Literature DB >> 30637389

Complete Genome Sequence of a Hepatitis E Virus Genotype 1e Strain from an Outbreak in Nigeria, 2017.

Chikwe Ihekweazu1, C-Thomas Bock2,3, Olusola Anuoluwapo Akanbi2,4, Dominik Harms2, Bo Wang2, Oluyinka Oladele Opaleye4, Olufisayo Adesina2, Folakemi Abiodun Osundare2,4, Abiodun Ogunniyi1, Dhamari Naidoo5, Isabelle Devaux6, Alemu Wondimagegnehu6, Clement Peter6, Okudo Ifeanyi6, Opeayo Ogundiran6, Uzoma Ugochukwu6, Nwando Mba1, Sunday A Omilabu7.   

Abstract

Hepatitis E virus genotype 1 (HEV-1) is associated with large epidemics. Notably, HEV subtype 1e (HEV-1e) has caused HEV outbreaks in sub-Saharan Africa. We report here the second full-length genome sequence of an HEV-1e strain (NG/17-0503) from a recent outbreak in Nigeria in 2017. It shares 94.2% identity with an HEV-1e strain from Chad.

Entities:  

Year:  2019        PMID: 30637389      PMCID: PMC6318360          DOI: 10.1128/MRA.01378-18

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Hepatitis E virus (HEV) is the most common causative agent of acute viral hepatitis. Eight HEV genotypes (HEV-1 to HEV-8) have been described, of which five are well recognized as human pathogens (1). HEV-1 and HEV-2 are waterborne, transmitted through fecal-oral routes, and are responsible for large HEV outbreaks in resource-limited countries. HEV-3 and HEV-4 are linked to zoonotic transmission and cause sporadic infections in industrialized countries. It has been reported that HEV subtype 1e (HEV-1e) was responsible for a large outbreak in sub-Saharan Africa (Chad). The T3 strain (GenBank accession no. AY204877) was obtained from an infected person from France during an outbreak in Chad in 1983 and represents the only complete genome sequence of HEV-1e available (2). We report the second full-length genome sequence of an HEV-1e strain (NG/17-0503) from a recent outbreak in Nigeria in 2017. The virus was isolated from a 35-year-old resident of the Mobbar local government area of Borno State, Nigeria. The patient’s serum tested positive for HEV antibodies using Wantai HEV IgM rapid test and Wantai HEV IgM enzyme-linked immunosorbent assay (ELISA; Sanbio, The Netherlands). Viral RNA was extracted from serum using the QIAamp viral RNA minikit with the QIAcube BioRobot workstation (Qiagen, Hilden, Germany), followed by cDNA synthesis using SuperScript first-strand synthesis (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Real-time reverse transcription-PCR (RT-PCR) targeting the HEV open reading frames (ORF) 2 and 3 showed viremic HEV infection, with a viral load of 2.22 × 10E+6 IU/ml. Sequence analysis of partial ORF1 (307 bp) and ORF2 (401 bp) implemented using the BLASTn search engine (https://blast.ncbi.nlm.nih.gov) indicated that NG/17-0503 had highest nucleotide identity with the T3 strain. Real-time RT-PCR and consensus nested RT-PCR were conducted as previously described (3). The complete viral genome was amplified in fragments using the Kapa HiFi HotStart ReadyMix PCR kit (Roche, Mannheim, Germany) with HEV-1 universal and NG/17-0503 genome-specific primers (Table 1). The 5ʹ and 3ʹ ends were amplified using 5ʹ and 3ʹ rapid amplification of cDNA ends (Roche). All HEV amplicons were sequenced using Sanger sequencing with a BigDye Terminator 3.1 kit (Thermo Fisher, USA) in sense and antisense directions. The whole-genome sequence was assembled and analyzed using Geneious software 10.0.5 (Biomatters Ltd., Auckland, New Zealand) (4). Phylogenetic analyses were performed with the MEGA 7.0.26 software (5).
TABLE 1

Primers used for NG/17-0503 complete genome sequencing

Primera Sequence (5′ to 3′)Locationb
HEV-289_fCTTGGGCCTTGAGTGTGCTA4443–4462
HEV-290_fCCCTATCCAGCGCGTTATACAT222–243
HEV-291_rACCGACAGTAACCTTGTAGCTG1089–1068
HEV-292_rCATGAGACGGTCCCAGATATGG999–978
HEV-293_fCCTGTGTCGGGTGGAATGAA5091–5110
HEV-294_rGGACTGGTCATACTCGGCAG6595–6576
HEV-295_fACGAAGGGTCCGATGTTGAC1532–1551
HEV-296_rAATGGCTGGGATCTGGTTCG3210–3191
HEV-297_rGACTCTAGCAGCAGTGTGGG3087–3068
HEV-298_fGATCCCAGCCATTGACTTCGAA3198–3219
HEV-299_rTAGCACACTCAAGGCCCAAG4462–4443
HEV-300_rTGTCGTCAAAAGCATCCCCA4351–4332
HEV-302_fTGCCACTGTAGAACCATGATCC1396–1417
HEV-303_rGGTAGATAAAGCTCATCCCCGG2771–2750
HEV-304_rGCGTCAAAACTAGGACCGATTG2729–2708
HEV-311_fGTGCTATTATGGAGGAGTGCGG4457–4478
HEV-312_rAGCACTATCGAATCATCACCTT4694–4673
HEV-321_rACAGAGCATAACAAGGCCAGAA5983–5962
HEV-322_fATGCTGTTGGTGGCTATGCTAT5745–5766
HEV-323_rCCTGGATAACTACACGGGATTCC6470–6448
HEV-324_fCATATCCGGGTCCTATGTGGTAC1575–1597
HEV-325_rGCATCAACYTCCGACCAAGT2156–2137
HEV-326_fGCATGTYTGGGAGTCGGC2082–2099

Forward primer designations end with _f; reverse primer designations end with _r.

Numbering is according the HEV prototype strain Burma (GenBank accession no. M73218).

Primers used for NG/17-0503 complete genome sequencing Forward primer designations end with _f; reverse primer designations end with _r. Numbering is according the HEV prototype strain Burma (GenBank accession no. M73218). The complete genome of NG/17-0503 is 7,284 nucleotides in length, excluding the poly(A) tail, with a G+C content of 57.6%. The genome contains three ORFs (ORF1, 1,693 amino acids; ORF2, 660 amino acids; ORF3, 123 amino acids) encoding the HEV viral proteins. NG/17-0503 shared the highest identity of 94.2% with the T3 strain from Chad, followed by 88.7% with an HEV-1d Moroccan strain (GenBank accession no. MH918640). Sequences were aligned using the MAFFT algorithm (6). Phylogenetically, NG/17-0503 and T3 formed a separate subcluster within HEV-1 (Fig. 1).
Fig 1

Phylogenetic tree based on complete genome sequences of representative proposed HEV reference strains. Each branch is labeled with the subtype designation, the strain name, and the GenBank accession number. The Nigerian NG/17-0503 strain in this study is marked with a solid circle. A maximum likelihood method based on the general time-reversible model with gamma distributed with invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1,000 replications).

Phylogenetic tree based on complete genome sequences of representative proposed HEV reference strains. Each branch is labeled with the subtype designation, the strain name, and the GenBank accession number. The Nigerian NG/17-0503 strain in this study is marked with a solid circle. A maximum likelihood method based on the general time-reversible model with gamma distributed with invariant sites was inferred. The values at nodes indicate the bootstrap values (using 1,000 replications). In conclusion, we identified and characterized the full-length genome of an HEV-1e strain circulating during an outbreak in Nigeria in 2017. Sequence and phylogenetic analyses showed that NG/17-0503 is the second full-length HEV-1e genome available to date. Since the Chad HEV-1e strain from 1983 was from a neighboring country of Nigeria, the detection of NG/17-0503 is strongly suggestive of local transmission of this endemic virus over decades.

Data availability.

The complete genome sequence of NG/17-0503 has been deposited in the GenBank database under the accession no. MH918640.
  6 in total

1.  MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform.

Authors:  Kazutaka Katoh; Kazuharu Misawa; Kei-ichi Kuma; Takashi Miyata
Journal:  Nucleic Acids Res       Date:  2002-07-15       Impact factor: 16.971

2.  MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets.

Authors:  Sudhir Kumar; Glen Stecher; Koichiro Tamura
Journal:  Mol Biol Evol       Date:  2016-03-22       Impact factor: 16.240

3.  Comprehensive Molecular Approach for Characterization of Hepatitis E Virus Genotype 3 Variants.

Authors:  Bo Wang; Dominik Harms; C Patrick Papp; Sandra Niendorf; Sonja Jacobsen; Marc Lütgehetmann; Sven Pischke; Heiner Wedermeyer; Jörg Hofmann; C-Thomas Bock
Journal:  J Clin Microbiol       Date:  2018-04-25       Impact factor: 5.948

4.  Phylogenetic analysis of the first complete hepatitis E virus (HEV) genome from Africa.

Authors:  Hélène van Cuyck; François Juge; Pierre Roques
Journal:  FEMS Immunol Med Microbiol       Date:  2003-11-28

Review 5.  Zoonotic Hepatitis E Virus: An Ignored Risk for Public Health.

Authors:  Yuchen Nan; Chunyan Wu; Qin Zhao; En-Min Zhou
Journal:  Front Microbiol       Date:  2017-12-04       Impact factor: 5.640

6.  Identification of a Novel Hepatitis E Virus Genotype 3 Strain Isolated from a Chronic Hepatitis E Virus Infection in a Kidney Transplant Recipient in Switzerland.

Authors:  Bo Wang; Dominik Harms; Jörg Hofmann; Diana Ciardo; Agnes Kneubühl; C-Thomas Bock
Journal:  Genome Announc       Date:  2017-05-18
  6 in total
  5 in total

1.  Hepatitis E virus infection in high-risk populations in Osun State, Nigeria.

Authors:  Folakemi Abiodun Osundare; Patrycja Klink; Olusola Aanuoluwapo Akanbi; Bo Wang; Dominik Harms; Olusola Ojurongbe; Moses Adedapo Ajayi; Emmanuel Oluwagbenga Babaranti; C-Thomas Bock; Oladele Oluyinka Opaleye
Journal:  One Health       Date:  2021-04-28

Review 2.  Mode and tempo of human hepatitis virus evolution.

Authors:  Rachele Cagliani; Diego Forni; Manuela Sironi
Journal:  Comput Struct Biotechnol J       Date:  2019-10-25       Impact factor: 7.271

Review 3.  Advances in Hepatitis E Virus Biology and Pathogenesis.

Authors:  Shaoli Lin; Yan-Jin Zhang
Journal:  Viruses       Date:  2021-02-09       Impact factor: 5.048

4.  Seroprevalence and burden of hepatitis E viral infection among pregnant women in central Nigeria attending antenatal clinic at a Federal Medical Centre in Central Nigeria.

Authors:  Philomena Ehi Airiohuodion; Anh Wartel; Andrew B Yako; Peter Asaga Mac
Journal:  Front Med (Lausanne)       Date:  2022-09-02

5.  Hepatitis E virus outbreak associated with rainfall in the Central African Republic in 2008-2009.

Authors:  Vianney Tricou; Julie Bouscaillou; Gina-Laure Laghoe-Nguembe; Aubin Béré; Xavier Konamna; Benjamin Sélékon; Emmanuel Nakouné; Mirdad Kazanji; Narcisse P Komas
Journal:  BMC Infect Dis       Date:  2020-04-03       Impact factor: 3.090

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.