Literature DB >> 30675325

Distribution of extended-spectrum β-lactamases (ESBLs) among Salmonella serogroups isolated from pediatric patients.

Reza Ranjbar1, Mehrdad Ardashiri1, Sakineh Samadi2, Davoud Afshar3.   

Abstract

BACKGROUND AND OBJECTIVES: Extended-spectrum β-lactamases (ESBLs) and fluoroquinolones are generally used to treat invasive Salmonella infections, but emergence of antibiotic-resistant strains are increasing worldwide. This study was aimed to investigate the distribution of ESBLs among Salmonella serogroups isolated from pediatric patients in Tehran, Iran.
MATERIALS AND METHODS: The study included all Salmonella isolates recovered from pediatric patients admitted to Children's Medical Center, Tehran, Iran during 2015-2016. Bacterial isolation and identification were performed by standard biochemical and agglutination tests. Antimicrobial susceptibility testing was done according to the Clinical and Laboratory Standards Institute (CLSI). Polymerase chain reaction was used to identify the genetic determinants responsible for ESBL phenotypes.
RESULTS: A total of 138 S. enterica serovars were isolated from stool specimens, including serogroup A (1), serogroup B (18), serogroup C (41) and serogroup D (78). Forty isolates out of 138 Salmonella strains had shown ESBL-positive phenotype. All ESBL-positive isolates showed multiple resistant phenotype. Resistance to more than 3 antimicrobial agents was observed among ESBL-positive strains. The frequency of Salmonella strains carrying the bla CTX, bla TEM and bla SHV genes was 17 (12.3%), 40 (29.9%) and 4 (2.89%) respectively.
CONCLUSION: The high rates of ESBLs positive-Salmonella strains recovered from pediatric patients is alarming and indicates a necessity to substitute the cephalosporins with a proper alternative.

Entities:  

Keywords:  Ciprofloxacin resistance; Extended-spectrum beta-lactamases; Salmonella

Year:  2018        PMID: 30675325      PMCID: PMC6340002     

Source DB:  PubMed          Journal:  Iran J Microbiol        ISSN: 2008-3289


INTRODUCTION

Gastroenteritis, also known as infectious diarrhea, accounts for the most important health problems worldwide, particularly in developing countries (1, 2). Salmonella is considered as one of the most common bacterial causes of acute gastroenteritis and food-borne infections worldwide (3). Salmonella gastroenteritis is usually a self-limiting disease. Salmonella species are prevalent throughout the world including Iran (4). Extensive use of antibiotics in humans leads to antibiotic resistance among some bacterial species (5). Application of antibiotics in animal feeds, especially in poultry industry, also led to increased antibiotics resistance (6). Salmonella enterica serovars are associated with poultry settings and therefore, the consumption of their products may increase the risk of antibiotic-resistance distribution to humans (7). The resistant strains are now common worldwide and it is believed that they acquire their resistance in the animal hosts (8). Antibiotic resistance among Salmonella enterica serovars has been increasing (9, 10) and existence of isolates with resistance to several antibiotics is also a concern in treatment of salmonellosis. Resistance to antibiotics due to production of β-lactamase enzymes is common among Salmonella strains and other gram negative bacilli. Recent studies show that Salmonella enterica strains isolated from different countries, carry the extended-spectrum β-lactamases (ESBLs) such as CTX-M, SHV, TEM and ACC-1 enzymes (11, 12). There is limited data about the prevalence of Salmonella producing ESBLs in Iran (13, 14), however, it seems to be more than what is reported in the published literatures. The aim of the present study was to characterize the β-lactamase–producing Salmonella isolates recovered from pediatric patients with diarrhea in Tehran, Iran over a 2-year period.

MATERIALS AND METHODS

Bacterial culture and isolation.

The study included all Salmonella isolates recovered from pediatrics patients admitted to Children’s Medical Center, Tehran, Iran from Jan. 2015 to Dec. 2016. The stool specimens were transferred into Selenite-F Broth and incubated at 37°C for 6 h. These cultures were again sub-cultured on Salmonella-Shigella agar and Bismuth sulphite agar (Merck, Germany) and finally, single colonies were identified using standard biochemical tests (15). Then, Salmonella isolates were serogrouped by commercial typing anti-sera.

Antibiotic susceptibility testing and ESBL screening.

Antibiotic susceptibility was determined according to the Clinical and Laboratory Standard Institute (CLSI) standards using antibiotic discs (MAST UK). The antibiotics selected for the panel were the following: ampicillin (AMP 10 μg), ciprofloxacin (CIP, 5 μg), ceftriaxone (CRO, 30 μg), cefotaxim (CTX, 30 μg) and ceftazidime (CAZ 30 μg). Briefly, bacterial suspensions were provided from overnight cultures, adjusted to the 0.5 McFarland turbidity standard and then, the organisms were evenly spread on the surface of a 10×150 mm Muller Hinton agar (Difco, USA) plate using a cotton swab. After about 15 min, the disks were applied to the plates and incubated at 37°C for 18h. Finally, the diameter of the inhibition zone was measured using a ruler. The double-disk synergy method was used by applying of ceftriaxone (CRO, 30 μg), cefotaxim (CTX, 30 μg) and ceftazidime (CAZ 30 μg) next to (25 mm) a disc of augmentin (amoxicillin 20 μg + clavulanate 10 μg). The zone of inhibition greater than 5 mm of cephalosporin toward the augmentin disc was interpreted as positive for ESBL production.

pCR.

ESBL positive isolates were cultured on LB broth and incubated at 37°C for 24 hr. The cultures were centrifuged at 9000 RPM for 3 min and genomic DNA was extracted using QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. The concentration of extracted DNA was calculated by an ND-1000 spectrophotometer (Nano Drop, Wilmington, DE, USA). For each blaTEM, blaSHV and blaCTX-M gene, polymerase chain reaction was carried out in a final 25 ul reaction mixture containing 12.5 μL of 2×PCR Master Mix, 10 pmol of both forward and reverse primers (Bioneer, Korea) (Table 1) and 50 ng DNA.
Table 1.

Primers used in this study.

Target genePrimer namePrimer sequence (5′→3′)Amplicon size (bp)Reference
bla TEMTEM-FATGAGTATTCAACATTTCCG867(16)
TEM-RCTGACAGTTACCAATGCTTA
bla SHVSHV-FTTAACTCCCTGTTAGCCA796(17)
SHV-RGATTGCTGATTTCGCCC
bla CTX-MCTX-FCGCTTTGCGATGTGCAG550(17)
CTX-RACCGCGATATCGTTGGT
Primers used in this study. The PCR was run at the following temperatures cycles: initial denaturation at 94°C, 5 min; 30 cycles of 94°C for 30 s, [60°C for 45 s (CTX-M), 54°C for 30 s (SHV), 52.2°C for 60 s (TEM)], and 72°C for 1 min; and final extension at 72°C for 10 min using a thermocycler (Eppendorf (W/V) agarose gel, stained with a DNA Safe Stain (CinnaGen, Iran) and finally visualized under a gel documentation system (Bio-Rad, Germany).

RESULTS

A total of 2,200 stool specimens were obtained from patients with diarrhea. One hundred- thirty-eight S. enterica serovars were isolated from stool specimens, that included serogroup A (n=1), serogroup B (n=18), serogroup C (n=41) and serogroup D (n=78). Disk diffusion testing showed Salmonella serogroup A strains were susceptible to ampicillin, ceftriaxone, cefotaxime, ciprofloxacin and ceftazidime while other serogroups had resistance phenotypes (Table 2). As show in Table 2, all strains were susceptible to ciprofloxacin.
Table 2.

Susceptibility of Salmonella serogroups to antibiotics

Antibiotics*Group AGroup BGroup CGroup DTotal
AMP (10 μg)-26311
CTX (30 μg)--426
CRO (30 μg)-6142040
CAZ (30 μg)-6142040
CIP (5 μg)----0
n=1n=18n=41n=78n=138

AMP, ampicillin; CRO, ceftriaxone; CTX, cefotaxime; CAZ, ceftazidime; CIP, ciprofloxacin

Susceptibility of Salmonella serogroups to antibiotics AMP, ampicillin; CRO, ceftriaxone; CTX, cefotaxime; CAZ, ceftazidime; CIP, ciprofloxacin According to results of antibiotic susceptibility testing, four resistance profiles were obtained as follows: 1) AMP resistance, 2) CRO, CAZ resistance, 3) CRO, CAZ, AMP resistance and 4) CTX, CRO, CAZ, AMP, CIP resistance (Table 3).
Table 3.

Antibiotic resistance profiles among Salmonella serogroups.

Profiles numberAntibiotics resistance profileSerogroup (number of isolates)
1AMPB (1), C (1) and D (1)
2CRO, CAZB (5), C (9) and D (17)
3CRO, CAZ, AMPB (1), C (2) and D (1)
4CTX, CRO, CAZ, AMPC (4) and D (2)
Antibiotic resistance profiles among Salmonella serogroups.

ESBLs screening test.

In this study, the blaCTX, blaTEM and blaSHV β-lactamse genes were detected among isolates using the double disc synergy method and also confirmed by PCR (Figs. 1–3). Forty strains (28.98%) of 138 isolates were positive for ESBL genes belonging to ESBL-CTX (n=17, 12.3%), ESBL-TEM (n=40, 29.9%) and ESBL-SHV (n=4, 2.89%) β-lactamase.
Fig. 1.

Electrophoresis of TEM amplicons (867 bp) on agarose gel 1%. Lane M, DNA marker, lane 1–9, PCR products from Salmonella isolates.

Fig. 3.

Electrophoresis of blaSHV gene amplicons (7796 bp) on agarose gel 1%. Lane PC, positive control; lane M, DNA marker; lane 1–4 PCR, product from Salmonella isolate.

Electrophoresis of TEM amplicons (867 bp) on agarose gel 1%. Lane M, DNA marker, lane 1–9, PCR products from Salmonella isolates. Electrophoresis of blaCTX gene amplicons (519 bp) on agarose gel 1%. Lane PC, positive control; lane M, DNA marker; lane 1–4PCR, products from Salmonella isolates. Electrophoresis of blaSHV gene amplicons (7796 bp) on agarose gel 1%. Lane PC, positive control; lane M, DNA marker; lane 1–4 PCR, product from Salmonella isolate.

DISCUSSION

Antibiotic resistance among Salmonella species is a major challenge in public health and is rapidly increasing (18). Recently, multidrug resistant strains of Salmonella have also been reported (19–23). These strains cause high mortality and morbidity and in most cases, leading to bloodstream infections and patient hospitalization (24). Multidrug resistant strains are common among animal populations and spreading worldwide (25). Although this phenotype has been reported in S. enterica serovar. Typhimurium, S. enterica serovar. Paratyphi and S. enterica serovar. Agona (26, 27), it may exist in other serotypes such as S. enterica serovar. Enteritidis (28, 29). Recently, resistance to ampicillin, chloramphenicol, trimethoprim/sulfamethoxazole, quinolones and cephalosporins have also been reported among Salmonella strains (30). Cephalosporins are commonly used to treat Salmonella infections. However, in our study, resistance to cephalosporins was observed in two serogroups, indicating high prevalence of cephalosporins resistance among Iranian isolates. These results are similar to other studies reporting resistance to cephalosporins in S. enterica serovars isolated from other countries. Rotimi et al. found that from a total of 407 isolates, 116 isolates possessed the ESBL resistance phenotypes (12.1% CTX-M-15; 24.6% TEM (31). The high rates of multidrug resistance and ESBL positive Salmonella have also been observed in China. Yu et al. found that most S. enterica serovar. Typhimurium isolates had a resistance phenotype to multiple antimicrobial agents, including tetracycline, trimethoprim/sulfamethoxazole, ampicillin, chloramphenicol and cefotaxime and also a total of 79.0% of S. enterica serovar. Typhimurium isolates harbor blaTEM-1b (32). According to above data and emergence of ESBL producing Salmonellae strains, the effectiveness of cephalosporins may be challengeable against Salmonella infections. In present study, all isolates were found to be susceptible to ciprofloxacin. The result is inconsistent with other reports worldwide (33–35). Cui et al. showed that the high prevalence of resistance to fluoroquinolone among S. Typhimurium isolates may be affected by various factors such as hospitalization (36). Using livestock products is also another way of acquisition of ciprofloxacin-resistant S. Typhimurium for the reason that livestock products are a common source of salmonellosis (37). Susceptibility to ciprofloxacin among other strains such as S. enterica serovar. Typhi has also been identified (38). It seems that ciprofloxacin can be considered as the drug of choice in treating Salmonella infections in Iran (39). In conclusion, our study showed high rates of ESBL positive-Salmonella strains isolated from pediatric patients, suggesting a necessity to substitute the cephalosporins with a proper alternative. Although all of isolates in our study were found to be susceptible to ciprofloxacin, it is better to perform antibiotic susceptibility testing before treatment of Salmonella infections.
  35 in total

Review 1.  Current concepts in the diagnosis and treatment of typhoid fever.

Authors:  Zulfiqar A Bhutta
Journal:  BMJ       Date:  2006-07-08

2.  Antimicrobial-resistant nontyphoidal Salmonella is associated with excess bloodstream infections and hospitalizations.

Authors:  Jay K Varma; Kåre Molbak; Timothy J Barrett; James L Beebe; Timothy F Jones; Therese Rabatsky-Ehr; Kirk E Smith; Duc J Vugia; Hwa-Gan H Chang; Frederick J Angulo
Journal:  J Infect Dis       Date:  2005-01-07       Impact factor: 5.226

3.  Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona.

Authors:  D Boyd; G A Peters; A Cloeckaert; K S Boumedine; E Chaslus-Dancla; H Imberechts; M R Mulvey
Journal:  J Bacteriol       Date:  2001-10       Impact factor: 3.490

4.  beta-Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands.

Authors:  Henrik Hasman; Dik Mevius; Kees Veldman; Inger Olesen; Frank M Aarestrup
Journal:  J Antimicrob Chemother       Date:  2005-06-07       Impact factor: 5.790

5.  Salmonella enterica serotype Typhimurium DT 104 antibiotic resistance genomic island I in serotype paratyphi B.

Authors:  Danièle Meunier; David Boyd; Michael R Mulvey; Sylvie Baucheron; Caterina Mammina; Antonino Nastasi; Elisabeth Chaslus-Dancla; Axel Cloeckaert
Journal:  Emerg Infect Dis       Date:  2002-04       Impact factor: 6.883

6.  Emergence of multidrug-resistant Salmonella enterica serotype Newport infections resistant to expanded-spectrum cephalosporins in the United States.

Authors:  Amita Gupta; John Fontana; Colleen Crowe; Barbara Bolstorff; Alison Stout; Susan Van Duyne; Mike P Hoekstra; Jean M Whichard; Timothy J Barrett; Frederick J Angulo
Journal:  J Infect Dis       Date:  2003-11-18       Impact factor: 5.226

Review 7.  Antimicrobial drug resistance in Salmonella: problems and perspectives in food- and water-borne infections.

Authors:  E John Threlfall
Journal:  FEMS Microbiol Rev       Date:  2002-06       Impact factor: 16.408

8.  Web-based surveillance and global Salmonella distribution, 2000-2002.

Authors:  Eleni Galanis; Danilo M A Lo Fo Wong; Mary E Patrick; Norma Binsztein; Anna Cieslik; Thongchai Chalermchikit; Awa Aidara-Kane; Andrea Ellis; Frederick J Angulo; Henrik C Wegener
Journal:  Emerg Infect Dis       Date:  2006-03       Impact factor: 6.883

9.  Multidrug-resistant strains of Salmonella enterica Typhimurium, United States, 1997-1998.

Authors:  Therese Rabatsky-Ehr; Jean Whichard; Shannon Rossiter; Ben Holland; Karen Stamey; Marcia L Headrick; Timothy J Barrett; Frederick J Angulo
Journal:  Emerg Infect Dis       Date:  2004-05       Impact factor: 6.883

10.  Multidrug-resistant Salmonella Typhimurium infection from milk contaminated after pasteurization.

Authors:  Sonja J Olsen; Michelle Ying; Meghan F Davis; Marshall Deasy; Ben Holland; Larry Iampietro; C Michael Baysinger; Frances Sassano; Lewis D Polk; Betty Gormley; Mary Jane Hung; Keith Pilot; Maria Orsini; Susan Van Duyne; Shelley Rankin; Carol Genese; Eddy A Bresnitz; Joseph Smucker; Maria Moll; Jeremy Sobel
Journal:  Emerg Infect Dis       Date:  2004-05       Impact factor: 6.883

View more
  3 in total

1.  Prevalence of fluoroquinolone-resistant Salmonella serotypes in Iran: a meta-analysis.

Authors:  Farzad Khademi; Hamid Vaez; Fahimeh Ghanbari; Mohsen Arzanlou; Jafar Mohammadshahi; Amirhossein Sahebkar
Journal:  Pathog Glob Health       Date:  2020-02-04       Impact factor: 2.894

Review 2.  Prevalence of Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in Ethiopia: A Systematic Review and Meta-Analysis.

Authors:  Teklehaimanot Kiros; Lema Workineh; Tegenaw Tiruneh; Tahir Eyayu; Shewaneh Damtie; Debaka Belete
Journal:  Int J Microbiol       Date:  2021-03-31

3.  High prevalence of antibiotic resistance in pathogenic foodborne bacteria isolated from bovine milk.

Authors:  Sima Hassani; Mir-Hassan Moosavy; Sahar Nouri Gharajalar; Seyed Amin Khatibi; Abolfazl Hajibemani; Zahra Barabadi
Journal:  Sci Rep       Date:  2022-03-09       Impact factor: 4.996

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.