| Literature DB >> 30670619 |
John C Freedman1, Jihong Li1, Eric Mi1, Bruce A McClane2.
Abstract
Clostridium perfringens type F strains cause a common human foodborne illness and many cases of nonfoodborne human gastrointestinal diseases. Sporulation plays two critical roles during type F enteric disease. First, it produces broadly resistant spores that facilitate type F strain survival in the food and nosocomial environments. Second, production of C. perfringens enterotoxin (CPE), the toxin responsible for causing the enteric symptoms of type F diseases, is restricted to cells in the process of sporulation. While later steps in the regulation of C. perfringens sporulation have been discerned, the process leading to phosphorylation of Spo0A, the master early regulator of sporulation and consequent CPE production, has remained unknown. Using an insertional mutagenesis approach, the current study identified the orphan histidine kinase CPR0195 as an important factor regulating C. perfringens sporulation and CPE production. Specifically, a CPR0195 null mutant of type F strain SM101 made 103-fold fewer spores than its wild-type parent and produced no detectable CPE. In contrast, a null mutant of another putative C. perfringens orphan histidine kinase (CPR1055) did not significantly affect sporulation or CPE production. Studies using a spoIIA operon promoter-driven reporter plasmid indicated that CPR0195 functions early during sporulation, i.e., prior to production of sporulation-associated sigma factors. Furthermore, in vitro studies showed that the CPR0195 kinase domain can autophosphorylate and phosphorylate Spo0A. These results support the idea of CPR0195 as an important kinase that initiates C. perfringens sporulation by directly phosphorylating Spo0A. This kinase could represent a novel therapeutic target to block C. perfringens sporulation and CPE production during type F disease.IMPORTANCE Clostridium perfringens type F enteric diseases, which include a very common form of food poisoning and many cases of antibiotic-associated diarrhea, develop when type F strains sporulate and produce C. perfringens enterotoxin (CPE) in the intestines. Spores are also important for transmission of type F disease. Despite the importance of sporulation for type F disease and the evidence that C. perfringens sporulation begins with phosphorylation of the Spo0A transcriptional regulator, the kinase phosphorylating Spo0A to initiate sporulation and CPE production had not been ascertained. In response, the current report now provides identification of an orphan histidine kinase named CPR0195 that can directly phosphorylate Spo0A. Results using a CPR0195 null mutant indicate that this kinase is very important for initiating C. perfringens sporulation and CPE production. Therefore, the CPR0195 kinase represents a potential target to block type F disease by interfering with intestinal C. perfringens sporulation and CPE production.Entities:
Keywords: Clostridium perfringenszzm321990; enterotoxin; histidine kinase; sporulation
Mesh:
Substances:
Year: 2019 PMID: 30670619 PMCID: PMC6343041 DOI: 10.1128/mBio.02674-18
Source DB: PubMed Journal: mBio Impact factor: 7.867
FIG 1Characterization of the SM101-CPR0195KO null mutant and SM101-CPR0195comp complementing strain. (A) PCR confirming insertional mutagenesis of the cpr0195 gene in SM101-0195KO. Shown is the cpr0195 PCR product amplified using DNA from wild-type SM101 (lane 2), the SM101-CPR0195KO mutant (lane 3), or the SM101-CPR0195comp complementing strain (lane 4). Note that, compared to the ∼300-bp product amplified using DNA containing a wild-type cpr0195 gene, DNA from the null mutant strain supported amplification of a larger (∼1,200-bp) product due to the insertion of an intron into its cpr0195 gene. (B) Southern blot hybridization of an intron-specific probe with DNA from SM101 (left), SM101-CPR0195KO (middle), or SM101-CPR0195comp (right). DNA from each strain was digested overnight with EcoRI at 37°C and then electrophoresed on a 1% agarose gel. The size of the hybridizing band in the middle and right lanes is shown to the left. Using DNA from wild-type SM101, no intron-specific band was detected, while a single intron-specific band was detected for the SM101-CPR0195KO mutant and complementing strain. (C) RT-PCR analysis for cpr0195 (top panel) or polC (middle panel) transcription in wild-type SM101, the SM101-CPR0195KO mutant, or the complementing strain. SM101 DNA was used as a positive control (gDNA [genomic DNA]). PCRs lacking template DNA acted as a negative control. To show that the RNA preparations from the three strains were free from DNA contamination, these samples were also subjected to PCR without reverse transcription (bottom panel). (D) Growth curves for wild-type SM101, the SM101-CPR0195KO mutant, and the SM101-CPR0195comp strain cultured at 37°C in MDS medium for up to 8 h. Aliquots of each culture were measured every 2 h for their OD600. All experiments were repeated three times, and mean representative values are shown. The markers used in panels A and C were Thermo Fisher 1-kb DNA ladders.
FIG 2CPR0195 controls sporulation and CPE production in C. perfringens strain SM101. (A) Wild-type (WT) SM101, SM101-CPR0195KO, and SM101-CPR0195comp were grown overnight at 37°C in MDS, and the cultures were then subjected to heat shock treatment and plated on BHI agar. After overnight incubation in an anaerobic jar, the resultant colonies were counted and the counts were converted to numbers of spores per milliliter. Mean results from three repetitions are shown, and error bars represent the standard errors. The asterisk (*) indicates that the cpr0195 mutant formed significantly (P < 0.05) fewer spores than the wild-type or complementing strains. (B) Photomicroscopy of WT SM101, SM101-CPR0195KO, and SM101-CPR0195comp grown in MDS, confirming the plate count results. (C) Supernatants of WT SM101, SM101-CPR0195KO, and SM101-CPR0195comp grown overnight at 37°C in MDS were assessed by Western blotting for CPE, showing that detectable CPE production is abolished by knockout of the cpr0195 gene. The blot shown is representative of results of three repetitions.
FIG 3Characterization of the SM101-CPR1055KO null mutant and analysis of sporulation and CPE production. (A) PCR confirming insertional mutagenesis of the cpr1055 gene in SM101-CPR1055. Shown is the cpr1055 PCR product amplified using DNA from wild-type SM101 (left lane) or the SM101-CPR1055KO mutant (right lane). Note that DNA from the null mutant strain supported amplification of a larger product due to the insertion of an intron into its cpr1055 gene. (B) Southern blot hybridization with an intron-specific probe with DNA from SM101 or SM101-CPR1055KO. The blot shows results of intron-specific Southern blot hybridization with DNA from wild-type SM101 (left lane) or the cpr1055 null mutant (middle lane). DNA from each strain was digested overnight with EcoRI at 37°C and then electrophoresed on a 1% agarose gel. The size of the hybridizing band in the right lane is shown to the left. Using DNA from wild-type SM101, no intron-specific band was detected. However, a single intron-specific band was detected for the SM101-CPR1055KO mutant. (C) RT-PCR analysis for cpr1055 (top panel) or polC (middle panel) transcription in wild-type SM101 or the SM101-CPR1055KO mutant. SM101 DNA was used as a positive control (gDNA). PCRs lacking template DNA acted as a negative control. To show that the RNA preparations from both strains were free from DNA contamination, the samples were also subjected to PCR without reverse transcription (bottom panel). (D) Growth curves for wild-type SM101 versus the SM101-CPR1055KO mutant cultured at 37°C in MDS medium for up to 8 h. Aliquots of each culture were measured every 2 h for their OD600. (E) Comparison of results of sporulation by WT SM101 versus SM101-CPR1055KO. Both strains were grown overnight at 37°C in MDS and then subjected to heat shock treatment and plated on BHI agar. After overnight incubation in an anaerobic jar, the resultant colonies were counted and the counts were converted to numbers of spores per milliliter. (F) Comparison of levels of CPE production by SM101 versus the SM101-CPR1055KO mutant. Supernatants of WT SM101 or SM101-CPR1055KO were grown overnight at 37°C in MDS and then assessed by Western blotting for CPE. The results showed that CPE production remained strong after inactivation of the cpr1055 gene. All experiments were repeated three times, and mean representative values are shown. The markers used in panels A and C were Thermo Fisher 1-kb DNA ladders.
FIG 4Expression analysis of the cpr0195 and cpr1055 genes for SM101 grown under vegetative and sporulation conditions. SM101 was grown at 37°C in MDS sporulation medium (A) or TGY vegetative growth medium (B) for the indicated times. Cell pellets were collected by centrifugation, RNA was harvested, and expression at each time point under each condition was assessed. Results representative of three repetitions are shown.
FIG 5The cpr0195-encoded protein affects early steps in sporulation. WT SM101, SM101-CPR0195KO, and SM101-CPR1055KO were each transformed with a pJIR750 shuttle plasmid containing the gusA gene under the control of the promoter for the spoIIA operon encoding SigF, which is an early sporulation-associated sigma factor necessary for production of SigE, SigG, and SigK (16). Supernatants from overnight MDS cultures of each strain were harvested, the substrate 4-nitrophenyl-β-d-glucuronide was added for 30 min at 37°C, and absorbance was read at 405 nm, and Miller unit values were calculated and plotted. Shown are the mean results from three repetitions of this experiment. Error bars show standard errors. The asterisks (*) indicate P values of <0.05 relative to SM101(pJIR750-PsigF-gusA).
FIG 6Production of CPR0195 affects Spo0A levels in MDS cultures. Three-hour MDS cultures of the indicated strains were harvested. The OD600 was then determined, and the cultures were adjusted to equal OD600 levels. Cells were then sonicated to release cellular contents, and the resulting sonicate was subjected to SDS-PAGE and Western blotting with antisera specific to Spo0A. Shown is a representative result for three Western blotting repetitions.
FIG 7Phosphotransfer from the recombinant CPR0195 kinase domain rCPR0195kin (r0195kin) to recombinant Spo0A (rSpo0A) in vitro. Purified r0195kin (0.4 µM) was incubated with rSpo0A (4 µM) in phosphotransfer buffer that did or did not contain (as indicated) ATP at room temperature for 1 h. Those samples were then electrophoresed overnight at 4°C on a 15% acrylamide gel containing SDS. (A) The upper photograph shows a gel stained with Phos-Tag phosphoprotein gel stain; the lower photograph shows the same gel stained with eLuminol protein gel stain to show equivalent loading levels of rSpo0A or r0195kin, as appropriate, in different lanes. (B) Quantitative analysis of rSpo0A phosphoprotein levels with or without r0195kin and in the absence or presence of ATP, as indicated. The band intensities of gels were compared by Image J analysis. *, P < 0.05 (in comparison to Spo0A without ATP by ordinary one-way analysis of variance [ANOVA]). #, P < 0.05 (in comparison to r0195kin without ATP; Student's t test). (C) Quantitative analysis of r0195kin phosphoprotein levels in the absence (left) or presence (right) of ATP. The band intensities of gels were compared by ImageJ analysis. *, P < 0.05 (in comparison to r0195kin without ATP; Student's t test). All experiments were repeated three times, and mean values are shown in panels B and C. The error bars indicate standard deviations.
Primers used in this study
| Primer name | Primer sequence | Purpose | PCR |
|---|---|---|---|
| 0195-706/707s-IBS | AAAAAAGCTTATAATTATCCTTAGGATTCGTGAAGGTGCGCCCAGATAGGGTG | pJIR750_0195i construction | 350 |
| 0195-706/707s-EBS1d | CAGATTGTACAAATGTGGTGATAACAGATAAGTCGTGAAGTATAACTTACCTTT | pJIR750_0195i construction | |
| 0195-706/707s-EBS2 | TGAACGCAAGTTTCTAATTTCGATTAATCCTCGATAGAGGAAAGTGTCT | pJIR750_0195i construction | |
| 0195KOF | CATAAAACAATTTCATCAGTAGCAG | Screen for intron insertion in | 350 |
| 0195KOR | AAAACTCCACTTATAGCCAATAAAA | Screen for intron insertion in | |
| 1055-433/434s-IBS | AAAAAAGCTTATAATTATCCTTAAATAACG-ATATAGTGCGCCCAGATAGGGTG | pJIR750_1055i construction | 350 |
| 1055-433/434s-EBS1d | CAGATTGTACAAATGTGGTGATAACAGATAAGTCGATATATTTAACTTACCTTT | pJIR750_1055i construction | |
| 1055-433/434s-EBS2 | TGAACGCAAGTTTCTAATTTCGGTTTTATTCCGATAGAGGAAAGTGTCT | pJIR750_1055i construction | |
| 1055Fscreen | CTTTTAATCATATTGACAGAAAA | Screen for intron insertion in | 319 |
| 1055Rscreen | TTAGGATGGATTCTATCTAATTTTAC | Screen for intron insertion in | |
| 0195compF | CATCATGGATCCGATACATTTAATAATTCTGCAAATTCTTTAGAC | pJIR750_0195comp construction | 3,474 |
| 0195compR | CATCATGGATCCGAGACAAAAGTAAGTTTTGATATACC | pJIR750_0195comp construction | |
| PJIR750Screen | CTGCAGGTCGACTCTAGA | Screen for pJIR750_ 0195comp | |
| 0195RT-F | CAAAGAAATCTTTAGATGATTGCGA | RT-PCR analysis of | 329 |
| 0195RT-R | GATAGAAAACTTGGAGTTCATTTTGTAG | RT-PCR analysis of | |
| 1055RT-F | GCAAAGGTTTAAATGAGAGTTTTAG | RT-PCR analysis of | 282 |
| 1055RT-R | TATAGAATATATTCTCTGCTATTCCAC | RT-PCR analysis of | |
| PolCF | ACTTCCCTGCAAGCCTCTTCTCCT | RT-PCR analysis of | 393 |
| PolCR | TGGTTCAGCTTGTGAAGCAGGGC | RT-PCR analysis of | |
| rSpo0AHisF | CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAAGGAAT | Cloning of | 828 |
| rSpo0AHisR | GTGCTCGAGGCTAACTTTATTCTTTAGTCTTAATTTATC | Cloning of | |
| r0195HisF | CCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAAATTA | Cloning of | 1,543 |
| r0195HisR | GTGCTCGAGATGTACTTCATAAATATCAGAAAGCTC | Cloning of | |