A and T classes of mononucleotides were 10–17 bp and 10–14 bp, respectively. In P. lipskyi, a poly‐C nucleotide repeat of 11 bp was found in the trnA‐UGC intron (IRa) and a poly‐G nucleotide repeat of 11 bp occurred in the trnA‐UGC intron (IRb). AT dinucleotide repeats with lengths of 10–14 bp were found in P. fedtschenkoi and P. lipskyi, with a repeat number of 6.

Table 6

Features of short sequence repeats (SSRs) with repeat length ≥10 bp in Prangos fedtschenkoi and Prangos lipskyi plastomes. Repeats include both copies of the IR

Unit size	Repeat length, bp	Repeat number
		P. fedtschenkoi	P. lipskyi
A	10–17	20	17
T	10–14	23	23
C	11	—	1
G	11	—	1
AT	10–14	6	6

The plastomes of P. fedtschenkoi and P. lipskyi each had seven large tandem repeats, with repeat size ≥30 bp and sequence identity >90% (Tables 7 and 8). Repeat units are repeated 2–4 times, with the majority occurring in the LSC region. Among the ten uniquely occurring large tandem repeats identified in Prangos, most were palindromic dispersed. Four tandem repeats have identical features and are located within the same genomic regions in both plastomes; two of these occur in IGS regions and two others occur in coding sequence regions. A survey for these 10 Prangos large tandem repeats in 27 other accessions of Apiaceae and Araliaceae resulted in three (i.e., repeat nos. 4, 5, and 6 in P. fedtschenkoi [Table 7] and repeat nos. 3, 5, and 6 in P. lipskyi [Table 8]) being widely distributed (Supporting Information Table S9); one of these occurs in the petN/psbM IGS region, and the other two occur in coding sequence regions. An additional repeat occurring in both psbM/trnD‐GUC and trnE‐UUC/trnT‐GGU IGS regions was shared by P. fedtschenkoi, P. lipskyi, P. trifida, and Crithmum maritimum. P. fedtschenkoi and P. trifida share a repeat within the trnL‐UAA intron.

Table 7

Features of large tandem repeat loci (≥30 bp) in the Prangos fedtschenkoi plastome

Repeat #	Repeat unit	Repeat number	Size (bp)	Repeat type	Location
1	ATTGACGAGCTACAGCACTCGCACCTATTAACGCAACTAAAAGAATTATT	2	100	Forward	IGS (ndhE ‐ ndhG)
2	AAAAGGGAAAGATGATGGATGTACTTATTGAATCTGTCG	2	78	Palindromic dispersed	IGS (psbM – trnD‐GUC; trnE‐UUC ‐ trnT‐GGU)
3	ATACGTATGTATATAC	2	32	Forward	Intron (trnL‐UAA)
4	GAGGATATTGATGCTAGTGAGGATATTGATGCTAGTGA	4	76 (2×)	Palindromic dispersed	CDS (ycf2)
5	ACGGAAAGAGAGGGATTCGAACCCTCGGTA	2	60	Palindromic dispersed	CDS (trnS‐GCU; trnS‐GGA)
6	GTAAGAAAGAAATAT	2	30	Palindromic	IGS (petN – psbM)
7	ATATTCATAAAGTAATGATA	2	40	Forward	IGS (ndhF – rpl32)

The bold characters represent the shared tandem repeats with P. lipskyi chloroplast genome.

CDS: coding DNA sequence; IGS: intergenic sequence.

Table 8

Features of large tandem repeat loci (≥30 bp) in the Prangos lipskyi plastome

Repeat #	Repeat unit	Repeat number	Size (bp)	Repeat type	Location
1	ATCATATAAATACAAAGATTATATTCATAATTCTATTCAT	2	40	Palindromic dispersed	IGS (psbZ ‐ trnG‐GCC; psaC – ndhE)
2	AAAAGGGAAAGATGATGGATGTACTTATTGAATCTGTCG	2	78	Palindromic dispersed	IGS (psbM – trnD‐GUC; trnE‐UUC ‐ trnT‐GGU)
3	GAGGATATTGATGCTAGTGAGGATATTGATGCTAGTGA	4	76 (2×)	Palindromic dispersed	CDS (ycf2)
4	ATGATATATGCTTTTGTACCTTCTATACTCACTTAG	2	72	Forward dispersed	IGS (accD ‐ psaI)
5	ACGGAAAGAGAGGGATTCGAACCCTCGGTA	2	30	Palindromic dispersed	CDS (trnS‐GCU; trnS‐GGA)
6	GTAAGAAAGAAATAT	2	30	Palindromic	IGS (petN ‐ psbM)
7	ATGATAAAAAATGGACATTATGA	2	46	Forward	IGS (petA – psbJ)

The bold characters represent the shared tandem repeats with P. fedtschenkoi chloroplast genome.

CDS: coding DNA sequence; IGS: intergenic sequence.

Stem–loop hairpin structures

Each Prangos species possessed one of two small inversions, of either 5 or 9 bp (Figure 5). The first occurs in the P. lipskyi ndhB intron in the IR, thus there are two copies of this inversion present; each copy has repeat sequences of 18 bp at its ends. The second inversion occurs in the P. fedtschenkoi petB intron and has repeat sequences of 19 bp at its ends. All regions form distinct stem–loop hairpin structures, with the sequences of the loop regions flip‐flopped in each Prangos species.

Figure 5

Short inversion mutations and associated secondary structure between Prangos fedtschenkoi and Prangos lipskyi plastomes. Inversions are located within intron regions of ndhB (IRb, IRa) and petB. Free energy of the secondary structures: (a) dG = −16.42 kcal/mol; dG = −16.72 kcal/mol; (b) dG = −19.37 kcal/mol, dG = −19.98 kcal/mol

Results of a survey for the presence of these two small inversions and their associated flanking inverted repeats in other Apiaceae and Araliaceae accessions are presented in Supporting Information Tables S10 and S11. The 5 bp inversion of P. lipskyi, represented by sequence ACCCA, is also detected in P. trifida, while similar sequences (e.g., ACTCA) are present in Anthriscus, Carum, Coriandrum, and Araliaceae. In contrast, the sequence TGGGT of P. fedtschenkoi, or TGAGT with 1 bp change, occurs in 20 other accessions, including Bupleurum, the most basal taxon within Apiaceae subfamily Apioideae. The 9 bp inversion of P. fedtschenkoi, with sequence ACGACAAGA, also occurs in Anethum graveolens, Carum carvi, and Foeniculum vulgare, and with 1 bp change (ACGAAAAGA) in Hansenia spp. and Tiedemannia filiformis. In contrast, the loop sequence of P. lipskyi and P. trifida, TCTTGTCGT, and similar sequence TCTTTTCGT, occurs in multiple other taxa. While the congeners of Angelica (4 spp.), Bupleurum (2 spp.), and Hansenia (4 spp.) are each represented by the same loop sequence for each of the two inversions, these loop regions are actually quite variable, with multiple motifs represented.

DISCUSSION

The results of this study have multiple, important implications. First, entire plastome sequences were determined for two endemic species of Prangos from Middle Asia: P. fedtschenkoi, a valuable resource plant; and P. lipskyi, a narrow endemic species of the Western Tien Shan Mountains. Prangos is treated in the Cachrys clade of Apiaceae based on molecular phylogenetic study (Downie, Spalik, Katz‐Downie, & Reduron, 2010). A comparative analysis of these plastomes identified new loci, specifically the accD/psaI IGS region, that offer levels of variation higher than those regions commonly employed in molecular phylogenetic studies of the family. Second, the Prangos‐specific primers developed and surveyed for the accD/psaI IGS region will be useful for future phylogeographic and population‐level studies. Similarly, the unique short repeated regions described for each plastome will be helpful to understand the genetic potential of each population, which is important in the development of ex situ conservation strategies. Third, the incorporation of novel DNA at the LSC/IRa junction suggestive of mtDNA adds to the growing body of evidence showing introgression of mtDNA into the angiosperm plastome. Fourth, the presence of two different inversions in sister species, each in one species but not the other, provides another marker that can be surveyed in a greater sampling of the group. However, similar inversions can occur in parallel in more distantly related taxa, thus reducing their phylogenetic utility.

Identification of variable loci

Direct comparisons of 83 protein‐coding regions, 113 IGS regions, and 18 introns from three complete Prangos plastomes resulted in the identification of seven loci having high nucleotide and length variability: accD/psaI, psbZ/trnG‐GCC, rps16/trnQ‐UUG, rps14/psaB, ndhE/ndhG, petA/psbJ, and the trnL‐UAA intron. Shaw et al. (2005) have discussed that the ideal plastid region for phylogenetic investigation should combine high variability with fragments of approximately 700–1,500 bp in size that will permit ease of PCR amplification. Using these criteria, the regions most suitable for phylogenetic inference and population‐level analyses in Prangos are accD/psaI, psbZ/trnG, rps16/trnQ, and the trnL intron. Within Apiaceae, the plastid loci most frequently employed in molecular phylogenetic studies to date have included the rpl16, rpoC1, and rps16 introns and the trnH/psbA, trnD/trnT, and trnF/trnL/trnT IGS regions (Downie & Jansen, 2015). In Prangos, accD/psaI, and psbZ/trnG are more variable and better suited for intraspecific and population‐level studies than these other loci. Indeed, the accD/psaI IGS region was listed among the most variable loci identified from the comparative analysis of five plastid genomes of Apiaceae (Downie & Jansen, 2015). In studies of other families, these aforementioned loci have previously been considered useful in resolving relationships. The accD/psaI region was used in studies of Pyrus (Rosaceae), Dendrochilum (Orchidaceae), and Castanea (Fagaceae; Shaw, Lickey, Shilling, & Small, 2007). The psbZ/trnG region was found most divergent in the analysis of 13 Gossypium plastid genomes (Malvaceae; Xu et al., 2012). The rps16/trnQ region included many phylogenetically informative indels in Carphephorus (Asteraceae), Gratiola (Plantaginaceae), Prunus (Rosaceae), and Trillium (Melanthiaceae; Shaw et al., 2007), and the trnL intron resolved relationships in Gentianaceae (Yuan et al., 2003).

Novel DNA

The three Prangos species examined herein have each incorporated novel DNA into the LSC region adjacent to the LSC/IRa junction, with BLAST searches revealing 100–102 bp matches having ≥86% sequence identity to an IGS region adjacent to Daucus mitochondrial gene cob. The introgression of mtDNA into the plastid genome is not without precedence in Apiaceae, for previous studies have also reported the presence of mtDNA in the plastomes of some Apiaceae species (Downie & Jansen, 2015; Goremykin, Salamini, Velasco, & Viola, 2009; Iorizzo, Grzebelus, et al., 2012a; Iorizzo, Senalik, et al., 2012b; Peery, Downie, Jansen, & Raubeson, 2011). In P. crispum, for example, 345 bp of novel noncoding DNA has been incorporated into the LSC region adjacent to the LSC/IRb boundary and BLAST searches querying this insert resulted in hits of a 122 bp region to angiosperm mtDNA (Downie & Jansen, 2015). A comparison of IRa/LSC boundaries from 34 species of Apiaceae revealed that those species with their LSC/IRb boundaries within rpl2 have insertions suggestive of mtDNA, ranging in size from 40 to 447 bp, between IRa and trnH‐GUC (Peery, 2015).

Nevertheless, we interpret these results cautiously, for in the absence of complete mitochondrial genomes from Prangos and other related Apiaceae, the mitochondrial provenance of this novel DNA in Prangos is not absolute.

Utility of plastome SSRs and tandem repeat units

In plastomes of D. carota and other Apiaceae species (Peery, 2015; Ruhlman et al., 2006), the number of SSRs reported previously ranged from 44 to 55. In Prangos plastomes, the number of mono‐ and dinucleotide repeats is similar, varying between 48 (P. lipskyi) and 49 (P. fedtschenkoi). SSRs are widely used molecular markers in plant population and phylogenetic studies due to their high mutation rates and high levels of polymorphism among individuals of a population. Another advantage is their ease of use and low‐cost detection using PCR (Hoshino, Bravo, Nobile, & Morelli, 2012; Wang, Barkley, & Jenkins, 2009). To date, the availability of complete plastome sequences in public databases has reduced the economic costs of obtaining these data and increased their use in inter‐ and intraspecific phylogenetic research, population study, and conservation activities (Wang et al., 2009). In addition, taxon‐specific primers, such as those generated herein for the Prangos accD/psaI highly variable IGS region, will be useful to assess genetic differentiation among and within its populations.

Short sequence repeats that arise by chance in DNA sequences along with mutational changes can be presumably expanded by slipped‐strand mispairing events into longer tandem repeats (Levinson & Gutman, 1987). Transposon‐mediated insertions along with replication slippage were suggested as being responsible for generating direct and inverted long repeats (Hoshino et al., 2012; Palmer, 1991). Ten long tandem repeats were identified in Prangos, four of which are located within the same genomic regions and identical in both plastomes. The three others, namely two in ycf2 and one in trnS, were reported previously by Ruhlman et al. (2006) for D. carota. These repeats plus one palindromic tandem repeat in the petN/psbM IGS region occur in the same locations and are shared by most of the Apiaceae and Araliaceae species surveyed.

Inversions

The shared possession of the same inversion is usually viewed as reliable evidence of common ancestry, although the presence of base substitutions within the region may cause misinterpretation (Kim & Lee, 2005). Large plastid inversions, as examples, have been suggested to be highly reliable phylogenetic markers (Graham, Reeves, Burns, & Olmstead, 2000; Jansen & Palmer, 1987; Raubeson & Jansen, 1992a, 1992b). In contrast, the utility of small inversions in phylogenetic inference is poor, because they are reported as often being homoplastic (Graham et al., 2000). In this study, we identified two small inversions in Prangos, both occurring in loop regions of ndhB and petB introns that are homoplastic within Apiaceae.

Comparisons of sequences comprising these 5‐ and 9‐bp inversions in ndhB and petB introns with 23 other species (16 genera) of Apiaceae (representing a diversity of tribes and other major clades within subfamily Apioideae; Downie et al., 2010) and 2 genera of Araliaceae revealed both identical direct and inverted motifs of these two small regions. In many additional taxa, 1–2 bp substitutions within these regions were also apparent. Both flip‐flop oriented forms of these sequences were revealed in the three Prangos species examined herein, whereas congeners of other genera shared identical forms of each sequence. The flip‐flop orientation of loop sequences in the plastid trnL/trnF region was also described for nine Jasminum species (Oleaceae; Kim & Lee, 2005). Two different accessions of J. elegans and single accessions of each of the other eight species were used in phylogenetic analyses. The accessions of J. elegans had different orientations of a loop sequence, with one orientation occurring in five other Jasminum species and the other orientation found in the remaining species. These sequence data may confound phylogenetic relationships unless one is cognizant that an inversion has taken place. Our future studies will survey for the presence of these inverted regions in other Prangos species.

In summary, the complete Prangos plastome sequences reported herein enhance the genomic information available for Prangos and will contribute to further studies of germplasm diversity, phylogeny, and phylogeography of these ecologically and economically important species. These data provide a valuable source of markers for future research at low taxonomic level and population genetics with further implementation in ex situ conservation strategies and restoration/regeneration programs.

CONFLICT OF INTEREST

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

AUTHOR CONTRIBUTION

FUM and KCh conceived and designated the study; DKYi and FUM conducted the molecular and computational analyses; SRD and FUM also performed analyses, interpreted the results, and wrote the manuscript; and ChHSh and KShT provided the necessary facilities, equipment, and chemicals, and helped with the field research.

DATA ACCESSIBILITY

Complete plastid genomes: Genbank accessions KY652265 (P. fedtschenkoi) and KY652266 (P. lipskyi).

Click here for additional data file.

Click here for additional data file.