Marisa Granato1, Maria Saveria Gilardini Montani2, Camilla Angiolillo3, Gabriella D'Orazi4,5, Alberto Faggioni6, Mara Cirone7. 1. Department of Experimental Medicine, "Sapienza" University of Rome, Italy, Laboratory affiliated to Istituto Pasteur Italia-Fondazione Cenci Bolognetti, Viale Regina Elena 324, 00161 Rome, Italy. marisa.granato@uniroma1.it. 2. Department of Experimental Medicine, "Sapienza" University of Rome, Italy, Laboratory affiliated to Istituto Pasteur Italia-Fondazione Cenci Bolognetti, Viale Regina Elena 324, 00161 Rome, Italy. mariasaveria.gilardinimontani@uniroma1.it. 3. Department of Experimental Medicine, "Sapienza" University of Rome, Italy, Laboratory affiliated to Istituto Pasteur Italia-Fondazione Cenci Bolognetti, Viale Regina Elena 324, 00161 Rome, Italy. camilla_angiolillo@yahoo.it. 4. Department of Research, Advanced Diagnostics, and Technological Innovation, Regina Elena National Cancer Institute, 00144 Rome, Italy. gdorazi@unich.it. 5. Department of Medical, Oral and Biotechnological Sciences, University "G. d'Annunzio", 66013 Chieti, Italy. gdorazi@unich.it. 6. Department of Experimental Medicine, "Sapienza" University of Rome, Italy, Laboratory affiliated to Istituto Pasteur Italia-Fondazione Cenci Bolognetti, Viale Regina Elena 324, 00161 Rome, Italy. alberto.faggioni@uniroma1.it. 7. Department of Experimental Medicine, "Sapienza" University of Rome, Italy, Laboratory affiliated to Istituto Pasteur Italia-Fondazione Cenci Bolognetti, Viale Regina Elena 324, 00161 Rome, Italy. mara.cirone@uniroma1.it.
Abstract
Previous studies have indicated that cytotoxic treatments may induce or not activate viral lytic cycle activation in cancer cells latently infected by Kaposi's sarcoma-associated herpesvirus (KSHV). To investigate the molecular mechanisms responsible for such an effect, we compared two cytotoxic treatments able to induce the viral lytic cycle, named 12-O-tetradecanoylphorbol 13-acetate (TPA) (T) in combination with sodium butyrate (B) and bortezomib (BZ), with two cytotoxic treatments that did not activate this process, named metformin (MET) and quercetin (Q). Our results indicated that TB and bortezomib increased levels of oxygen reactive species (ROS) while metformin and quercetin reduced them. The finding that N-acetylcysteine (NAC), a reactive oxigen species (ROS) scavenger, counteracted K-bZIP expression induced by TB or bortezomib, confirmed that an ROS increase played a role in KSHV lytic cycle activation. Moreover, we found that TB and bortezomib up-regulated p62/Sequestosome1(p62/SQSTM1) protein, while metformin and quercetin down-regulated it. p62/SQSTM1 silencing or the inhibition of NF-E2-related factor 2 (NRF2) or Heat Shock Factor 1 (HSF1), that mediate p62/SQSTM1 transcription, also reduced KSHV lytic antigen expression induced by TB or bortezomib. Interestingly, such combination treatments further increased intracellular ROS and cytotoxicity induced by the single TB or bortezomib treatment, suggesting that NRF2, HSF1 and p62/SQSTM1 keep the ROS level under control, allowing primary effusion lymphoma (PEL) cells to continue to survive and KSHV to replicate.
Previous studies have indicated that cytotoxic treatments may induce or not activate viral lytic cycle activation in cancer cells latently infected by Kaposi's sarcoma-associated herpesvirus (KSHV). To investigate the molecular mechanisms responsible for such an effect, we compared two cytotoxic treatments able to induce the viral lytic cycle, named 12-O-tetradecanoylphorbol 13-acetate (TPA) (T) in combination with sodium butyrate (B) and bortezomib (BZ), with two cytotoxic treatments that did not activate this process, named metformin (MET) and quercetin (Q). Our results indicated that TB and bortezomib increased levels of oxygen reactive species (ROS) while metformin and quercetin reduced them. The finding that N-acetylcysteine (NAC), a reactive oxigen species (ROS) scavenger, counteracted K-bZIP expression induced by TB or bortezomib, confirmed that an ROS increase played a role in KSHV lytic cycle activation. Moreover, we found that TB and bortezomib up-regulated p62/Sequestosome1(p62/SQSTM1) protein, while metformin and quercetin down-regulated it. p62/SQSTM1 silencing or the inhibition of NF-E2-related factor 2 (NRF2) or Heat Shock Factor 1 (HSF1), that mediate p62/SQSTM1 transcription, also reduced KSHV lytic antigen expression induced by TB or bortezomib. Interestingly, such combination treatments further increased intracellular ROS and cytotoxicity induced by the single TB or bortezomib treatment, suggesting that NRF2, HSF1 and p62/SQSTM1 keep the ROS level under control, allowing primary effusion lymphoma (PEL) cells to continue to survive and KSHV to replicate.
It has not been clarified why some cytotoxic treatments induce gammaherpesvirus replication in lymphoma cells harboring latent Epstein–Barr virus (EBV) or Kaposi sarcoma-associated herpesvirus (KSHV) infection. Lytic cycle activation may be considered a side effect of chemotherapies, since it leads to the expression of viral lytic antigens that may promote tumorigenesis. Particularly in the case of KSHV, viral replication and viral spread contribute to the maintenance of viral-associated malignancies [1]. Therefore, it is important to understand, at the molecular level, which pathways are activated by cytotoxic drugs that induce the viral lytic cycle in order to target them to restrain KSHV replication. In this study, we compared the effects induced by cytotoxic treatments that activate KSHV lytic cycle in primary effusion lymphoma (PEL) cells, namely 12-O-tetradecanoylphorbol 13-acetaten (TPA) in combination with sodium butyrate (TB) and bortezomib (BZ), with those mediated by metformin (MET) and quercetin (Q) that, although cytotoxic for PEL cells [2,3,4,5], did not affect viral replication. We investigated whether these drugs could influence the levels of intracellular oxygen reactive species (ROS), since these molecules have been reported to promote the KSHV lytic cycle [6]. Moreover, as we have recently shown, it is known that ROS may activate the extracellular signal-regulated kinase 1/2 (ERK1/2), which in turn phosphorylates serine 15 p53, promoting the transcription of p21 and activating KSHV replication [3]. Accordingly, previous separate findings have indicated that the activation of ERK1/2 [7] and p53-p21 axis were essential for the induction of KSHV replication in PEL cells [8]. In response to the intracellular ROS increase, transcription factors such as NF-E2-related factor 2 (NRF2) and Heat Shock Factor 1 (HSF1), the main mediators of the anti-oxidant and heat shock response, may be activated to protect cells from stress [9]. Among other molecules, these transcription factors promote the transcription of p62/Sequestosome1 (p62/SQSTM1) [10]. Notably, p62/SQSTM1 accumulation may also be the consequence of autophagy inhibition, not only because the reduction of autophagy causes cellular stress, but because autophagy represents the main route for p62/SQSTM1 degradation [11]. Interestingly, p62/SQSTM1 activates the p62/SQSTM1-KEAP1-NRF2 axis and increases NRF2 stabilization through a positive feedback loop [10]. In this study, we investigated whether the level of intracellular ROS could influence the expression of p62/SQSTM1 in TB-, BZ-, MET-, and Q-treated PEL cells, and evaluated its role in KSHV lytic cycle activation. It has been shown that p62/SQSTM1 negatively affects viral replication in the case of dengue virus [12], while its role in KSHV lytic cycle has not yet been investigated. We then explored whether HSF1 and NRF2, the main transcription factors promoting p62/SQSTM1 transcription, could also play a role in KSHV lytic cycle induced by TB or BZ. It has been reported that NRF2 inhibition may affect KSHV lytic reactivation [13] and, interestingly, HSP70, another common target of HSF1 and NRF2, seems to be essential for KSHV replication, being recruited at the replication compartments (RTCs) [14]. Since several molecular pathways, activated in response to stress to help cells to cope with it, concomitantly promote viral replication, it could be that their inhibition allows us to deal with two birds with one stone. Indeed, survival and progression of KSHV viral-associated malignancies are also dependent on continuous viral release and renewal of viral infection [15]. Based on these considerations, the aim of this study was to investigate which molecules, and/or molecular pathways, activated by cytotoxic drugs were responsible for KSHV lytic cycle activation and whether their targeting could prevent such effects and further reduce PEL cell survival.
2. Materials and Methods
2.1. Cell Culture
BC3 (American Type Culture Collection, Manassas, VA, USA; ATCC) and BCBL1 (kindly provided by Prof. P. Monini, National AIDS Center, Istituto Superiore di Sanità, Rome, Italy) are human B-cell lines KSHV-infected, established from patients affected by primary effusion lymphoma (PEL). Cells were cultured in RPMI 1640 (Thermo Fisher Scientific, Waltham, MA, USA; 21870) supplemented with 10% fetal bovine serum (FBS) (Corning, NY, USA; 35-079), with L-glutamine and with streptomycin (100 µg/mL) (Corning, NY, USA; 30-002) and with penicillin (100 U/mL) (Corning, NY, USA; 25-005) in 5% CO2 at 37 °C.
2.2. Cell Treatments
To induce viral replication, PEL cell lines were treated with either 12-O-tetradecanoylphorbol 13-acetate (TPA) (20 ng/mL) (Sigma Aldrich, St Louis, MO, USA; 185361) and sodium butyrate (B) (0.3 mM) (Sigma Aldrich, St Louis, MO, USA; B5887) (TB), or with bortezomib (BZ) (20 nM) (Santa Cruz Biotechnology, Dallas, TX, USA; sc-217785) at the indicated times. BC3 and BCBL1 cell lines were treated with metformin (MET) (20 mM) (Sigma Aldrich, St Louis, MO, USA; D150659) or quercetin (Q) (50 µM) (Sigma Aldrich, St Louis, MO, USA; Q4951) at the indicated times [5,16]. To evaluate the role of HSF1 and NRF2 during KSHV replication induced by TB or BZ, a time-course assay (from 5 to 10 µM) was performed with HSF1 inhibitor, KRIBB11 (HSF1 Inhibitor, I-HSF1), (Merck, Milano, Italy. 385570) or with NRF2 inhibitor, Brusatol (HSF1 Inhibitor, I-NRF2) (from 5 to 10 nM) (Sigma Aldrich, St Louis, MO, USA; 1868) for the indicated time. In some experiments, BC3 and BCBL1 were pre-treated with I-HSF1 (5 µM), I-NRF2 (5 nM) and/or with N-acetylcysteine (NAC) (5 mM) (Sigma Aldrich, St Louis, MO, USA; A7250), for 20 min and then cultured with TPA (20 ng/mL)/sodium butyrate (0.3 mM) for the indicated time. In some experiments, BC3 cells were treated with TB in the presence of H2O2 (100 µM) for the indicated time.In order to investigate autophagy, cells were treated with TPA (20 ng/mL)/sodium butyrate (0.3 mM) in the presence or absence of Bafilomycin A1 (BAF) (20 nM) (Santa Cruz Biotechnology Inc., Dallas, TX, USA; sc-201550), an inhibitor of vacuolar-H+-ATPase, for the final 4 h.
2.3. Cell Assay Viability
BC3 and BCBL1 cell lines were plated in 12-well plates at a density of 8 × 105 cells/well. Cells were pre-treated with I-HSF1 (5 µM), I-NRF2 (5 nM) or I-HSP70 (10 µM) and then cultured with either TPA (20 ng/mL) and sodium butyrate (0.3 mM) (TB) or bortezomib (BZ) (20 nM) for 24 h in the presence or absence of NAC or H2O2.The BC3 cell line was transiently transfected with a specific RNA duplex to knock-down NRF2 for 48 h and then treated with TPA (20 ng/mL) and sodium butyrate (0.2 mM) (TB) or bortezomib (BZ) (20 nM) for the last 24 h.A trypan blue (Sigma Aldrich, St Louis, MO, USA; 72571) exclusion assay was performed to test cell viability. Live cells were counted by light microscopy using a Neubauer hemocytometer.
2.4. Antibodies
In western blotting, we used the following primary antibodies: mouse monoclonal anti-K-bZIP (1:300) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-69797), mouse monoclonal anti-gp64 (1:100) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-65444), mouse monoclonal anti-SQSTM1 (1:500) (BD Transduction Laboratories, San Jose, CA, USA; cat. no. 610833), rabbit polyclonal anti-Microtubule-Associated protein 1 light chain 3 (LC3) (1:1000) (Novus Biologicals, Cambridge, UK; NB100-2220SS), mouse monoclonal anti-HSP70 (1:100) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-66049), mouse monoclonal anti-NRF2 (1:100) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-365949), rabbit polyclonal anti-p21 (1:500) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-397). Mouse monoclonal anti-β-actin (1:10000) (Sigma Aldrich, St Louis, MO, USA; A5441) (1:10000) was used as the loading control. The goat polyclonal anti-mouse IgG-horseradish peroxidase (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-2005) and anti-rabbit IgG-HRP (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-2004) were used as secondary antibodies. All the primary and secondary antibodies were diluted in PBS-0.1% Tween20 solution containing 3% of BSA (SERVA, Reno, NV, USA; 11943.03).In the immunofluorescence assay, mouse monoclonal anti-K-bZIP (1:300) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-69797) or mouse monoclonal anti-gp64 (1:100) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-65444) was diluted in 1XPBS and used to evaluate the KSHV lytic cycle.
2.5. Western Blot Analysis
1 × 106 PEL cells were washed twice with 1X PBS and centrifuged at 1500 rpm for 5 min. Cells were lysed in a 1X RIPA buffer containing 150 mM Nacl, 1% NP-40 (Sigma Aldrich, NP40S), 50 mM Tris-HCl, pH 8, 0.5% deoxycholic acid (Sigma Aldrich, D6750), 0.1% SDS (Sigma Aldrich, 71736), protease (Sigma Aldrich, St Louis, MO, USA; S8830) and phosphatase inhibitors (Sodium Orthovanadate; Sigma Aldrich, St Louis, MO, USA; S6508) (Sodium Fluoride; Sigma Aldrich, St Louis., MO, USA; S7920). Following this, 10 µg of protein lysates were subjected to electrophoresis on 10% or 15% acrylamide gels. Gels were transferred to nitrocellulose membranes (Bio-Rad, 162-0115) for 2 h in Tris-glycine buffer. Membranes were blocked in PBS-0.1% Tween 20 solution containing 3% BSA, probed with specific antibodies and developed using ECL Blotting Substrate (Advansta, K-12045-D20).
2.6. Indirect Immunofluorescence Assay (IFA)
For immunofluorescence, BC3 and BCBL1 cell lines were treated either with TPA (20 ng/mL) and sodium butyrate (0.3 mM) or with bortezomib (20 nM) for 24 h with and without previous RNA interference to knock-down HSF1, NRF2 and SQSTM1 for 48 h. A total of 1 × 106 cells were centrifuged, washed in cold 1X PBS, seeded on glass slides and air dried. Cells were fixed in 2% paraformaldehyde for 30 min and then made permeable with 0.2% Trinton X-100 (Sigma Aldrich, St Louis, MO, USA; T-8787) for 5 min at room temperature. Slides were incubated with mouse monoclonal anti-K-bZIP (1:300 in 1X PBS) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-69797), mouse monoclonal anti-gp64 (1:100) (Santa Cruz Biotechnology Inc., Heidelberg, Germany; sc-65444) or mouse monoclonal anti-p62/SQSTM1 (1:500 in 1X PBS) (BD Transduction Laboratories, San Jose, CA, USA; cat. no. 610833) antibody and washed three times in 1X PBS after 1 h. They were then incubated with polyclonal conjugated-Cy3 sheep anti-mouse antibody (Jackson ImmunoResearch, Cambridgeshire, UK; 515-165-062) (1:1000 in 1X PBS) for 30 min at room temperature and washed twice with 1X PBS. Cells were then incubated with 1 µg/mL of 4′,6′-diamidino-2-phenylindole (DAPI) to stain nuclei and coverslips were mounted face down using a PBS-glycerol (1:1) solution. The immunofluorescence was analyzed using a Fluorescence microscope (Zeiss) equipped with an AxioCam MRM Rev.3 at ×40 magnification.
2.7. Endogenous Reactive Oxygen Species (ROS) Detection
To detect reactive oxygen species, BC3 and BCBL1 cells were treated with TPA (20 ng/mL) and sodium butyrate (0.3 mM) (TB), or with bortezomib (BZ) (20 nM) for 24 h. In some experiments, PEL cell lines were pre-treated with I-HSF1 (5 µM) and I-NRF2 (5 mM) and then cultured with TPA (T) (20 ng/mL)/ sodium butyrate (B) (0.3 mM) or bortezomib (BZ) (20 nM), as described above.Cells were stained with 2′,7′-dichlorofluorescein diacetate (DCFDA) (Thermo Fisher Scientific, Waltham, MA, USA; D399), a fluorogenic dye which diffuses into the cell. DCFDA is oxidized by ROS into 2′,7′-dichlorofluorescein, a fluorescent compound which can be detected by fluorescence spectroscopy. Cells were twice washed 1X PBS and then incubated at 37 °C with 10 µM DCFDA for 15 min. PEL cells were analyzed in FL-1 by a FACScalibur flow cytometer (BD, USA). For each analysis 10,000 events were recorded [17,18,19].
2.8. Transfection and Plasmids
The BC3 cell line was transiently transfected with empty vector (EV) or pDest-mCherry-EGFP-SQSTM1 (pSQSTM1) (kindly provided by Terje Johansen) [20] plasmid, using Lipofectamine 2000 as indicated by manufacture’s instructions. Briefly, 5 × 105 cell were seeded into 12-wells plate in RPMI supplemented with 10% FBS and L-glutamine without antibiotics for 24 h. Then, 1 µg plasmid DNA and 3 µL Lipofectamine 2000/well were diluted in Opti-MEM medium. The mixture was added to cells for 48 h. Cells were treated with TPA (20 ng/mL) (T) and sodium butyrate (B) (0.3 mM) for the last 24 h. To evaluate the KSHV lytic activation, K-bZIP expression was assessed by western blotting assay.
2.9. HSF1, NRF2 and P62/SQSTM1 Knockdown by Small Interfering RNA (siRNA)
HSF1, NRF2 and SQSTM1 knockdown was performed in PEL cell lines using specific small interfering RNA. Subsequently, 3 × 105 cells were seeded in 12-wells culture plate in RPMI medium supplemented with 10% fetal bovine serum (FBS) (Corning, NY, USA; 35-079), with L-glutamine and without antibiotics. Subsequently, 30 pmoli of siRNA duplex (siRNAHSF1, siRNANRF2 and siRNASQSTM1) (Santa Cruz Biotechnology Inc., Dallas, TX, USA; sc-35611, sc-37030 and sc-29679) and 7 µL of Lipofectamine 2000 Transfection Reagent (Life Technologies, 11668027) were diluted in Optimem medium (Thermo Fisher Scientific, Waltham, MA, USA; 31985062) for 20 min at room temperature. The mixture was added to the cell culture for 48 h. After this, the cells were treated either with TPA (20 ng/mL) (T) and sodium butyrate (0.3 mM), or with bortezomib (20 nM) for the last 24 h.Transfection efficiency was evaluated by Fluorescein Conjugate-A siRNA (Santa Cruz Biotechnology Inc., Dallas, TX, USA; sc-36869). A control siRNA-A (siRNASC) (Santa Cruz Biotechnology Inc., Dallas, TX, USA; sc-37007) was also used [21].
2.10. RNA Extraction
BCBL1 cell line was treated either with TPA (20 ng/mL) and sodium butyrate (0.3 mM), or with bortezomib (20 nM) for 6 h and RNA was extracted [22]. Briefly, cells were centrifuged and washed twice in cold 1X PBS. Then, cells were lysed using 1 mL TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA; 15596026) for 5 min at room temperature. Following this, 0.2 mL chloroform was added to the solution. To isolate total RNA, the mixture was centrifuged and 0.5mL isopropanol was added to the colorless upper aqueous phase. Extracted RNA was washed twice in 75% ethanol and then re-suspended in warmed RNAase- and DNAse-free water. To remove contaminating genomic DNA, 5 µg RNA was incubated with DNase I, according to the manufacturer’s instructions (Sigma Aldrich, St Louis, MO, USA; 11284932001). RNA samples were collected and stored at −80 °C.
2.11. Reverse-Transcription Quantitative PCR (qRT-PCR) and Quantitative PCR (qPCR)
1 µg total RNA was used to synthesize single-stranded cDNA, using SuperScript III Reverse Transcriptase Kit (Thermo Fisher Scientific, Waltham, MA, USA; 18064014). A total of 2 µL/well (10 ng/sample) of template was mixed to SYBR Master (Applied Biosystems, Foster City, CA, USA; 4472908), RNAase-/DNAse-free water and primers in 20 µL volume.To perform qRT-PCR, the following conditions were used: 50 °C for 2 min, 95 °C for 2 min, 95 °C for 15 s and 60 °C for 1 min (40 cycles). The following primers were used:SQSTM1 (FW GGAGCCAGAGAACAAGTACC; RW CTCGCTCTTTCAGTTTCATGTTC)ACTA(FWTCACCCACACTGTGCCATCCTACGA;RWCAGCGGAACCGCTCATTGCCAATGG) [23,24].Target mRNA level was normalized to housekeeping mRNA actin and analyzed, comparing treated (TB or BZ) to untreated samples.To evaluate KSHV viral production, the BC3 cell line was pre-treated with I-HSF1 (5 µM) for 1 h and then with NAC (5 mM) for the last 30 min. Cells were treated with TPA (20 ng/mL) (T)/Butyrate (B) (0.3 mM) for 24 h. Supernatants were collected and qRT-PCR was performed to assess KSHV DNA using the HHV-8 Elite MGB kit (ELITechGroup, Puteaux, France; RTS038PLD).
2.12. Densitometric Analysis
The quantification of proteins bands was performed by densitometric analysis using the Image J software, which was downloaded from the NIH web site (available online: http://imagej.nih.gov).
2.13. Statistical Analysis
Results are represented by the mean ± standard deviation (SD) of at least three independent experiments. Differences were considered statistically significant for p-value <0.05.
3. Results
3.1. TPA/Butyrate (TB) and Bortezomib (BZ) Increase Intracellular ROS and Promote KSHV Lytic Antigen Expression, while Quercetin (Q) and Metformin (MET) Reduce ROS and Do Not Induce This Effect in PEL Cells
We investigated the impact of four different cytotoxic treatments, namely TPA in combination with sodium butyrate (TB), bortezomib (BZ), quercetin (Q) and metformin (MET), on the activation of the KSHV lytic cycle in PEL cells. These drugs, able to induce apoptosis in these cells [3,4,5,25] with similar kinetics (Figure 1A), were used at concentrations that inhibit 50% of cell survival. As shown in Figure 1B,C, both TB and BZ induced the expression of early and late viral lytic antigens K-bZIP and gp64, respectively, as indicated by western blot or by IFA, while Q and MET failed do so. Searching for the mechanisms that could underlie these differing impacts on the lytic cycle activation, we found that TB and BZ increased ROS while MET and Q reduced them, as evaluated by FACS analysis using DCFDA staining (Figure 2A). Similarly, TB and BZ increased ROS while MET and Q decreased them in BJAB, a B lymphoma cell line that does not harbor the viral genome (Figure 2A), suggesting that ROS modulation was independent of KSHV infection. The reduction of K-bZIP expression by the ROS scavenger N-acetylcysteine (NAC) (Figure 2B), and the decreased number of cells expressing the KSHV late lytic antigen gp64 (Figure 2C), as evaluated by IFA, indicated that the ROS increase played a role in the activation of KSHV lytic cycle in PEL cells undergoing TB or BZ treatment.
Figure 1
12-O-tetradecanoylphorbol 13-acetate (TPA) in combination with sodium butyrate (TB) and bortezomib (BZ) induce the Kaposi sarcoma-associated herpesvirus (KSHV) lytic cycle, while metformin and quercetin fail to do so in PEL cells. (A) The BC3 cell line was treated with either TPA (T) (20 ng/mL) and sodium butyrate (0.3 mM) in combination (TB), bortezomib (BZ) (20 nM), metformin (MET) (20 mM), or quercetin (Q) (15 µM). Cell viability was evaluated by trypan blue exclusion in a time course assay. Histograms represent the mean ± standard deviation (SD) of at least three independent experiments. (B) BC3 and BCBL1 cell lines were treated with TPA (T) (20 ng/mL) and sodium butyrate (B) (0.3 mM) in combination (TB), bortezomib (BZ) (20 nM), metformin (MET) (20 mM), or quercetin (Q) (15 µM) for 24 h. K-bZIP and β-Actin expression was evaluated by western blotting. Densitometric analysis was performed using Image J software and the ratio of K-bZIP versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of at least three independent experiments. (C) The BC3 cell line was treated with TPA (T) (20 ng/mL) and sodium butyrate (B) (0.3 mM) in combination (TB), bortezomib (BZ) (20 nM), metformin (MET) (20 mM), or quercetin (Q) (15 µM) for 24 h, and was analyzed by IFA for the expression of the late lytic antigen gp64. The percentage of gp64-positive cells is also indicated. Magnification 20×.
Figure 2
Oxygen reactive species (ROS) levels increase with TB- and BZ-treated PEL cells, and decrease in MET- and Q-treated PEL cells. (A) KSHV-infected BC3 or uninfected BJAB cell lines were cultured with TB (20 ng/mL and 0.3 mM), BZ (20 nM), MET (5 mM) or Q (15 µM) (6, 12 and 24 h) and ROS production was assessed by FACS analysis in a time-dependent manner using DCFDA detection assay. Histograms represent the fold increase of treated versus untreated cells. Standard deviations (SD) are shown. (B) KSHV lytic antigen K-bZIP expression in TB- (20 ng/mL and 0.3 mM) or BZ- (20 nM) treated cells, in the presence or in the absence of N-Acetyl cysteine (Nac) (5 mM), assessed by western blotting analysis. β-Actin was used as a loading control. Densitometric analysis has been performed using Image J software and the ratio of K-bZIP versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of at least three independent experiments. p* value < 0.05. (C) Late lytic antigen gp64 expression was evaluated by IFA in TB- or BZ-treated PEL cells, in the presence or in the absence of NAC. The percentage of gp64-positive cells is also indicated. Magnification 20×.
3.2. p62/SQSTM1 is Up-Regulated by TB and BZ and Down-Regulated By MET And Q
It has been reported that oxidative stress may lead to the up-regulation of p62/SQSTM1 expression [26]. Thus, we investigated if its expression could be up-regulated by TB or BZ treatment, to help cells cope with oxidative stress. As shown in Figure 3A, we found that p62/SQSTM1 accumulated after 6, 12 and 24 h of TB or BZ treatments, the same time points in which these drugs increased ROS and activated KSHV lytic antigen expression. Conversely, Q and MET, which reduced ROS and down-regulated p62/SQSTM1 expression, did not induce viral replication. The accumulation of p62/SQSTM1 in TB- and BZ-treated PEL cells was then demonstrated by IFA experiments that also evidenced its different intracellular localization in cells following TB or BZ treatment (Figure 3B). This could be due to the BZ-mediated activation of kinases phosphorylating p62/SQSTM1 and leading to the formation of larger aggresomes. Subsequently, we correlated p62/SQSTM1 up-regulation with ROS increase. The finding that p62/SQSTM1 expression decreased in the presence of the ROS scavenger NAC in TB- and BZ-treated cells indicated that oxidative stress played a role in increasing its expression (Figure 3C).
Figure 3
p62/SQSTM1 protein accumulates with TB and BZ treatments in the BC3 cell line. (A) p62/SQSTM1 expression was evaluated by western blotting in a time-dependent manner in PEL cells treated with TB (20 ng/mL) (0.3 mM) or BZ (20 nM) in the BC3 cell line. K-bZIP and β-Actin were used as KSHV lytic infection markers and a loading control, respectively. Densitometric analysis was performed using Image J software and the K-bZIP or SQSTM1/β-Actin ratio was calculated. Histograms represent the mean ± standard deviation (SD) of three independent experiments. (B) p62/SQSTM1 accumulated in the BC3 cell line treated with TB or BZ, as indicated by IFA experiments performed after 24 h of treatment (panel II and III, green). DAPI was used for nuclei staining (blue). Magnification ×40. The dashed rectangular box displays a zoomed-view of SQSTM1-positive cells. (C) p62/SQTM1 expression was evaluated in TB- and BZ- treated cells in the presence or absence of NAC. Densitometric analysis was performed using Image J software and the ratio of K-bZIP or SQSTM1 versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of at least three independent experiments. * p-value < 0.05.
3.3. p62/SQSTM1 Up-Regulation is not Dependent on Autophagy Reduction at 6 and 12 h, while Autophagy Inhibition Contributes to Its Accumulation at 24 h after TB or BZ Treatments
As p62/SQSTM1 is a protein mainly degraded through autophagy [11], we evaluated whether p62/SQSTM1 accumulation in TB- and BZ-treated PEL cells could be due to the inhibition of autophagic flux. For this aim, we evaluated LC3-I/II expression in PEL cells treated with TB or BZ after 6–12 or 24 h of treatment, in the presence or absence of bafilomycin (BAF). Bafilomycin is an inhibitor of vacuolar H+ ATPase (V-ATPase) that inhibits the last autophagic steps and thus LC3-II degradation, allowing us to better evaluate its formation. As shown in Figure 4A, after 6 and 12 h, LC3-II expression increased in cells treated with TB or BZ in the presence of BAF, indicating that the autophagic flux was complete and that p62 accumulation did not depend on the reduction of autophagy at these time points. Similar to our previous findings [27], after 24 h of TB or BZ treatment LC3-II did not further accumulate in the presence of BAF in comparison to control cells (see Figure 4A), indicating that autophagy was blocked in the final stages and contributed to p62/SQSTM1 accumulation. We then investigated whether the p62/SQSTM1 up-regulation observed after 6 h of TB or BZ treatment was dependent on mRNA increase. Towards this aim, we performed qRT-PCR analysis and, as shown in in Figure 4B, we found that SQSTM1 mRNA increased in cells undergoing TB or BZ treatment. These results suggest that an increase of transcription and/or changes in mRNA stability and degradation could be leading to the up-regulation of p62/SQSTM1 observed at the time in which the autophagic flux was complete.
Figure 4
TB and BZ, which activate the KSHV lytic cycle and induce autophagy, increase SQSTM1 RNA in PEL cells. BC3 PEL cells were treated with (A) TB or (B) BZ in the presence or absence of bafilomycin (BAF) (20 nM) for the final 3 h, and LC3-I/II was evaluated by western blotting analysis. β-Actin was used as a loading control. Densitometric analysis was performed using Image J software and the LC3-II/β-Actin ratio was calculated. Histograms represent the mean ±standard deviation (SD) of at least three independent experiments. * p-value < 0.05, ** p-value < 0.05. (B) BC3 cell line was treated with TB or BZ for 6 h and SQSTM1 RNA was evaluated by qRT-PCR. Target mRNA level was normalized to actin gene and analyzed to compare treated (TB or BZ) with untreated samples. Data are plotted in histograms showing standard deviation (SD). * p-value < 0.05.
3.4. p62/SQSTM1 Plays a Role in KSHV Lytic Antigen Expression Induced by TB or BZ
As p62/SQSTM1 expression increased in PEL cells undergoing TB or BZ, the same treatments that induced KSHV lytic cycle, the role of p62/SQSTM1 in this process was evaluated. We performed SQSTM1 knocking-down by using specific siRNA and found that it led to a reduction of K-bZIP expression in PEL cells treated with TB or BZ (Figure 5A). These results were confirmed by immunofluorescence experiments that showed a reduction of K-bZIP-positive cells after SQSTM1 silencing (Figure 5B), further indicating that p62/SQSTM1 plays a role in KSHV lytic antigen expression induced by TB or BZ in PEL cells. To confirm the importance of p62/SQSTM1 in supporting the KSHV lytic cycle, we also overexpressed this molecule by using a plasmid expression vector and, as shown in Figure 5C, p62/SQSTM1 overexpression caused increased K-bZIP expression in TB-treated cells.
Figure 5
SQSTM1 RNA interference reduces K-bZIP expression in PEL cell lines. (A) p62/SQSTM1 expression following RNA interference using a specific siRNASQSTM1, before treating PEL cells with TB or BZ. Both p62/SQSTM1 and K-bZIP expression were evaluated by western blotting, and siRNASC was used as a control. Densitometric analysis was performed using Image J software and the ratio of p62/SQSTM1 and K-bZIP versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of three independent experiments. p* < 0.05 (siRNA SQSTM1 vs siRNA SC), p** < 0.05 (siRNA SQSTM1 vs siRNA SC; TB-treated) and p*** < 0.05 (siRNA SQSTM1 vs siRNA SC; BZ-treated) (B). K-bZIP expression (red staining) was evaluated by immunofluorescence assay in SQSTM1 knocked-down BCBL1 cells. The percentage of K-bZIP-positive cells is indicated. DAPI was used to stain nuclei (blue). Images are 40× magnification. All results are representative of three independent experiments. (C) K-bZIP expression in TB-treated BC3 cells overexpressing SQSTM1, as evaluated by western blot analysis. Densitometric analysis was performed using Image J software and the ratio of p62/SQSTM1 and K-bZIP versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of three independent experiments. p* < 0.05 (TB vs CT; EV-transfection)and p** < 0.05 (TB vs CT; pSQSTM1-transfection).
3.5. The Main Mediators of Cell Stress Responses, HSF1 and NRF2, Promote P62/SQSTM1 And KSHV Lytic Antigen Expression in TB- or BZ-Treated PEL Cells
p62/SQSTM1 is a common transcription target of HSF1 and NRF2, activated during the main mammalian cellular responses to stress (the heat shock and anti-oxidant responses, respectively) [9]. In order to investigate the role HSF1 and NRF2 in p62/SQSTM1 up-regulation and the activation of KSHV lytic antigen expression, we pharmacologically inhibited these transcription factors. In a dose response assay, we found that the HSF1 inhibitor KRIBB11 (I-HSF1) used at 5 µM was able to reduce HSF1 activity, as revealed by the decreased expression of its target heat shock protein (HSP) 70 (Figure 6A), and reduced p62/SQSTM1 and K-bZIP expression in TB- or BZ-treated PEL cell lines (Figure 6B). Furthermore, the inhibition of NRF2 by brusatol (I-NRF2) at concentrations able to reduce NRF2 expression (5 nM) (Figure 6C), decreased p62/SQSTM1 and K-bZIP expression (Figure 6D), suggesting that both HSF1 and NRF2 transcription factors played a role in the KSHV lytic antigen expression induced by TB or BZ in PEL cells. Given that pharmacological inhibitors could have off-target effects, to better elucidate the role of these transcription factors in KSHV lytic antigen expression and p62/SQSTM1 up-regulation, we performed HSF1 or NRF2 silencing by using specific siRNA. As shown in Figure 7A,B, HSF1 and NRF2 knocking-down reduced both p62/SQSTM1 and K-bZIP expression in TB- and BZ-treated cells. The results confirmed the reduction of the percentage of K-bZIP-positive cells in NRF2 and HSF1 silenced cells undergoing TB or BZ treatment (Figure 7C). Considered together, these results indicate that the main mediators of cellular responses to stress, HSF1 and NRF2, and their target p62/SQSTM1, played a role in the induction of KSHV lytic antigen expression induced by TB or BZ in PEL cells. Notably, p62/SQSTM1 siRNA reduced NRF2 expression (Figure 7D), in agreement with previous studies indicating that a positive feedback loop between the two molecules may occur [28,29,30].
Figure 6
HSF1 and NRF2 inhibition counteracts the KSHV lytic cycle induced by TB and BZ in PEL cells. (A) and (C): HSF1 and NRF2 activity was inhibited in a time-course assay by I-HSF1 (KRIBB11) or I-NRF2 (brusatol), as revealed by HSP70 or NRF2 expression evaluated by western blotting analysis. β-Actin was used as a loading control. Densitometric analysis was performed using Image J software and the ratio of HSP70 or NRF2 versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of three independent experiments. (B) and (D): K-bZIP lytic antigen and p62/SQSTM1 expression in TB- or BZ-treated PEL cells in the presence or absence of HSF1 (5 µM) or NRF2 (5 nM) inhibitors (I-HSF1 and I-NRF2) was analyzed by western blotting after 24 h of treatment. Densitometric analysis was performed using Image J software and the ratio of K-bZIP or p62/SQSTM1 versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of three independent experiments. p* < 0.05 (TB/I-HSF1 or I-NRF2 vs TB), p** < 0.05 (BZ/I-HSF1 or I-NRF2 vs BZ).
Figure 7
HSF1 and NRF2 RNA interference reduces K-bZIP expression in TB- or BZ-treated PEL cells. (A) HSF1 and (B) NRF2 knocking-down by specific siRNA decreased K-bZIP and p62/SQSTM1 expression in BCBL1 treated with TB or BZ. Densitometric analysis was performed using Image J software and the ratio of K-bZIP, HSF1, NRF2 or SQSTM1 versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of at least three independent experiments. p* < 0.05 (siRNA HSF1 or siRNA NRF2 vs siRNA SC), p** < 0.05 (siRNA HSF1 or siRNA NRF2 vs siRNA SC, TB-treated) and p*** < 0.05 (siRNA HSF1 or siRNA NRF2 vs siRNA SC, BZ-treated). (C) Immunofluorescence analysis of K-bZIP expression (red) in HSF1 and NRF2 knocked-down cells treated for 24 h with TB or BZ. DAPI was used to stain nuclei (blue). Percentage of K-bZIP-positive cells is also indicated. Objective magnification 20×. (D) NRF2 expression in SQSTM1 knocked-down cells, induced to lytic replication by TB or BZ, as evaluated by western blotting. Densitometric analysis was performed using Image J software and the ratio of NRF2 versus β-Actin was calculated. Histograms represent the mean ± standard deviation (SD) of three independent experiments. p** < 0.05 (siRNA SQSTM1 vs siRNA SC, TB-treated), and p*** < 0.05 (siRNA SQSTM1 vs siRNA SC, BZ-treated).
3.6. The Inhibition of HSF1, NRF2 and p62/SQSTM1 (siRNA) Further Increases ROS and Cytotoxicity Induced by TB or BZ in PEL Cells
Since HSF1, NRF2 and p62/SQSTM1 proteins may be activated in the course of oxidative stress, we evaluated the level of intracellular ROS in PEL cells treated with TB or BZ in the presence or absence of HSF1 or NRF2 inhibitors KRIBB11 (I-HSF1) and brusatol (I-NRF2) respectively. SQSTM1 (siRNA) was also evaluated. As shown in Figure 8A, HSF1 and NRF2 inhibitors led to a further increase of ROS level in comparison with TB or BZ single treatments, and similarly, SQSTM1 RNA knocking-down also exerted this effect (Figure 8B), likely due to the positive feedback loop between p62 and NRF2 [28,29]. These results suggest that HSF1, NRF2 and p62/SQSTM1 are required to maintain the ROS increase at a moderate level, allowing KSHV lytic cycle activation in TB- or BZ-treated PEL cells. Indeed, when ROS level further increased by the combination of TB or BZ with SQSTM1 silencing, HSF1 or NRF2 inhibition, the cytotoxicity increased (Figure 8C,D) and likely rendered the cellular environment unsuitable for viral replication. This hypothesis was confirmed by the findings that NAC supplementation rescued the ability of TB to activate KSHV p64 lytic antigen expression (Figure 8E) and to induce viral release (Figure 8F) in the presence of HSF1 inhibitor. Conversely, the addition of H2O2 to TB reduced KSHV late lytic expression (Figure 8G), further highlighting that the ROS level is critical for virus replication.
Figure 8
HSF1, NRF2 and SQSTM1 inhibition increases endogenous ROS and decreases PEL cell viability in TB- and BZ-treated PEL cells. (A) Intracellular ROS in the BC3 cell line treated with or without HSF1 and NRF2 inhibitors in the presence of TB or BZ. Flow-cytometric analysis was performed to measure ROS using DCFDA staining after 6 h of treatment. The mean of fluorescence intensity is indicated and one representative experiment out of three is shown. (B) Intracellular ROS in BC3 cells SQSTM1 knocked-down during treatment with TB or BZ for 6 h. (C) Cell viability as evaluated by trypan blue exclusion assay in BC3 cell line treated with TB or BZ, with or without I-HSF1 or I-NRF2 inhibitors for 24 h. Data are plotted as histograms showing mean ± standard deviation (SD). p* < 0.05, p** < 0.05. (D) NRF2 expression in p62/SQSTM1 knocked-down PEL cells. siRNASC was used as a control. p* < 0.05, p** < 0.05. (E) gp64 expression of PEL cells treated with TB alone or in combination with HSF1 inhibitor in the presence or absence of NAC. Magnification 20×. (F) KSHV release in the supernatants of BC3 cells treated with TB in the presence or absence HSF1 inhibitor and in the presence or absence of NAC. Histograms represent the KSHV DNA fold increase of treated to untreated control cells. The mean ± standard deviation (SD) calculated by statistical software is shown. p* < 0.05, p** < 0.05. (G) gp64 expression of PEL cells treated with TB in the presence or absence of H2O2. Magnification 20×.
4. Discussion
The results obtained in this study indicate that cytotoxic drugs which increase ROS levels, such as TB and BZ, activate the KSHV lytic cycle, while those that decrease ROS levels, such as MET and Q, although cytotoxic for PEL cells, fail to do so. Therefore, the induction of viral reactivation from latency appears to correlate with the increase or decrease of intracellular ROS, whose role was highlighted by the use of NAC that prevented viral lytic antigen expression in TB- or BZ-treated PEL cells. Previous studies have attempted to investigate which molecular mechanisms could be responsible for lytic cycle activation by some cytotoxic treatments. It has been reported, for example, that the induction of apoptosis is neither necessary nor sufficient to induce gammaherpesvirus replication [25,31,32]. Additionally, autophagy activation, while promoting the replication of gammaherpesviruses such as KSHV and EBV, is not sufficient per se to trigger the replicative process [21,27]. Indeed, as we have previously demonstrated, quercetin (Q) and metformin (MET) are able to activate autophagy in PEL cells [4,5], similar to BZ or TB treatments [2,25].The role of oxidative stress in activating KSHV has been shown by our laboratory and that of others [6,33]. Besides confirming the importance of ROS in reactivating KSHV from latency, this study also suggests that, in order to allow KSHV to reactivate from latency in PEL cells, ROS increases must be kept to moderate levels by HSF1 and NRF2 transcription factors and p62/SQSTM1 [9]. Their pharmacologic or genetic inhibition indeed further increased ROS in comparison to TB or BZ single treatments, likely rendering the cellular environment unsuitable for viral replication. Indeed, the targeting of HSF1 and NRF2, as well as p62/SQSTM1 silencing, enhanced the cytotoxic effect of TB or BZ treatments in PEL cells.It is possible that different levels of ROS determine whether KSHV remains latent or switches to a lytic cycle or no longer replicates. In particular, when the ROS level is low, KSHV continues to remain in a latent state; conversely, when the ROS level slightly increases, the virus may sense the cellular stress and starts replicating before cells will possibly end up dying. Accordingly, a mild ROS increase has been shown to induce a low DNA damage that may lead to the activation of the growth arrest function of wild type p53, through the transcription of p21. Interestingly, the p53–p21 axis has been reported to be essential for KSHV replication [3,8]. However, when the level of ROS is too high, the activation of the pro-apoptotic function p53 may occur [34] and cell death may be induced [35].Regarding BZ, it has been previously reported that it induces an ROS increase in lymphoma cells [36] and induces Endoplasmic Reticulum (ER) stress [37]. We have previously shown that BZ also induced ER stress in PEL cells and that through this effect it activated the autophagic process [2,25]. As stated above, ROS plays a role in activating KSHV replication during several treatments [6,33]. Interestingly, the inhibition of NRF2, the main mediator of the antioxidant response, may reactivate KSHV from latency [13]. However, based on the results obtained in this study, we observed that, in order to activate KSHV replication, the increase of ROS must be kept at a moderate level by HSF1, NRF2 and p62/SQSTM1 (Figure 9). It is a clever strategy for viruses to initiate a lytic replication in cells undergoing mild stress that could possibly increase and lead to a condition in which both cellular and virus survival is no longer guaranteed. The latter event occurs when the level of ROS is too high or, conversely, too low. Indeed, in comparison to normal cells, cancer cells are usually dependent on a higher level of ROS that promotes cell survival by maintaining activated oncogenic pathways, such as PI3K and NF-κB [38]. Accordingly, we have observed MET or Q treatments that reduced ROS and the activation of oncogenic pathways induced PEL cell death [4,5,39].
Figure 9
Schematic model. Interplay between HSF1, NRF2 and p62/SQSTM1 proteins and ROS intracellular production during KSHV replication induced by TB or BZ tratements.
In conclusion, this study suggests that targeting ROS or the pathways that regulate the ROS level, such as NRF2, HSF1 or p62/SQSTM1, could be a promising strategy to increase PEL cell death and concomitantly restrain viral replication induced by cytotoxic drugs such as TB or BZ.
Authors: Maria Saveria Gilardini Montani; Roberta Santarelli; Luca Falcinelli; Roberta Gonnella; Marisa Granato; Livia Di Renzo; Laura Cuomo; Marina Vitillo; Alberto Faggioni; Mara Cirone Journal: J Leukoc Biol Date: 2018-07-24 Impact factor: 4.962
Authors: Giuseppe Balistreri; Johanna Viiliäinen; Mikko Turunen; Raquel Diaz; Lauri Lyly; Pirita Pekkonen; Juha Rantala; Krista Ojala; Grzegorz Sarek; Mari Teesalu; Oxana Denisova; Karita Peltonen; Ilkka Julkunen; Markku Varjosalo; Denis Kainov; Olli Kallioniemi; Marikki Laiho; Jussi Taipale; Sampsa Hautaniemi; Päivi M Ojala Journal: PLoS Pathog Date: 2016-02-18 Impact factor: 6.823
Authors: Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier Journal: Autophagy Date: 2016 Impact factor: 16.016
Authors: Marisa Granato; Maria Anele Romeo; Mariangela Sara Tiano; Roberta Santarelli; Roberta Gonnella; Maria Saveria Gilardini Montani; Alberto Faggioni; Mara Cirone Journal: Sci Rep Date: 2017-10-12 Impact factor: 4.379
Authors: Roberta Gonnella; Roberta Zarrella; Roberta Santarelli; Concetta Anna Germano; Maria Saveria Gilardini Montani; Mara Cirone Journal: Int J Mol Sci Date: 2022-06-17 Impact factor: 6.208
Authors: Joseph A Combs; Chandler H Monk; Mark A A Harrison; Elizabeth B Norton; Cindy A Morris; Deborah E Sullivan; Kevin J Zwezdaryk Journal: Antiviral Res Date: 2021-08-11 Impact factor: 5.970