| Literature DB >> 30619710 |
Kendall R Blanchard1, Aravindan Kalyanasundaram1, Cassandra Henry1, Matthew Z Brym1, James G Surles2, Ronald J Kendall1.
Abstract
The northern bobwhite quail (Colinus virginianus) is a popular gamebird in the Rolling Plains Ecoregion of West Texas. However, there has been a population decline in this area over recent decades. Consistent reports indicate a high prevalence of the eyeworm (Oxyspirura petrowi) and caecal worm (Aulonocephalus pennula), which may be of major influence on the bobwhite population. While research has suggested pathological consequences and genetic relatedness to other pathologically significant parasites, little is known about the influence of climate on these parasites. In this study, we examined whether seasonal temperature and precipitation influences the intensity of these parasites in bobwhite. We also analyzed quantitative PCR results for bobwhite feces and cloacal swabs against temperature and precipitation to identify climatic impacts on parasite reproduction in this region. Multiple linear regression analyses were used for parasite intensity investigation while binary logistic regression analyses were used for parasite reproduction studies. Our analyses suggest that caecal worm intensity, caecal worm reproduction, and eyeworm reproduction are influenced by temperature and precipitation. Temperature data was collected 15, 30, and 60 days prior to the date of collection of individual bobwhite and compared to qPCR results to generate a temperature range that may influence future eyeworm reproduction. This is the first preliminary study investigating climatic influences with predictive statistics on eyeworm and caecal worm infection of northern bobwhite in the Rolling Plains.Entities:
Keywords: Bobwhite; Caecal; Climate; Eyeworm; qPCR
Year: 2018 PMID: 30619710 PMCID: PMC6312831 DOI: 10.1016/j.ijppaw.2018.12.006
Source DB: PubMed Journal: Int J Parasitol Parasites Wildl ISSN: 2213-2244 Impact factor: 2.674
Primer and probe sequences used in qPCR methods.
| Primer/Probe | Sequence | Target | Product Size |
|---|---|---|---|
| Oxy2448F | GTTTCCTCATGTGATTTCATTTTGT | Eyeworm ITS2 ( | 149bp |
| Oxy2597R | ATAAACGTTATTGTTGCCATATGCT | ||
| Oxy_Probe_1 | |||
| Apen F1 | GGGTTGTGGTACTAGGTGGGT | Caecal Worm COX1 ( | 120bp |
| Apen R1 | GCACCCAAAATAGAACTCACCCC | ||
| Apen_Probe_1 | |||
| ND2_70F | CAACCACTGAATCATAGCCTGAAC | Northern Bobwhite NADH2 ( | 79bp |
| ND2_149R | GGTGGTGGGATTTTGAAATGAG | ||
| Quail_ND2_Probe1 |
Data on all sample sizes used in statistical analyses of average worm counts and qPCR positives.
| Season and Year | Climatic Variables | Total Positive qPCR Results | Average Worm Counts | |||
|---|---|---|---|---|---|---|
| Temperature (°C) | Precipitation (cm) | Eyeworm | Caecal worm | Eyeworm | Caecal worm | |
| Spring | 20.00 | 7.53 | 0 (N = 0) | 0 (N = 0) | 23.5 (N = 14) | 139.0 (N = 14) |
| Summer | 26.94 | 1.49 | 1 (N = 11) | 2 (N = 11) | 33.0 (N = 16) | 149.3 (N = 16) |
| Fall | 22.08 | 4.36 | 2 (N = 19) | 1 (N = 19) | 16.0 (N = 21) | 91.5 (N = 21) |
| Spring | 19.31 | 7.01 | 1 (N = 2) | 1 (N = 2) | 26.0 (N = 18) | 181.0 (N = 18) |
| Summer | 26.66 | 3.49 | 6 (N = 7) | 6 (N = 7) | 22.0 (N = 39) | 101.0 (N = 39) |
| Fall | 22.36 | 10.22 | 14 (N = 22) | 20 (N = 22) | 23.5 (N = 27) | 74.5 (N = 51) |
| Spring | 17.59 | 6.68 | 0 (N = 20) | 3 (N = 20) | 13.0 (N = 27) | 162.3 (N = 27) |
| Summer | 27.22 | 4.90 | 1 (N = 4) | 0 (N = 4) | 18.5 (N = 10) | 238.5 (N = 10) |
| Fall | 22.50 | 6.70 | 0 (N = 8) | 1 (N = 8) | 19.5 (N = 16) | 180.0 (N = 16) |
| Spring | 18.70 | 1.85 | 0 (N = 21) | 8 (N = 21) | 18.0 (N = 26) | 277.6 (N = 26) |
| Summer | 26.48 | 9.76 | 1 (N = 10) | 3 (N = 10) | 10.6 (N = 14) | 153.3 (N = 14) |
| Fall | 20.83 | 3.49 | 0 (N = 17) | 4 (N = 17) | 16.0 (N = 16) | 154.5 (N = 16) |
Fig. 1Contour and scatterplot of relationships between temperature and precipitation on parasite worm burdens and egg shedding. a) Predicted caecal worm intensity against temperature and precipitation contour plot. b) Scatterplot of predicted caecal worm reproduction against precipitation. d) Predicted eyeworm reproduction against temperature and precipitation contour plot.
Fig. 2Scatterplot of predicted eyeworm reproduction with temperature 60 days prior to collection date with upper and lower 95% confidence intervals.