| Literature DB >> 30638311 |
Chunyan Feng1, CaiXia Wang1, Yongning Zhang1, Fangyuan Du1, Zhou Zhang1, Fuchuan Xiao2, Jianchang Wang3, Xiangmei Lin1, Shaoqiang Wu1.
Abstract
Porcine circovirus type 3 (PCV3) is a novel pathogen first identified in the United States in 2016. As there is a high possibility that no clinical signs of infection are observed in the host, an accurate and sensitive method is needed for quarantine on numerous live pigs especially for international pig trade. In this study, a TaqMan-based real-time PCR assay specifically for PCV3 was established without cross-reactions with other non-targeted pig viruses. The sensitivity of the current approach is about 1.5 × 101 copies μL-1 plasmid DNA while the sensitivity of the conventional PCR is about 1.5 × 102 copies μL-1 plasmid DNA. Further, this assay was applied in the retrospective quarantine on serum samples of 601 commercial live boars imported to China from the United States, France and the United Kingdom from 2011 to 2017. The results revealed that PCV3 could be detected positive in the commercial boars imported from the United States and the above-mentioned western European countries and phylogenetic study also revealed that viral isolates were grouped with some isolates from Korea and the United States. Our study suggested that PCV3 may be prevalent globally since 2011.Entities:
Keywords: Porcine circovirus type 3; TaqMan real-time PCR assay; capsid gene; replicase gene; retrospective quarantine
Mesh:
Year: 2019 PMID: 30638311 PMCID: PMC6498530 DOI: 10.1002/vms3.141
Source DB: PubMed Journal: Vet Med Sci ISSN: 2053-1095
Nucleotide sequences of primers and probe used in the TaqMan real‐time PCR assay and in conventional PCR in this study
| Name | Sequence 5′– 3′ | Nucleotideposition | Purpose |
|---|---|---|---|
| Probe | FAM‐ AGTAATGTTGTACCGGAGGAGTGG‐BHQ1 | 960–983 | TaqMan real time PCR |
| Forward primer | TGTGGCTAAGGTATTATATATTAC | 935–958 | |
| Reverse primer | TCTCCATGTCTTTCTTTACC | 1064–1083 | |
| PCV3U1 | ACTTGTAACGAATCCAAACTTC | 1347–1368 | Conventional PCR |
| PCV3L1 | TGGCACGCCAACCACTTCATTA | 1782–1803 |
Detection results of PCV3 in the serum samples of boars imported from France, the United Kingdom and the United states between 2011 and 2017
| Year | Country | Sample numbers | Positive ratio (%) | Positive numbers |
|---|---|---|---|---|
| 2011 | UK | 26 | 7.69 | 2 |
| 2011 | France | 89 | 7.87 | 7 |
| 2011 | United states | 37 | 10.8 | 4 |
| 2012 | France | 50 | 4.00 | 2 |
| 2014 | UK | 100 | 6.00 | 6 |
| 2017 | United states | 299 | 11.04 | 33 |
Figure 1The sensitivity detection and Standard curves of the Taqman PCR assay. (a) Representative amplification chart of sensitivity of the Taqman PCR assay. The sensitivity of the TaqMan real‐time PCR assay was 1.5 × 101 copies μL−1 of plasmid DNA. (b) Standard curve of the real‐time PCR based on serial dilutions of the plasmid DNA. Mean threshold cycle C t values from three replicates (y‐axis) versus logarithmic concentrations of plasmid copies (x‐axis) are plotted.
Figure 2The phylogenetic analysis of partial cap gene of PCV3 sequenced in this study. The isolates with black bold indicated the partial cap genes sequenced in this study. Scale bars indicated nucleotide substitutions per site.