| Literature DB >> 30643861 |
Masoumeh Golestan Jahromi1,2, Reza Aflatoonian3, Parvaneh Afsharian2, Samaneh Aghajanpour3, Maryam Shahhoseini2, Abbas Aflatoonian1.
Abstract
BACKGROUND: Endometriosis is a prevalent gynecological disease, with limited known etiology and more researches are required to identify its etiology. In this manner, there is no evidence for expression and function of 3´HOX genes in 4 clusters in the limb and pelvic organs such as the uterus and its disorders (Genes in the HOXA-D clusters are subdivided into 13 paralogous groups).Entities:
Keywords: Ectopic endometrium; Endometriosis; Eutopic endometrium; HOX genes
Year: 2018 PMID: 30643861 PMCID: PMC6312708
Source DB: PubMed Journal: Int J Reprod Biomed ISSN: 2476-3772
Sequence of the primers used for qPCR experiments
|
|
|
|
|
|---|---|---|---|
|
| F: 5' CAAGATCATTGCTCCTCCTG 3' | 151 | NM_001101.4 |
|
| F: 5' ACCCACCAAGAAGCCT 3' | 113 | NM_153620.2 |
|
| F: 5' AGGAGGACGAGGAAGAGA 3' | 151 | NM_006735.3 |
|
| F: 5' TTCCTGCCCTTTCCTTC 3' | 125 | NM_153631.2 |
|
| F: 5' AGGATGAAGTGGAAGAAAGA 3' | 121 | NM_002141.4 |
|
| F: 5' GAGCCACAAATCAAGCAC 3' | 148 | NM_019102.3 |
|
| F: 5' AAACCCACCCAAGACAG 3' | 150 | NM_002144.3 |
|
| F: 5' GCCACGTCTCCTTCTC 3' | 150 | NM_002145.3 |
|
| F: 5' TTCCCTTCCAACTTTCCCA 3' | 151 | NM_001330323.1 |
|
| F: 5' AGACAGAAAGAGAAATAGGAGG 3' | 120 | NM_024015.4 |
|
| F: 5' TATACCCGCTACCAGACC 3' | 159 | NM_002147.3 |
|
| F: 5' TCCTCTCCCTCCCACT 3' | 159 | NM_014620.5 |
|
| F: 5' TCAAAGAGTCACAAATCACC 3' | 148 | NM_018953.3 |
|
| F: 5' GCTTTCCAGACCGCATC 3' | 114 | NM_024501.2 |
|
| F: 5' AAAGAAACCTGAAGAGCCT 3' | 141 | NM_006898.4 |
|
| F: 5' CGGAGGATGAAGTGGAAA 3' | 138 | NM_014621.2 |
Figure 1Relative gene expression of HOXA cluster genes in ectopic and eutopic tissues of endometriosis patients (n=15) compare to healthy women (n=15). The relative quantity of gene of interest was normalized to the relative quantity of β-actin, as reference gene and was reported as fold change of gene expression. Values expressed as mean ± SEM. Data were analyzed by ANOVA followed by Tukey’s multiple comparison test. (*p<0.05 compared to control group, ** p<0.05 between eutopic and ectopic groups).
Figure 2Relative gene expression of HOXB cluster genes in ectopic and eutopic tissues of endometriosis patients (n=15) compare to healthy women (n=15). The relative quantity of gene of interest was normalized to the relative quantity of β-actin, as reference gene and was reported as fold change of gene expression. Values expressed as mean±SEM. Data were analyzed by ANOVA followed by Tukey’s multiple comparison tests. (*p<0.05 compared to control group, ** p<0.05 between eutopic and ectopic groups).
Figure 3Relative gene expression of HOXC and D cluster genes in ectopic and eutopic tissues of endometriosis patient (n=15) compare to healthy women (n=15). The relative quantity of gene of interest was normalized to the relative quantity of β-actin, as reference gene and was reported as fold change of gene expression. Values expressed as mean±SEM. Data were analyzed by ANOVA followed by Tukey’s multiple comparison tests. (*p<0.05 compared to control group, ** p<0.05 between eutopic and ectopic groups).