| Literature DB >> 30637389 |
Chikwe Ihekweazu1, C-Thomas Bock2,3, Olusola Anuoluwapo Akanbi2,4, Dominik Harms2, Bo Wang2, Oluyinka Oladele Opaleye4, Olufisayo Adesina2, Folakemi Abiodun Osundare2,4, Abiodun Ogunniyi1, Dhamari Naidoo5, Isabelle Devaux6, Alemu Wondimagegnehu6, Clement Peter6, Okudo Ifeanyi6, Opeayo Ogundiran6, Uzoma Ugochukwu6, Nwando Mba1, Sunday A Omilabu7.
Abstract
Hepatitis E virus genotype 1 (HEV-1) is associated with large epidemics. Notably, HEV subtype 1e (HEV-1e) has caused HEV outbreaks in sub-Saharan Africa. We report here the second full-length genome sequence of an HEV-1e strain (NG/17-0503) from a recent outbreak in Nigeria in 2017. It shares 94.2% identity with an HEV-1e strain from Chad.Entities:
Year: 2019 PMID: 30637389 PMCID: PMC6318360 DOI: 10.1128/MRA.01378-18
Source DB: PubMed Journal: Microbiol Resour Announc ISSN: 2576-098X
Primers used for NG/17-0503 complete genome sequencing
| Primer | Sequence (5′ to 3′) | Location |
|---|---|---|
| HEV-289_f | CTTGGGCCTTGAGTGTGCTA | 4443–4462 |
| HEV-290_f | CCCTATCCAGCGCGTTATACAT | 222–243 |
| HEV-291_r | ACCGACAGTAACCTTGTAGCTG | 1089–1068 |
| HEV-292_r | CATGAGACGGTCCCAGATATGG | 999–978 |
| HEV-293_f | CCTGTGTCGGGTGGAATGAA | 5091–5110 |
| HEV-294_r | GGACTGGTCATACTCGGCAG | 6595–6576 |
| HEV-295_f | ACGAAGGGTCCGATGTTGAC | 1532–1551 |
| HEV-296_r | AATGGCTGGGATCTGGTTCG | 3210–3191 |
| HEV-297_r | GACTCTAGCAGCAGTGTGGG | 3087–3068 |
| HEV-298_f | GATCCCAGCCATTGACTTCGAA | 3198–3219 |
| HEV-299_r | TAGCACACTCAAGGCCCAAG | 4462–4443 |
| HEV-300_r | TGTCGTCAAAAGCATCCCCA | 4351–4332 |
| HEV-302_f | TGCCACTGTAGAACCATGATCC | 1396–1417 |
| HEV-303_r | GGTAGATAAAGCTCATCCCCGG | 2771–2750 |
| HEV-304_r | GCGTCAAAACTAGGACCGATTG | 2729–2708 |
| HEV-311_f | GTGCTATTATGGAGGAGTGCGG | 4457–4478 |
| HEV-312_r | AGCACTATCGAATCATCACCTT | 4694–4673 |
| HEV-321_r | ACAGAGCATAACAAGGCCAGAA | 5983–5962 |
| HEV-322_f | ATGCTGTTGGTGGCTATGCTAT | 5745–5766 |
| HEV-323_r | CCTGGATAACTACACGGGATTCC | 6470–6448 |
| HEV-324_f | CATATCCGGGTCCTATGTGGTAC | 1575–1597 |
| HEV-325_r | GCATCAACYTCCGACCAAGT | 2156–2137 |
| HEV-326_f | GCATGTYTGGGAGTCGGC | 2082–2099 |
Forward primer designations end with _f; reverse primer designations end with _r.
Numbering is according the HEV prototype strain Burma (GenBank accession no. M73218).
Fig 1Phylogenetic tree based on complete genome sequences of representative proposed HEV reference strains. Each branch is labeled with the subtype designation, the strain name, and the GenBank accession number. The Nigerian NG/17-0503 strain in this study is marked with a solid circle. A maximum likelihood method based on the general time-reversible model with gamma distributed with invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1,000 replications).