Stefanie Beck-Wödl1, Klaus Harzer2, Marc Sturm1, Rebecca Buchert1, Olaf Rieß1, Hans-Dieter Mennel3, Elisabeth Latta4, Axel Pagenstecher3, Ursula Keber5. 1. Department of Medical Genetics and Applied Genomics, University of Tübingen, Tübingen, Germany. 2. Department of Neuropediatrics and Neurometabolic Laboratory, Children's Hospital of the University of Tübingen, Tübingen, Germany. 3. Department of Neuropathology, Philipps University and University Hospital of Marburg, Baldingerstrasse, 35043, Marburg, Germany. 4. Department of Pediatrics, University Hospital of Marburg, Marburg, Germany. 5. Department of Neuropathology, Philipps University and University Hospital of Marburg, Baldingerstrasse, 35043, Marburg, Germany. keber@med.uni-marburg.de.
Abstract
Homozygous mutation of TBC1 domain-containing kinase (TBCK) is the cause of a very recently defined severe childhood disorder, which is characterized by severe hypotonia, global developmental delay, intellectual disability, epilepsy, characteristic facies and premature death. The link between TBCK loss of function and symptoms in patients with TBCK deficiency disorder (TBCK-DD) remains elusive. Here we demonstrate for the first time the histopathological characteristics of TBCK deficiency consisting of 1) a widespread and massive accumulation of lipofuscin storage material in neurons of the central nervous system without notable neuronal degeneration, 2) storage deposits in few astrocytes, 3) carbohydrate-rich deposits in brain, spleen and liver and 4) vacuolated lymphocytes. Biochemical examinations ruled out more than 20 known lysosomal storage diseases. These investigations strikingly uncover TBCK-DD as a novel type of lysosomal storage disease which is characterized by different storage products rather than one specific type of accumulated material. Due to the clear predominance of intraneuronal lipofuscin storage material and the characteristic clinical presentation we propose to classify this disease as a new subtype of neuronal ceroid lipofuscinosis (CLN15). Our results and previous reports suggest an autophagosomal-lysosomal dysfunction caused by enhanced mTORC1-mediated autophagosome formation and reduced Rab-mediated autophagosome-lysosome fusion, thus disclosing potential novel targets for therapeutic approaches in TBCK-DD.
Homozygous mutation of TBC1 domain-containing kinase (TBCK) is the cause of a very recently defined severe childhood disorder, which is characterized by severe hypotonia, global developmental delay, intellectual disability, epilepsy, characteristic facies and premature death. The link between TBCK loss of function and symptoms in patients with TBCK deficiency disorder (TBCK-DD) remains elusive. Here we demonstrate for the first time the histopathological characteristics of TBCK deficiency consisting of 1) a widespread and massive accumulation of lipofuscin storage material in neurons of the central nervous system without notable neuronal degeneration, 2) storage deposits in few astrocytes, 3) carbohydrate-rich deposits in brain, spleen and liver and 4) vacuolated lymphocytes. Biochemical examinations ruled out more than 20 known lysosomal storage diseases. These investigations strikingly uncover TBCK-DD as a novel type of lysosomal storage disease which is characterized by different storage products rather than one specific type of accumulated material. Due to the clear predominance of intraneuronal lipofuscin storage material and the characteristic clinical presentation we propose to classify this disease as a new subtype of neuronal ceroid lipofuscinosis (CLN15). Our results and previous reports suggest an autophagosomal-lysosomal dysfunction caused by enhanced mTORC1-mediated autophagosome formation and reduced Rab-mediated autophagosome-lysosome fusion, thus disclosing potential novel targets for therapeutic approaches in TBCK-DD.
Entities:
Keywords:
Autophagy; Central nervous system (CNS); Infantile muscular hypotonia with psychomotor retardation and characteristic facies 3 (IHPRF3); Mammalian target of rapamycin (mTOR); Rab; Vacuolated lymphocytes
Homozygous mutation of TBC1 domain-containing kinase (TBCK) leads to a very recently defined severe disorder in childhood, which is characterized by infantile muscular hypotonia, psychomotor retardation and characteristic facies (IHPRF3; OMIM: 616900). To date, more than 30 patients with various homozygous TBCK mutations have been reported [1, 4, 9, 17, 20, 31, 35, 51]. The disease is often accompanied by global developmental delay, distinctive facial features like deeply set eyes and tented upper lip vermilion, medication refractory epilepsy and chronic respiratory failure [51]. Typical brain imaging signs are brain atrophy and progressive leukoencephalopathy with a thinned corpus callosum. The disease has a generally short survival and only exceptional clinical courses up to two decades have been described [17, 35].In all reported cases, the different TBCK mutations resulted in aberrant TBCK protein. The knowledge about the function of TBCK is still limited. The protein contains a Tre-2/Bub2/Cdc16 (TBC) domain, a rhodanase-like domain and a kinase domain, which has been proposed to be inactive due to a lack of essential catalytic subdomains [7, 29, 42]. The TBCK protein is expressed in most organs (https://www.proteinatlas.org/). It has been shown to suppress cell proliferation [29, 50] and to play a role in cell growth and actin organization by enhancing the signalling pathways of mammalian target of rapamycin (mTOR), presumably at a transcriptional or post-transcriptional level [29]. Interestingly, an autophagosomal-lysosomal dysfunction has been described recently in patients with TBCK deficiency [35] that is attributed to the disturbed activation of the mTOR complex 1 (mTORC1), which regulates autophagy [6]. In addition, it has been suggested that TBCK encodes a Rab GTPase-activating protein [9].Despite these data, the actual mechanisms linking TBCK gene mutation to the clinical phenotype remain elusive, thus impeding the establishment of potential therapeutic strategies. This study provides the first autopsy reports of two siblings, who suffered from homozygous TBCK mutation. Macroscopic, histological and ultrastructural investigations give insights into the cellular changes in the disorder and provide compelling evidence for classification of TBCK deficiency disorder (TBCK-DD) as a novel type of lysosomal storage disease (LSD).
Materials and methods
General study design
Two siblings born in 1972 and 1974 suffered from the same severe and at that time unknown disease. Clinical examinations of both patients rendered no definite diagnosis. Autopsies were done immediately after death of patient 1 in 1978 and of patient 2 in 1985. Investigations included macroscopic, histological and biochemical analysis, but no definite diagnosis could be made. With the recent advent of modern genetic techniques it became possible to pinpoint the cause of the disorder. Subsequently, intense re-evaluation of tissue samples including completive immunohistochemical and ultrastructural studies was performed. Written informed consent to participate in the study and for publication of the clinical photographs (Fig. 2) was obtained from the parents of the siblings.
Fig. 2
External appearance of the two patients. Severe hypotonia, a short neck and mild facial dysmorphia with open mouth, tented upper lip vermilion, macroglossia, furrowed tongues and right esotropia are seen
Molecular gene analysis
Genomic DNA was isolated from spleen tissue of patient 2 using the QIAamp Mini Kit (Qiagen NV, Hilden, Germany) following the manufacturer’s instructions. Mutations in the TBCK gene were uncovered by whole exome sequencing. Target regions were enriched using the SureSelectXT Human All Exon Kit V5 (Agilent, Böblingen, Germany) according to the manufacturer’s protocol. Sequencing was performed on a HiSeq2500 instrument (Illumina, San Diego, CA; USA). On average 100 million paired-end reads with a length of 125 bp were produced per exome. The conversion of the sequence data in the FASTA format was done by Illumina bcl2fastq. Adapter sequences were removed with SeqPurge (https://github.com/imgag/ngs-bits) and the trimmed reads were mapped to the human reference genome hg19 (GRCh37) using Burrows Wheeler Aligner (http://bio-bwa.sourceforge.net). PCR-duplicates were removed with samblaster (https://github.com/GregoryFaust/samblaster). Deletions and insertions were realigned with ABRA (https://github.com/mozack/abra). Variants were detected using freebayes (https://github.com/ekg/freebayes) and transcript/protein information was annotated with SnpEff / SnpSift (http://snpeff.sourceforge.net).Filtering of variants for pathogenicity was performed with an in-house tool (MS, unpublished). Calls with an allele frequency ≥ 1% in the 1000 Genomes, ExAC or Kaviar databases were excluded. In addition, frequently observed variants in our in-house database (≥ 20x) were removed. All exonic non-synonymous variants including splice sites which potentially change the protein were taken into account (other intronic and UTR mutations were eliminated). Finally the remaining SNVs and INDELs of the index patient were checked for the three modes of inheritance: Autosomal dominant (de novo?), autosomal recessive, X-linked recessive or dominant and the coverage (minimum 20x).Sanger sequencing of the TBCK gene was performed on genomic DNA from spleen and paraffin-embedded brain tissue of patient 2. Genomic DNA was also isolated from peripheral blood leukocytes of both parents by standard methods in order to confirm the pathogenic variants and exclude de novo mutations. The following primer sequences were used: TBCK-Ex3F: AGCCCTTTCGTGGAAGAACC, TBCK-Ex3R: GCCCTGATCCCAGTTGCT, chr4: 107183639–107183188. TBCK reference sequence was NM_001163435.2, ENST00000394708.6 and all genomic positions are denoted according to GRCh37/hg19.
Biochemical analysis
Enzymatic, cytochemical and thin-layer chromatographic lipid analyses screening more than 20 LSDs were performed on white blood cells, cultured fibroblasts and frozen tissue samples of brain, spinal cord and liver obtained from autopsy of both patients. Additionally, urine of patient 2 was tested for oligosaccharide concentration and spleen tissue of patient 2 was examined regarding its content of carbohydrate positive (CHp) material. For this, buffer extract from 200 mg spleen tissue was delipidated by phase partitioning with chloroform/methanol 2:1 by volumes. The aqueous upper phase was dialyzed against water, concentrated and applied to a BioGel P-4 column [25]. The buffer-eluted fractions were monitored for CHp material by spotting aliquots to a thin-layer plate and reacting the spots with anisaldehyde/sulfuric acid reagent (characteristic colour for carbohydrates, glucose as a reference). CHp material was detected only in some fractions eluted with the void volume. These fractions were also positive with a mucopolysaccharide reagent [13]. Positive fractions were pooled and centrifuged. The resulting sediment and supernatant were again tested for CHp material as follows: The test spots were applied to a start line 1 cm above the lower edge of a thin-layer plate. Water-soluble, low-molecular-weight contaminations were removed from the start line by running the plate upwards with a polar solvent system for 2 h. Finally, the run plate was sprayed with anisaldehyde reagent to visualize CHp material. The entire procedure was also applied to spleen tissue from two control individuals.
Histological and immunohistochemical analysis
Autopsies were done immediately after death of patient 1 in 1978 and of patient 2 in 1985. Visceral and central nervous tissue was formalin fixed and paraffin embedded according to standard protocols. Multiple stained sections of all relevant brain regions and of the spinal cord were available from patient 1 and re-evaluated for this study. From patient 2, both the stained sections and archived paraffin blocks of the central nervous system and peripheral organs were re-evaluated and used for new histological and immunohistochemical stains, respectively. Hematoxylin and eosin, Klüver Barrera (luxol fast blue and cresyl violet), Sudan black and red, periodic acid-Schiff (PAS), Alcian blue, Shimizu and Heidenhain-Woelcke stains as well as Gallyas silver impregnation were performed according to standard procedures. Investigation of sections was performed with normal or differential interference contrast microscopy and autofluorescence was evaluated with light excitation using ultraviolet (excitation wavelength 340–380 nm), blue (460–500 nm) and green (515–560 nm) light.For immunohistochemistry, heat-induced epitope retrieval was performed either with citrate or EDTA according to the manufacturer’s protocol of the respective primary antibody. Sections were incubated for one hour with the following primary antibodies: rabbit anti-GFAP (1:1000; Dako Z0334), mouse anti-ß-Amyloid (1:100; Dako M0872), rabbit anti-p62 (1:100; Enzo BML-PW9860), mouse anti-CD3 (1:50; Novocastra Laboratories NCL-CD3-PS1), mouse anti CD20 (1:400; Dako M0755), mouse anti-CD68 (1:100; Dako M0876) and mouse anti-CD138 (1:200; Dako M7228). Sections were washed and incubated with post-block solution and HRP-polymer reagent according to the manufacturer’s protocol of ZytoChem-Plus HRP Polymer-Kit (Zytomed Systems).
Ultrastructural analysis
For ultrastructural analysis, cylinders of 3 mm in diameter were punched out of paraffin embedded tissue of the neocortex, medulla oblongata and spinal cord anterior horn, respectively. We chose areas in which neuronal storage inclusions were histologically observed. The tissue was rehydrated and fixed in glutaraldehyde. Tissue preparation was performed as described previously [26]. In brief, the tissue cylinders were fixed in buffered glutaraldehyde, postfixed in osmiumtetroxide and embedded in Epon resin. Thin sections were contrasted with uranylacetate and lead citrate and analyzed using a Zeiss EM 902.
Results
Clinical report
The two sisters were born to healthy Caucasian German parents with distant consanguinity (Fig. 1). The third pregnancy was interrupted without a prenatal diagnosis. The clinical symptoms, age of onset and age of death of both patients are summarized in Table 1.
Fig. 1
Family tree of the patients. The siblings (VI.5 and VI.6, black circles) were born to Caucasian, distantly consanguineous parents, who did not suffer from the disease. ◊, pregnancy with induced abortion. ?, twins with unknown zygosity
Table 1
Clinic of siblings
Patient 1
Patient 2
Age of onset
4 months
10 months
Age of death
7 years
11 years
Cause of death
Respiratory failure
+
+
Main symptons
Severe Hypotonia
+
+
Global developmental delay
+
+
Intellectual disability
+
+
Generalized onset seizures
+
+
Reduced visual acuity
–
+
Blindness
+
–
Appearance
Undersize
+
+
Underweight
–
+
Short neck
+
+
Facial dysmorphia
+
+
Open mouth
+
+
Tented upper lip
+
+
Macroglossia
+
+
Furrowed tongue
+
+
Unilateral esotropia
+
+
Family tree of the patients. The siblings (VI.5 and VI.6, black circles) were born to Caucasian, distantly consanguineous parents, who did not suffer from the disease. ◊, pregnancy with induced abortion. ?, twins with unknown zygosityClinic of siblingsIn detail, patient 1 started to suffer from hypotonia and loss of tendon reflexes at the age of about 4 months. The progressive hypotonia prevented any statomotor development except for lifting the head in prone position, an ability that was lost later on. At the age of 7, the body size was reduced (1.2 m, according to the 30. percentile of age-related WHO reference values), the body weight was regular (31.5 kg). X-ray examination revealed no signs of dysostosis. She had a short neck and mild facial dysmorphia with an open mouth, tented upper lip vermilion, macroglossia, furrowed tongue and right esotropia (Fig. 2). She was intellectually disabled, never able to speak and blind, but able to hear. At the age of 5 years, epilepsy with generalized onset motor seizures became manifest. Accordingly, electroencephalographic (EEG) waves of severely changed general activity and some hypersynchronous activity were observed. The patient died at the age of 7 years and 3 months from a bronchopneumonia with respiratory failure.External appearance of the two patients. Severe hypotonia, a short neck and mild facial dysmorphia with open mouth, tented upper lip vermilion, macroglossia, furrowed tongues and right esotropia are seenPatient 2, the younger sister, developed similar clinical features of a profound global developmental delay with a slightly later onset and longer survival. Her statomotor maximum was the all-fours position, when the symptoms with hypotonia started at the age of 10 months. The subsequent disease progress was faster compared to her sister and generalized onset motor seizures appeared soon. She was intellectually disabled, never able to speak and suffered from severely reduced visual acuity. Hearing was intact and she developed hyperacusis. The external appearance was comparable to her sister (Fig. 2, middle and right panel). Size and weight was normal at birth but severely reduced by the age of 11 years (size 1.24 m, according to < 1. percentile and weight 33 kg, according to the 22. percentile of age-related WHO reference values, respectively). Electroneurographic and myographic measurements at the age of 9 years revealed reduced distal nerve conduction velocities and a complete absence of spontaneous and arbitrary muscular activity. Computer tomography showed a general cortical, frontally accentuated atrophy with slightly distended, deformed ventricles and a massive atrophy of the lower cerebellar vermis. The patient died at the age of 11 years from bronchopneumonia with respiratory failure.
Genetic investigations
Whole exome sequencing of the DNA of patient 2 yielded 77 million mapped reads with a mean coverage of more than 94%. The analysis revealed a homozygous nonsense mutation in exon 3 of TBCK: NM_001163435.2:c.304C > T, p.Gln102* (Fig. 3a). This leads to a premature stop codon and affects the protein kinase domain. The mutation was confirmed by Sanger sequencing and accordingly heterogeneously present in both parents of the patients (Fig. 3b). Other gene mutations, especially of known metabolic diseases, were not detected.
Fig. 3
The TBCK defect in the genome of patient 2 and her parents. a, Integrative Genomics Viewer presentation of the homozygous stop mutation in the TBCK gene of patient 2. Below the green square, green dots show the base exchange (c.304C > T) in the multiple reads. b, Sanger sequencing of the TBCK gene of patient 2 and her parents. Sequencing was performed on the reverse strand, showing the base exchange G > A in our patient (grey boxes). Both parents carry the same mutation heterozygously, as seen in the R (grey boxes) that resembles an A and a G in each allele
The TBCK defect in the genome of patient 2 and her parents. a, Integrative Genomics Viewer presentation of the homozygous stop mutation in the TBCK gene of patient 2. Below the green square, green dots show the base exchange (c.304C > T) in the multiple reads. b, Sanger sequencing of the TBCK gene of patient 2 and her parents. Sequencing was performed on the reverse strand, showing the base exchange G > A in our patient (grey boxes). Both parents carry the same mutation heterozygously, as seen in the R (grey boxes) that resembles an A and a G in each allele
Biochemical investigations
Biochemical analyses were performed on white blood cells, cultured fibroblasts and frozen tissue samples of patient 2 and ruled out the following metabolic diseases: metachromatic leukodystrophy, multiple sulfatase deficiency, Krabbe disease, GM1 gangliosidosis I and II, GM2 gangliosidosis, galactosialidosis, sialidosis, Salla disease, Fabry disease, Schindler disease, Farber disease, Niemann-Pick disease, Gaucher disease, mucopolysaccharidoses (7 types), Wolman disease, cholesterylester storage disease and neuronal ceroid-lipofuscinosis (NCL). Thin-layer chromatographic lipid analyses of brain, spinal cord and liver tissues showed normal patterns of gangliosides including GM1, GM2 and GM3, and of glucosylceramide, galactosylceramide, sulfatides, and sphingomyelins. Urinary oligo- and mucopolysaccharides were unremarkable.Investigation of carbohydrate-positive material in spleen tissue of patient 2, on the thin-layer plate, detected carbohydrate-positive material at the start line suggestive of an accumulation of a carbohydrate-containing substance of high molecular weight. In contrast, the spleen tissue of two control individuals showed only small traces and thus distinctly less amounts of carbohydrate-positive material compared to the patient.
Visceropathological investigations
General autopsy of both patients revealed respiratory failure as cause of death, which was evident with multiple atelectases, recurrent small embolisms, pulmonary edema and single foci of pneumonia in patient 1 and with a fulminant bronchopneumonia in patient 2. Strikingly, in the obtained mesenterial lymph nodes few leucocytes contained large uniform bold vacuoles, which were pale in hematoxylin eosin staining, strongly PAS-positive and did not stain for chloracetate esterase (Fig. 4). They emitted a strong yellowish, green and red autofluorescence in light excitation with respective wave lengths. Immunohistochemical analysis characterized the vacuolated cells mainly as B-lymphocytes and as occasional plasma cells with an incomplete differentiation (Fig. 4e-f), whereas T-cells and macrophages were not affected. The vacuolated lymphocytes suggested an enhanced autophagosomal load, as indicated by p62 immunohistochemistry (Fig. 4d).
Fig. 4
Vacuolated lymphocytes in lymph nodes of patient 1. A few lymphocytes with clear bold cytoplasmic vacuoles can be detected in the hematoxylin eosin staining in normal microscopy (a and b, first panel) and differential interference contrast (DIC) microscopy allowing for a three-dimensional illustration (a and b, second panel). The vacuoles exhibit a clear autofluorescence in different channels (a and b, right panel) and are strongly PAS-positive (c, DIC). An enhanced autophagosome formation is indicated by strong p62 immunoreactivity (d, black arrow), whereas normal lymphocytes are predominantly negative (white arrow). Note the positively stained larger macrophage (arrowheads) phagocytosing an erythrocyte (asterisk). Most of the vacuolated cells are CD20+ B-lymphocytes (e, DIC), and single cells show a partial CD138 expression, likely pointing at immature plasma cells (f, DIC). Scale bar: 10 μm
Vacuolated lymphocytes in lymph nodes of patient 1. A few lymphocytes with clear bold cytoplasmic vacuoles can be detected in the hematoxylin eosin staining in normal microscopy (a and b, first panel) and differential interference contrast (DIC) microscopy allowing for a three-dimensional illustration (a and b, second panel). The vacuoles exhibit a clear autofluorescence in different channels (a and b, right panel) and are strongly PAS-positive (c, DIC). An enhanced autophagosome formation is indicated by strong p62 immunoreactivity (d, black arrow), whereas normal lymphocytes are predominantly negative (white arrow). Note the positively stained larger macrophage (arrowheads) phagocytosing an erythrocyte (asterisk). Most of the vacuolated cells are CD20+ B-lymphocytes (e, DIC), and single cells show a partial CD138 expression, likely pointing at immature plasma cells (f, DIC). Scale bar: 10 μmIn both patients, the spleen showed subacute congestion. Here, single extracellular clusters of autofluorescent polymorphic structures suggestive of degraded material were seen (data not shown). The liver showed fatty degeneration, presenting as diffuse small lipid droplets in patient 1 and as centrolubular hypoxic fatty changes in patient 2. Neither in the spleen nor in the liver storage cells could be detected, but patient 2 exhibited PAS-positive material subendothelial to small arterioles in both organs. No lipopigments were seen in all investigated peripheral organs, including heart, lung, liver, spleen, kidneys, endocrine organs, gastrointestinal and urogenital tracts as well as skeletal musculature.As individual pathologic changes, patient 1 showed a jejunal invagination with beginning impaired circulation and a reactive hyperplasia of single mediastinal, mesenterial and inguinal lymph nodes. Patient 2 had kidneys reduced in weight to 50% of the age related norm and a thoracolumbal scoliosis.
Neuropathological investigations
On autopsy, both brains showed a moderate global atrophy including a hydrocephalus internus and narrowed cortical gyri with dilated sulci in patient 1 and narrowing of white matter tracts in patient 2 (Fig. 5). Brain weights were appropriate to the age related norm (1490 g and 1350 g formalin fixed, respectively). The corpus callosum was thinned. Basal ganglia, thalami, hippocampi, brain stem and cerebellum appeared macroscopically unremarkable. The dorsal nerve roots of the spinal cord were partly thickened in patient 2. There was acute congestion with dilated capillaries. Singular microbleeds were found in the white matter of cerebrum, cerebellum and pons. In patient 1, individual hippocampal neurons of Sommer sector CA1 and of the nucleus dentatus were shrunken and hyperchromatic, indicating previous hypoxia. Patient 2 showed mild edematous changes in the cerebrum, a severe reduction of Purkinje cells with strong activation of Bergmann glia and a discrete fibrosis of leptomeninges. The white matter showed normal myelination.
Fig. 5
Whole mount coronar brain sections of patient 1 (a, Heidenhain-Woelcke stain) and patient 2 (b, luxol fast blue stain). The lateral ventricle is widened especially in patient 1 (a, asterisk). The brain of patient 2 shows narrowing of the white matter (b, blue staining of myelin). The corpus callosum is thinned in both patients (a and b, arrows). Scale bar: 2 cm
Whole mount coronar brain sections of patient 1 (a, Heidenhain-Woelcke stain) and patient 2 (b, luxol fast blue stain). The lateral ventricle is widened especially in patient 1 (a, asterisk). The brain of patient 2 shows narrowing of the white matter (b, blue staining of myelin). The corpus callosum is thinned in both patients (a and b, arrows). Scale bar: 2 cmBoth patients showed a significant muscular atrophy, especially of the lower legs. Muscle specimens revealed a neurogenic atrophy with angular fibers and partial fiber groupings (data not shown).Histological examination of the central nervous system (CNS) revealed one major pathological finding in both patients: cytoplasmic accumulation of granular storage material within neurons and to a lesser extent within glial cells. Interestingly, the number of neurons was normal to slightly reduced. The intracellular inclusions were distributed bihemispherically in many neurons of nearly all investigated brain regions. A detailed list is provided in Table 2. Most severely affected were the cerebral cortex laminae V and VI, claustrum, corpus geniculatum laterale, olivary nuclei, nuclei nervi vagi and the anterior horn of the spinal cord. The mesencephalon and the lateral and posterior horns of spinal cord were mainly preserved, the Purkinje cells peculiarly spared. The occurrence of neurons with abnormal storage material was more pronounced in patient 1 as compared to patient 2, who showed significantly less affected neurons in the cortical laminae I-IV, striatum and hippocampus.
Table 2
Distribution of neuronal storage material and PAS-positive granules in the central nervous system. Screening for neuronal inclusions was performed on sections stained with cresyl violet luxol fast blue (LFB) and sudan black (SB) or under ultraviolet light excitation for emission of autofluorescence (AF)
Region
Neuronal storage material
PAS + granules
LFB/SB
AF
Cerebrum
Basal ganglia
Neocortex I – IV
–
++
++
Neocortex V - VI
+++
+++
++
Nucleus caudatus
(+)
+
–
Putamen
–
++
(+)
Claustrum
+++
+++
–
Thalamus
++
+++
–
Hippocampus
CA 1
++
+++
+
CA 2–4
+
++
+
Corpus geniculatum laterale
+++
+++
n. a.
Cerebellum
Cortex
Purkinje cells
–
–
–
Granule cells
–
–
–
Subcortical white matter
–
–
+++
Nucleus dentatus
(+)
++
+++
Brain stem
Mesencephalon
Substantia nigra
–
(+)
++
Nucleus oculomotorius
–
(+)
n. a.
Pons
Pontine nuclei
(+)
+
+++
Raphe nuclei
(+)
+
+++
Medulla oblongata
Olivary nuclei
+++
+++
(+)
Nucleus nervus vagus
+++
+++
–
Nucleus nervus hypoglossus
–
++
–
Note the distinctly higher sensitivity of detection with autofluorescence. n. a., no available PAS-stained section or paraffin-embedded tissue
Distribution of neuronal storage material and PAS-positive granules in the central nervous system. Screening for neuronal inclusions was performed on sections stained with cresyl violet luxol fast blue (LFB) and sudan black (SB) or under ultraviolet light excitation for emission of autofluorescence (AF)Note the distinctly higher sensitivity of detection with autofluorescence. n. a., no available PAS-stained section or paraffin-embedded tissueThe neuronal inclusions were densely packed in the perikaryon and lay frequently adjacent to neuronal processes (Fig. 6). They had a round shape with an average diameter of 1 μm, varying from 0.3 to 2 μm. They stained strongly with luxol fast blue and sudan black and were argyrophilic. In unstained sections, they exhibited a bright silvery autofluorescence in ultraviolet light excitation and a weaker green and red autofluorescence in light excitation using respective lasers (Figs. 6 and 8 patient 1; Additional file 1: Supplement A patient 2). The detection of autofluorescent inclusions was most sensitive compared to other stains (Table 2). The PAS-reaction of the granules was heterogeneous and mainly weak (Fig. 6e), the alcian blue staining was entirely negative. A small proportion of the storage material was weakly immunoreactive for ß-amyloid, whereas a negative immunoreactivity was observed for ubiquitin, TDP-43 and the marker for autophagosomes p62 (Fig. 6h). In ultrastructural analysis, the inclusions presented as globular structures with a partially undulating border and a surrounding empty halo (Fig. 7). They consisted of amorphous osmiophilic, compact or granular material including high-density particles, lipid droplets (Fig. 7d-e) and sometimes membrane packages (Fig. 7d lower arrow), thus being highly suggestive of lipofuscin granules in lysosomal residual bodies. They furthermore showed a strong similarity to granular osmiophilic deposits (GRODs). Some neurons in addition contained vacuoles with membraneous structures resembling membranous cytoplasmic bodies (MCB) and zebra bodies (Additional file 1: Supplement B).
Fig. 6
Neuronal inclusions in the spinal cord anterior horn of patient 2. Many neurons present with granular deposits in the perikaryon, which stain strongly with sudan black (a and b) and sudan red (c). Note the frequent localization adjacent to neuronal processes. The inclusions stain with luxol fast blue (d, arrows) and show a weak PAS-reaction (e). The storage material is moderately argyrophilic (f, Gallyas stain) and shows strong autofluorescence (g, unstained section). The storage material does not stain for p62 (h, arrows). Note the reactive GFAP+ gliosis (i, arrowheads). GFAP, glial fibrillary acidic protein. Scale bar: 250 μm in a, 50 μm in b-i
Fig. 8
Morphological changes in the cortex of patient 2. Many cortical neurons in lamina V and VI incorporate storage material, which stains strongly with luxol fast blue in the Klüver Barrera staining (a, arrows) and with sudan black (b, arrows). A massive reactive astrocytosis is seen in GFAP immunohistochemistry (c). The intraneuronal inclusions (arrows) and glial inclusions (arrowheads) exert a strong autofluorescence (d, unstained section). Several cortical glia cells show cytoplasmatic PAS-positive granula (e, arrows). Note the numerous PAS-positive corpora amylacea (e, arrowheads). The laden glia cells are mainly astrocytes, as shown in double staining for PAS and GFAP (f, upper panel, arrows) and very few microglia cells, as shown in double staining for PAS and CD68 (f, lower panel, arrow). GFAP, glial fibrillary acidic protein. Scale bar: 50 μm in a-e, 20 μm in f
Fig. 7
Ultrastructural morphology of neuronal storage material. Semi-thin section stained with toluidin blue of a neuron in the spinal cord anterior horn of patient 2 shows strongly stained storage material (a). Ultrastructural examination of the same neuron in a serial section (b-e) reveals a cluster of intracytoplasmic globular inclusions (delineated in b) consisting of amorphous osmiophilic material with high-density particles, lipid droplets (e; white arrowheads) and structures reminding of degraded membranous material (d and e; arrows). These inclusions correspond to lipofuscin granules in lysosomal residual bodies and remind of granular osmiophilic deposits (GRODs). Note the different polygonal shape of physiological Nissl substance (b; white arrowheads). Scale bar: 50 μm in a, 10 μm in b, 2 μm in c, 250 nm in d and e
Neuronal inclusions in the spinal cord anterior horn of patient 2. Many neurons present with granular deposits in the perikaryon, which stain strongly with sudan black (a and b) and sudan red (c). Note the frequent localization adjacent to neuronal processes. The inclusions stain with luxol fast blue (d, arrows) and show a weak PAS-reaction (e). The storage material is moderately argyrophilic (f, Gallyas stain) and shows strong autofluorescence (g, unstained section). The storage material does not stain for p62 (h, arrows). Note the reactive GFAP+ gliosis (i, arrowheads). GFAP, glial fibrillary acidic protein. Scale bar: 250 μm in a, 50 μm in b-iUltrastructural morphology of neuronal storage material. Semi-thin section stained with toluidin blue of a neuron in the spinal cord anterior horn of patient 2 shows strongly stained storage material (a). Ultrastructural examination of the same neuron in a serial section (b-e) reveals a cluster of intracytoplasmic globular inclusions (delineated in b) consisting of amorphous osmiophilic material with high-density particles, lipid droplets (e; white arrowheads) and structures reminding of degraded membranous material (d and e; arrows). These inclusions correspond to lipofuscin granules in lysosomal residual bodies and remind of granular osmiophilic deposits (GRODs). Note the different polygonal shape of physiological Nissl substance (b; white arrowheads). Scale bar: 50 μm in a, 10 μm in b, 2 μm in c, 250 nm in d and eIntracellular storage material was not only present in neurons of both patients, but also in some glial cells. These inclusions varied in their features from those of neuronal storage material, as they showed a strong PAS reaction, no staining with luxol fast blue or sudan black/red and a silvery autofluorescence in ultraviolet light excitation of unstained sections (Fig. 8d-e). Double staining with PAS + GFAP and PAS + CD68 revealed a localization of the material in the cytoplasm mostly of astrocytes and to a lesser extent of microglia (Fig. 8f).Morphological changes in the cortex of patient 2. Many cortical neurons in lamina V and VI incorporate storage material, which stains strongly with luxol fast blue in the Klüver Barrera staining (a, arrows) and with sudan black (b, arrows). A massive reactive astrocytosis is seen in GFAP immunohistochemistry (c). The intraneuronal inclusions (arrows) and glial inclusions (arrowheads) exert a strong autofluorescence (d, unstained section). Several cortical glia cells show cytoplasmatic PAS-positive granula (e, arrows). Note the numerous PAS-positive corpora amylacea (e, arrowheads). The laden glia cells are mainly astrocytes, as shown in double staining for PAS and GFAP (f, upper panel, arrows) and very few microglia cells, as shown in double staining for PAS and CD68 (f, lower panel, arrow). GFAP, glial fibrillary acidic protein. Scale bar: 50 μm in a-e, 20 μm in fFinally, diffusely dispersed small granules of PAS- and Shimizu-positive material were observed in the neuropil of some areas in patient 1 and less frequent in patient 2. Affected regions were only partially concordant with the described areas showing neuronal inclusions, as the cerebellum and pons harbored the highest content of grains (Tab. 2, Fig. 9). The material lay diffusely in the grey and white matter of the mentioned regions with a notable dense perivascular accumulation (Fig. 9b). The remaining CNS showed isolated subendothelial aggregations. The deposits varied in size between 0.2 μm and 2 μm in diameter, the larger ones emitted autofluorescence. The granules were mainly globular, but large grains were often polygonal, allowing for discrimination against round corpora amylacea with a larger diameter. Considering the age of the patients, an excessive number of corpora amylacea was found in the brain and spinal cord of both patients, predominantly located in subpial, subependymal and perivascular areas.
Fig. 9
Diffuse PAS-positive material in the cerebellum of patient 1. The PAS-positive deposits are abundantly present in the subcortical cerebellar white matter (a, Δ; b and c) with sparing of molecular layer (#), Purkinje cell layer (*) and granular cell layer (+++). The deposits often accumulate perivascular (b, arrows) and are sometimes seen in glia cells (c, arrow). The nucleus dentatus is also affected (d). Note the shrunken and hyperchromatic neurons (arrows) as a sign of previous hypoxia. Scale bar: 65 μm in a, 50 μm in b-d
Diffuse PAS-positive material in the cerebellum of patient 1. The PAS-positive deposits are abundantly present in the subcortical cerebellar white matter (a, Δ; b and c) with sparing of molecular layer (#), Purkinje cell layer (*) and granular cell layer (+++). The deposits often accumulate perivascular (b, arrows) and are sometimes seen in glia cells (c, arrow). The nucleus dentatus is also affected (d). Note the shrunken and hyperchromatic neurons (arrows) as a sign of previous hypoxia. Scale bar: 65 μm in a, 50 μm in b-dAn extensive reactive gliosis was present especially in the regions containing storage materials (Figs. 6i, 8c). Immunohistochemistry for CD68 revealed a moderate activation of microglia, other inflammatory changes were not seen.
Discussion
This study provides a description of the morphological and biochemical pathology in the CNS and peripheral organs of patients with inherited TBCK-DD. The presence of 1) predominant lipofuscin-like storage material in CNS neurons, 2) storage deposits in astrocytes and to a lesser extent in microglia, 3) grainy PAS-positive deposits mostly in the pontine and cerebellar neuropil, spleen and liver, and 4) vacuolated lymphocytes support the classification of TBCK-DD as an LSD and give important evidence for the understanding of its pathogenesis.
Morphological classification of TCBK-DD
Neuronal inclusions correspond to lipofuscin granules
The foremost observation were the frequent intraneuronal granular deposits spread throughout almost the whole central nervous system. Neuronal storage material is characteristic for LSDs, which comprise more than 50 diseases with a wide variation of storage products depending on defects in lysosomal enzymes, lysosomal membrane-associated proteins or non-lysosomal associated enzymes [33]. Here, positive staining for Sudan black and luxol fast blue, a moderate PAS reaction together with the absence of eosinophilia demonstrated that the inclusions consist predominantly of lipopigments with minor or no protein content [49]. In addition, the inclusion material showed strong autofluorescence, a characteristic feature of lipofuscin, the storage material in neuronal ceroid lipofuscinosis (NCL) and mucopolysaccharidosis type III (MPS III, Sanfilippo syndrome), respectively [12, 46, 52].In concordance with the light microscopical characteristics, ultrastructurally the majority of storage material corresponded to lipofuscin granules in lysosomal residual bodies and in particular resembled granular osmiophilic deposits (GRODs) as seen in NCL types 1, 4, 5, 8–10, 12 and 14 [34]. Moreover, few zebra body- and MCB-like structures similar to inclusions in gangliosidoses and MPS were observed [16, 21]. In contrast to MPS, the neuronal deposits did not stain with Alcian blue and they showed strong autofluorescence distinguishing the disorder from gangliosidoses and all but one MPS (MPS III). Since the electron microscopical investigation was performed on material that was recovered from formalin fixed and paraffin embedded tissue, ultrastructural morphology was suboptimally preserved and therefore we cannot fully exclude the possibility that TBCK-DD pathology consists of further alterations.The autofluorescent glial inclusions differed from the neuronal deposits in that they were PAS-positive and negative in luxol fast blue and Sudan black stains, suggesting that they contain a larger fraction of carbohydrates in addition to autofluorescent lipofuscin. The inclusions were mostly present in astrocytes, but also seen in few microglia.
Diffuse accumulation of PAS-positive material in the CNS and in peripheral organs
Moreover, PAS-positive granular deposits were observed diffusely in the neuropil. Interestingly, the spleen and liver contained PAS-positive granules in subendothelial areas, too. These deposits biochemically corresponded to increased concentration of carbohydrate-positive material in the spleen of patient 2 and indicate an insufficient degradation of saccharides or glycosylated substrates. Similarly, a recent study described enhanced oligosaccharide levels in fibroblasts and urine of patients with TBCK-DD [35]. The absence of urinary oligosaccharides in our patient 2 might be due to the lower sensitivity of the test used in 1987 as compared to the mass spectrometric analysis recently performed by Ortiz-Gonzalez et al. [35]. The distribution pattern of PAS-positive material was different in the two patients, indicating that these deposits might be a variable pathologic feature of TBCK-DD in different organs. The more severe brain affection of patient 1 correlated with the worse clinical course compared to that of her sister. All in all, storage of PAS-positive material was much less pronounced as in mucopoly−/oligosaccharidosis, gangliosidoses or polyglucosan body disease.
Vacuolated lymphocytes
Here, we discovered the presence of vacuolated B-cells and immature plasma cells in TBCK-DD. Vacuolated lymphocytes are a feature of several metabolic diseases including CLN3 [2, 3, 10, 27, 45] and CLN11 [8], Pompe’s disease/adult acid maltase deficiency [2, 19, 36], GM1 gangliosidosis [2, 14, 15] and others as summarized by Anderson et al. [2].The autofluorescence together with the strong PAS-reaction of the vacuoles in lymphocytes of our patients suggest an accumulation of both lipopigment and carbohydrates. PAS-positive vacuoles in lymphocytes have been reported in patients with Pompe’s disease/adult acid maltase deficiency [2, 19] and Danon disease (LAMP2-deficient cardiomyopathy) [32]. At present it is unknown whether vacuolated lymphocytes are regularly present in the peripheral blood of patients with homozygous TBCK mutation. Should this be the case, peripheral blood film examination might represent a useful and simple diagnostic tool to support the diagnosis of TBCK-DD.The vacuolated lymphocytes showed excessive p62-positive autophagosomes which have been previously described in TBCK-DDpatients’ fibroblasts [35]. This contrasted to neurons that showed no accumulation of p62 immunoreactive organelles. This variance may be explained either by cell type-specific effects of TBCK or by alternative pathways regulating autophagy in postmitotic neuronal cells as compared to dividing cells such as fibroblasts [11, 28].
Synopsis of morphological changes
In summary, our findings revealed characteristic morphological changes in both patients with TBCK-DD that are typical for an LSD. Subclassification into a specific group, however, is not straightforward since we observed aggregates with different morphological properties pointing at different storage materials. While the majority of neuronal inclusions in the CNS indicate an NCL, the PAS-positive vacuoles in lymphocytes are reminiscent of those seen in Pompe’s disease and the PAS-positive aggregates in the CNS, spleen and liver as well as the occasional intraneuronal zebra bodies and MCB-like structures demonstrate carbohydrate-containing material as is stored in polyglycosan body diseases, mucopoly−/oligosaccharidosis or gangliosidosis. Together, TBCK-DD represents a new type of storage disorder, characterized by the occurrence of different storage products with predominance of lipofuscin. Future studies will show whether a classification as a novel subtype of NCL (CLN15) is appropriate.
Metabolic consequences of TBCK defects
A recent study demonstrated an autophagosomal-lysosomal dysfunction in TBCK-DD with accumulation of autophagosomes and impaired degradation of glycosylated proteins in cultured fibroblasts [35]. Mechanistically, TBCK can be linked to autophagy as a regulator of two distinct pathways including mTOR and small GTPases of the Rab-family. Knockdown of TBCK in vitro significantly downregulated the main inhibitor for autophagy initiation, mTORC1 [4, 6, 29], thus explaining an enhanced production of autophagosomes in case of defective TBCK. Importantly, disturbed mTORC1 signaling and lysosomal dysfunction have been observed in a mouse model of CLN11/progranulin deficiency, underpinning the concept of TBCK-DD being an NCL [40, 43, 48]. Furthermore, TBCK has been proposed a putative activator protein for small GTPases of the Rab-family [9], which regulate fusion of autophagosomes with lysosomes [18, 22, 24, 47]. In line with this interpretation, Rab-associated dysfunctional endocytic membrane trafficking was described in CLN3mammalian cells [30]. It is therefore likely that a TBCK defect leads to both, enhanced autophagosome formation and decreased fusion with lysosomes which in turn cause a disturbed clearance of cell components e.g. glycosylated substrates and an accumulation of non-degradable products such as lipofuscin.In addition to the effects on autophagy, mTOR has been reported to mediate key endogenous neuroprotective mechanisms in motoneurons [41] and to contribute to peripheral axonal myelination and growth [44], thus possibly explaining the severe affection of the second motoneuron due to both CNS (storage inclusions) and peripheral (myelination and axonal growth) pathologies in TBCK-DD.To date, few neurodevelopmental disorders have been linked to an aberrantly reduced mTOR signaling as seen in the herein described TBCK-DD, including Rett syndrome [38, 39], Phelan-McDermid syndrome with autism spectrum disorder [5] and Galloway-Mowat syndrome [23]. These diseases share the symptoms of cognitive deficits and epilepsy, but are not associated with an accumulation of storage products. Thus, the appearance of TBCK-DD as an LSD is likely to result from multifactorial TBCK-specific alterations, which need to be elucidated in further studies. So far, therapeutic mTORC1 activation may be a potential strategy to prevent disease progress in patients.
Correlation of morphological changes to clinical symptoms
The presence of storage material in a large number of neurons in the absence of significant neuronal loss suggests neuronal dysfunction as the underlying cause of TBCK-DD. This is a clear difference to most other LSDs that are characterized by severe neuronal degeneration with marked brain atrophy in late stage disease. The distribution pattern of neuronal storage material fits well with the clinical phenotype: neurogenic atrophy of skeletal muscle is likely the consequence of secondary motoneurons in the spinal cord being severely affected and intellectual disability is consistent with the high amount of neuronal inclusions in the neocortex, archicortex and hippocampus. Those changes may not only explain neuronal deficits, but also account for uncontrolled neuronal excitations as a source of epileptic seizures. As the patients suffered from declining visual acuity or blindness, an involvement of the retina like in CLN1–3 and CLN5 [37] seems possible, although an electroretinogram in one patient with TBCK-DD was normal [9] and points to a cause by affected neurons in the central visual tract. Overall, the clinical symptoms with severe developmental delay and intellectual disability, hypotonia, severe visual deterioration and generalized seizures resemble those seen in infantile and late infantile CLN1 and CLN2, respectively.
Conclusion
In conclusion, our investigations uncover TBCK-DD as a novel LSD. The predominant neuronal lipofuscin inclusions as well as the clinical symptoms are typical for an NCL and may indicate a novel subtype (CLN15). The accumulation of carbohydrate-related material and the PAS-positivity of lymphocytic vacuoles, however, exceed the pathological alterations seen in other NCL. Since our investigations are limited due to restrictedly archived tissue material, further studies, in particular ultrastructural analyses of the CNS and vacuolated lymphocytes are needed in order to come to a definite classification of this disorder. The underlying mechanism can be assigned to an autophagosomal-lysosomal dysfunction, including enhanced mTORC1-mediated autophagosome formation and reduced Rab-mediated autophagosome-lysosome fusion, thus implicating new targets for therapeutic approaches in TBCK-DD.Additional histological and ultrastructural observations. (PDF 771 kb)
Authors: T Kirisako; M Baba; N Ishihara; K Miyazawa; M Ohsumi; T Yoshimori; T Noda; Y Ohsumi Journal: J Cell Biol Date: 1999-10-18 Impact factor: 10.539
Authors: Robert N Jinks; Erik G Puffenberger; Emma Baple; Brian Harding; Peter Crino; Agnes B Fogo; Olivia Wenger; Baozhong Xin; Alanna E Koehler; Madeleine H McGlincy; Margaret M Provencher; Jeffrey D Smith; Linh Tran; Saeed Al Turki; Barry A Chioza; Harold Cross; Gaurav V Harlalka; Matthew E Hurles; Reza Maroofian; Adam D Heaps; Mary C Morton; Lisa Stempak; Friedhelm Hildebrandt; Carolin E Sadowski; Joshua Zaritsky; Kenneth Campellone; D Holmes Morton; Heng Wang; Andrew Crosby; Kevin A Strauss Journal: Brain Date: 2015-06-11 Impact factor: 13.501
Authors: Jessica X Chong; Viviana Caputo; Ian G Phelps; Lorenzo Stella; Lisa Worgan; Jennifer C Dempsey; Alina Nguyen; Vincenzo Leuzzi; Richard Webster; Antonio Pizzuti; Colby T Marvin; Gisele E Ishak; Simone Ardern-Holmes; Zara Richmond; Michael J Bamshad; Xilma R Ortiz-Gonzalez; Marco Tartaglia; Maya Chopra; Dan Doherty Journal: Am J Hum Genet Date: 2016-03-31 Impact factor: 11.043
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Elizabeth J Meiman; Grace Robinson Kick; Cheryl A Jensen; Joan R Coates; Martin L Katz Journal: Dev Neurobiol Date: 2022-04-28 Impact factor: 3.102
Authors: Danielle de Paula Moreira; Angela May Suzuki; André Luiz Teles E Silva; Elisa Varella-Branco; Maria Cecília Zorél Meneghetti; Gerson Shigeru Kobayashi; Mariana Fogo; Merari de Fátima Ramires Ferrari; Rafaela Regina Cardoso; Naila Cristina Vilaça Lourenço; Karina Griesi-Oliveira; Elaine Cristina Zachi; Débora Romeo Bertola; Karina de Souza Weinmann; Marcelo Andrade de Lima; Helena Bonciani Nader; Andrea Laurato Sertié; Maria Rita Passos-Bueno Journal: Front Cell Neurosci Date: 2022-01-13 Impact factor: 5.505
Authors: Grace Robinson Kick; Elizabeth J Meiman; Julianna C Sabol; Rebecca E H Whiting; Juri Ota-Kuroki; Leilani J Castaner; Cheryl A Jensen; Martin L Katz Journal: Exp Eye Res Date: 2021-06-30 Impact factor: 3.770