Literature DB >> 30556505

Protective Effect of Selenium-L-methionine on Radiation-induced Acute Pneumonitis and Lung Fibrosis in Rat.

Peyman Amini1, Sedighe Kolivand2, Hana Saffar3, Saeed Rezapoor1, Elahe Motevaseli4, Masoud Najafi5, Farzad Nouruzi6, Dheyauldeen Shabeeb7,8, Ahmed Eleojo Musa7,9.   

Abstract

BACKGROUND: In this study, we aimed to detect the changes in the level of interleukin (IL)-4 and IL-13 cytokines and their downstream genes including interleukin-13 receptor subunit alpha-2 (IL13Ra2), interleukin-4 receptor subunit alpha-1 (IL4Ra1), dual oxidase 1 (DUOX1) and dual oxidase 2 (DUOX2). The protective effects of Selenium-L-methionine on radiation-induced histopathological damages and changes in the level of these cytokines and genes were detected.
METHODS: Four groups of 20 rats (5 rats in each) namely, control; Selenium-L-methionine, radiation and radiation plus Selenium-L-methionine were used in this study. 4 mg/kg of Selenium-Lmethionine was administered 1 day before irradiation and five consecutive days after irradiation. Irradiation was done using a dose of 15 Gy 60Co gamma rays at 109 cGy/min. All rats were sacrificed 10 weeks after irradiation for detecting changes in IL-4 and IL-13 cytokines, the expressions of IL13Ra2, IL4Ra1, Duox1 and Duox2 and histopathological changes.
RESULTS: The level of IL-4 but not IL-13 increased after irradiation. This was associated with increased expression of IL4Ra1, Duox1 and Duox2, in addition to changes in morphological properties. Selenium-L-methionine could attenuate all injury markers following lung irradiation.
CONCLUSION: Selenium-L-methionine can protect lung tissues against toxic effects of ionizing radiation. It is possible that the modulation of immune responses and redox interactions are involved in the radioprotective effect of this agent. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.

Entities:  

Keywords:  IL-4. IL-13; Selenium-L-methionine; interleukin; lung; pneumonitis; radiation; radiotherapy.

Mesh:

Substances:

Year:  2019        PMID: 30556505      PMCID: PMC7040518          DOI: 10.2174/1574884714666181214101917

Source DB:  PubMed          Journal:  Curr Clin Pharmacol        ISSN: 1574-8847


INTRODUCTION

Protection of lung tissues against toxic effects of radiotherapy or chemotherapy is one of the most studied investigations in experimental studies. The lung is one of the most sensitive organs to ionizing radiation. Although, damages to the lungs during the course of radiotherapy may not cause severe problems, the appearance of the signs of lung toxicity months to years after exposure poses a threat to patients’ life [1]. In addition to clinical implications in cancer radiotherapy, lung injury is one of the most dangerous consequences of exposure to external or internal radiation during a nuclear or radiation disaster [2]. The major side effects of radiotherapy in the lungs are pneumonitis and fibrosis. Pneumonitis occurs due to acute upregulation of inflammatory mediators and cytokines while fibrosis appears following long-term T2-helper cytokines such as interleukin (IL)-4, IL-13, transforming growth factor beta (TGF-β) as well as some growth factors like platelet-derived growth factor (PDGF) [3, 4]. Experimental studies have shown that exposure to radiation can lead to oxidative DNA damage in both nucleus and mitochondria. If cells cannot repair DNA damages, it may lead to cell death mainly through apoptosis, mitotic catastrophe and necrosis. Apoptosis and necrosis stimulate the immune system, leading to an increased level of cytokines and chemokines, as well as immune mediators and transcription factors [5]. In response to apoptosis, macrophages release tolerogenic cytokines such as IL-4, IL-10, IL-13, and TGF-β while necrosis which is more obvious following higher doses of radiation induces inflammatory responses. Danger alarms like oxidized DNA and other products of necrosis induce upregulation of toll-like receptors (TLRs), transcription factors, inflammatory mediators and cytokines [6]. Both inflammatory and anti-inflammatory cytokines are able to induce reduction/oxidation (redox) interactions and amplify oxidative injury by ionizing radiation [7, 8]. Chronic oxidative stress by redox mediators stimulates edema and collagen deposition, dramatic upregulation of inflammatory and anti-inflammatory cytokines as well as prostaglandins in a positive feedback loop [9]. These changes disrupt normal lung action months to years after exposure to a high dose of ionizing radiation [10]. With regard to the mechanisms of lung injury following exposure to radiation, several studies have been conducted to alleviate radiation toxicity in this organ. Targeting of immune system mediators by inhibition of cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), renin-angiotensin system, as well as cytokines such as IL-4, IL-13 and TGF-β has shown promising results [11, 12]. Moreover, suppression of chronic oxidative stress by targeting pro-oxidant enzymes such as NADPH oxidase and mitochondria can ameliorate late effects of radiation to the lung [13]. NADPH oxidase comprises five subfamilies which include NADPH oxidase 1-5 (NOX1-5) and dual oxidase 1 and 2 (Duox1&2) [14]. Duox1 and Duox2 are usually identified in thyroid cells. These enzymes through the production of H2O2 stimulate the production of thyroid hormones [15]. It is known that both IL-4 and IL-13 play key roles in late effects of radiation-induced lung injury [16]. On the other hand, some studies have shown that increased levels of IL-4 and IL-13 play key roles in stimulating continuous production of free radicals following exposure to radiation. A study by Hassani et al. showed that IL-4 and IL-13, through upregulation of interleukin-13 receptor subunit alpha-2 (IL13Ra2) and interleukin-4 receptor subunit alpha-1 (IL4Ra1) lead to the stimulation of Duox2 and Duox1 as well as chronic production of H2O2 and damage thyroid cells [17]. IL13Ra2 is able to upregulate Duox1, while IL4Ra1 can induce upregulation of both Duox1 and Duox2 [18]. This study proposed that attenuation of these genes can help mitigate radiation injury and chronic oxidative damage. Modulation of NADPH oxidase enzymes such as Duox1 and Duox2 has been proposed for suppressing redox interactions, inflammatory responses and fibrosis [8, 19, 20]. Selenium-L-methionine can be incorporated into proteins containing methionine, without any detrimental effects on the functions of proteins. Free selenium can also be used for the development of selenocysteine, an amino acid that plays a key role in stimulating antioxidant enzymes such as superoxide dismutase (SOD), thioredoxin reductase (TR), glutathione peroxidases (GPx), and others [21]. In addition to neutralization of free radicals by these antioxidant enzymes, methionine itself is able to scavenge ROS via its sulfur, and also act as a metal chelator [22]. Selenium-L-methionine is a potent antioxidant that has shown interesting radioprotective and mitigatory effects. In recent years, it has shown the ability to mitigate radiation-induced hematopoietic and gastrointestinal injury as well as nephrotoxicity in animal models [23, 24]. In the present study, our aim was to assess changes in the regulation of IL-4, IL-13, IL4Ra1, IL13Ra2, Duox2 and Duox1 following local chest irradiation of rats, in addition to evaluating the modulatory effects of Selenium-L-methionine on these genes and its radioprotective effect on inflammatory and fibrosis markers.

MATERIALS AND METHODS

Irradiation and Treatment with Selenium-L-methionine

Selenium-L-methionine, purchased from Sigma Aldrich company (USA) was dissolved in distilled water at a concentration of 0.8 mg/ml. Intraperitoneal injection of Selenium-L-methionine at a dose of 4 mg/kg (1 ml for each rat) was administered to the rats 1 day before and five consecutive days after irradiation. This dose of Selenium-L-methionine was chosen based on a previous study [25]. On the day of irradiation, 30 minutes before commencement, Selenium-L-methionine was injected to each rat followed by anesthesia using a combination of ketamine and xylazine. The rats were positioned supine on the table of a 60Co gamma rays source. Irradiation of 15 Gy was performed using a 60Co source (1.25Mev) at a dose rate of 109 cGy/min and a source to skin distance of 60 cm. This radiation dose was selected similar to previous studies [26, 27].

Experimental Design

Twenty male Wistar rats weighing 200±20 g were provided from Razi Institute, Tehran, Iran. All rats were kept under standard humidity and temperature (55% and 220C, respectively) at Pharmacy Animal Laboratory, Tehran University of Medical Sciences, Tehran, Iran. All rats were divided into 4 groups (5 rats in each) namely: control; Selenium-L-methionine treatment; radiation; and radiation plus Selenium-L-methionine. 10 weeks after irradiation, all rats were sacrificed using spinal dislocation followed by removal of lung tissues. The lower parts of their left lungs were fixed in 10% normal buffer formalin while their right lungs were frozen for ELISA assay and real-time PCR.

Histopathological Evaluation

The fixed lung samples were embedded in paraffin blocks. Afterward, tissue samples were cut into 5-micron sizes and placed on the slides. For evaluating the usual histological changes caused by radiation such as infiltration of inflammatory cells, edema, as well as damages to alveolar and vascular, the slides were stained with hematoxylin and eosin (H&E). For the evaluation of collagen deposition as a marker of fibrosis, other slides were provided and stained with Masson’s trichrome. Slides were evaluated by a pathologist with the aid of a light microscope. The severity of histological changes was scored from 0 to 3, while fibrosis was reported as absent, mild and severe.

Real-time PCR

Total RNA was extracted from lung cells after homogenization in TRIzol reagent (RiboExTM, GeneAll, South Korea). The cDNA was generated using cDNA Synthesis Kits (GeneAll, South Korea) via a thermocycler. The expression of each gene was detected using Applied Biosystems real-time PCR (USA). The sequence of each primer was designed using Gene Runner and NCBI Blast. GAPDH was chosen as an internal control primer. The sequences of confirmed primers are shown in Table .

ELISA

The levels of both IL-4 and IL-13 were detected by ELISA kit provided from Zellbio Company (Gold Biotechnology, Inc, Germany). The complete protocol was carried out based on the manufacturer’s instruction. Colorimetric kit results were converted into pictogram per milliliter (pg/ml) and reported.

Statistical Analysis

All statistical analyses were done using SPSS software (version 16). Pathological results were analyzed using the Mann-Whitney test. The significance of changes in the expression of genes reported by real-time PCR was analyzed using T-Test. Finally, ELISA results were analyzed by one-way ANOVA and Tukey's HSD post HOC with P values <0.05 considered statistically significant.

RESULTS

Pathological studies with H&E stained slides showed a severe increase in infiltration of macrophages and lymphocytes as well as damages to vascular and alveolar in the radiation group compared to the control group. Moreover, trichrome slides showed a mild accumulation of collagen following irradiation, compared to control. Treatment with Selenium-L-methionine led to significant alleviation of all mentioned parameters Figs. ()-(). QPCR results showed that when rats were irradiated with 15 Gy gamma rays, the level of IL4Ra1 increased significantly (4.9±1.3) compared to the control group (p<0.05). Treatment with Selenium-L-methionine could significantly reduce the expression of IL4Ra1 (1.78±0.51) (p<0.05). However, when rats were treated with only Selenium-L-methionine, the level of IL4Ra1 did not show any significant change (1.12±0.54). Lung tissue irradiation caused an 8.37±1.37-fold increase in the expression of Duox1 compared to control group (p<0.05). Treatment with only Selenium-L-methionine did not change the expression of Duox1 (1.40±24) while in administering Selenium-L-methionine with radiation, the expression of Duox1 reduced significantly (4.2±0.76) compared to radiation alone (p<0.05). Similar to IL4Ra1 and Duox1, the expression of Duox2 was upregulated following irradiation and attenuated when rats were treated with Selenium-L-methionine before and after irradiation. Results showed a 5.87±2-fold increase in the expression of Duox2 following irradiation while Selenium-L-methionine reduced it to 2.26±0.64-fold (p<0.05). Treatment with only Selenium-L-methionine did not cause any change in the expression of Duox2 (1.02±0.36) Fig. (). Results of enzyme immunoassay of cytokines showed that irradiation with gamma rays led to a significant increase in the level of IL-4 (633±48) compared to the basal level of this cytokine in the control group (422±71) (p<0.05). When rats were treated with Selenium-L-methionine before and after exposure to gamma rays, the level of this cytokine decreased significantly (468±44) (p<0.05). Treatment with only Selenium-L-methionine did not cause any significant increase or decrease in IL-4 compared to control group (477±49). ELISA assay results for IL-13 showed no significant change in the level of this cytokine following irradiation (215±3) compared to control (223±8). Also, treatment with only Selenium-L-methionine (237±5) before and after irradiation (243±14) had no significant change in the level of IL-13 Fig. ().

DISCUSSION

As previously mentioned, lung toxicity is a major side effect for chest cancer patients who underwent radiotherapy or chemo/radiation therapy. In addition, lung injury may appear in patients who had been exposed to whole body irradiation for bone marrow transplantation. Development of some mitigators for preventing death due to radiation-induced lung injury in an accidental nuclear disaster has been on the increase in recent years. Knowledge about the mechanisms of radiation-induced pneumonitis or fibrosis can improve the management of these side effects. For example, dramatic upregulation of renin-angiotensin system in lung tissue following exposure to radiation can be modulated by captopril, leading to attenuation of lung toxicity and increased survival in animal models. Some studies have proposed antioxidants such as genistein, hesperidin, melatonin, superoxide dismutase-catalase mimetic (EUK-207) etc. [13, 28, 29]. Selenium-L-methionine is a potent antioxidant that has shown interesting properties for protection and mitigation of radiation injury [30]. It has shown the ability to protect against micronuclei formation in bone marrow and also mitigate radiation injury in hematopoietic and gastrointestinal system as well as alleviating nephropathy [23, 31-33]. These studies may indicate the important roles of inflammatory reaction and redox system in late effects of ionizing radiation in lung tissues. Studies have proposed the involvement of a large number of cytokines and pro-oxidants in radiation-induced lung pneumonitis and fibrosis. It has been confirmed that chronic upregulation of some subfamilies of NADPH oxidase genes such as NOX1, NOX4 and NOX5 is involved in the continuous production of free radicals, genomic instability as well as lung injury [34, 35]. Duox1 and Duox2 are other subfamilies of NADPH oxidase that are involved in oxidative injury induced by some agents such as ionizing radiation [36]. Studies have shown that exposure to ionizing radiation leads to massive oxidative injury, DNA break and cell death. The release of cell contents such as oxidized DNA, apoptotic bodies and necrotic products like high mobility group box 1 (HMGB1) lead to the activation of immune responses by macrophages and lymphocytes. In response to these danger alarms, macrophages, dendritic cells and lymphocytes trigger the release of several pro-inflammatory and pro-fibrotic cytokines such as IL-1, IL-2, IL-4, IL-6, IL-8, IL-10, IL-13, IL-18, IL-33, TNF-α, TGF-β and IFN-γ. Evidences have shown that chronic upregulation of some cytokines such as IL-1, IL-4, IL-10, IL-13, and TGF-β cause continuous production of prostaglandins, free radicals, etc., which mediate inflammation and fibrosis induction from months to years after exposure to radiation [37]. For example, TGF-β upregulates the expression of NOX1, NOX2, NOX4, NOX5, COX-2 and iNOS, leading to chronic oxidative injury, cell senescence, genomic instability and fibrosis [38]. IL-4 and IL-13 stimulate the upregulation of Duox1 and Duox2 via stimulation of some pathways such as JAK1-STAT6 cascade, STAT1, p38MAPK, etc. [39, 40]. Moreover, IFN-γ may induce upregulation of Duox2 through STAT-1 [41]. In the present study, we aimed to detect changes in the levels of IL-4 and IL-13; two potent pro-fibrotic cytokines, following local lung irradiation. Also, we evaluated changes in the expression of their downstream genes such as IL4Ra1, IL13Ra2, Duox1 and Duox2. The modulatory effect of Selenium-L-methionine on these parameters associated with histopathological changes was observed. Results of this study showed that irradiation of lung tissues led to an increase in the level of IL-4 but not IL-13. Also, the expression of IL13Ra2 was not detected. Results showed that the expression of IL4Ra1, Duox1 and Duox2 increased following lung irradiation. As earlier mentioned, IL4Ra1 can upregulate both Duox1 and Duox2. It is possible that IL-4, through upregulation of IL4Ra1, plays a key role in the increased expressions of Duox1 and Duox2, while IL-13 and IL-13Ra2 do not have this effect. However, some other pathways such as IFN-γ may be involved in the upregulation of these pro-oxidant genes. Moreover, treatment with Selenium-L-methionine reduced the expression of all of them. These results were associated with infiltration of macrophages, lymphocytes, fibrosis as well as vascular and alveolar thickening following irradiation and amelioration of them when rats were treated with Selenium-L-methionine. Selenium-L-methionine was able to reverse vascular and alveolar thickening as well as fibrosis completely. Selenium-L-methionine, as well as selenium alone, has shown abilities to potently mitigate radiation injury via modulating chronic production of free radicals. The inhibition of redox reactions may play a key role in the radioprotective effects of Selenium-L-methionine. Upregulation of antioxidant enzymes by selenium as well as direct chelating of ROS by methionine can alleviate radiation-induced DNA damage and cell death. Previous studies confirmed potent antioxidant effects, as well as stimulatory effects on antioxidant enzymes [42]. These are associated with attenuation, leading to the release of pro-inflammatory and pro-fibrotic cytokines, which reduce redox activity and chronic free radicals’ production by pro-oxidant enzymes. Further studies are needed to illustrate the possible antioxidant role of Selenium-L-methionine on lung tissues following exposure to ionizing radiation. The suppression of pro-oxidant enzymes such as Duox1 and Duox2 is involved in the radioprotective property of Selenium-L-methionine.

CONCLUSION

This study showed upregulation of IL-4Duox2 pathways after irradiation of rats’ lungs. Also, results indicated an increased level of Duox1 without upregulation of IL-13. Selenium-L-methionine could reduce the increased level of IL-4 and attenuate the upregulation of IL4Ra1, Duox1 and Duox2. Moreover, the administration of Selenium-L-methionine attenuated the infiltration of macrophages and lymphocytes. It reversed vascular and alveolar thickening as well as fibrosis. These results may be an indication that Selenium-L-methionine can be proposed for protection against radiation-induced lung toxicity. The suppression of chronic oxidative stress, mediated by some pro-oxidant enzymes such as Duox1 and Duox2 is involved in radioprotective property of Selenium-L-methionine.
Table 1

The sequences of primers for Real-time PCR.

Gene Forward Sequence Reverse Sequence
IL-4R1GAGTGAGTGGAGTCCCAGCATCGCTGAAGTAACAGGTCAGGC
IL- 13Ra2TCGTGTTAGCGGATGGGGATGCCTGGAAGCCTGGATCTCTA
Duox1AAGAAAGGAAGCATCAACACCCACCAGGGCAGTCAGGAAGAT
Duox2AGTCTCATTCCTCACCCGGAGTAACACACACGATGTGGCG
GAPDHAGTGCCAGCCTCGTCTCATAATGAAGGGGTCGTTGATGGC
  39 in total

Review 1.  Melatonin and cancer: From the promotion of genomic stability to use in cancer treatment.

Authors:  Bagher Farhood; Nasser Hashemi Goradel; Keywan Mortezaee; Neda Khanlarkhani; Masoud Najafi; Amirhossein Sahebkar
Journal:  J Cell Physiol       Date:  2018-09-21       Impact factor: 6.384

Review 2.  Targeting of Inflammation for Radiation Protection and Mitigation.

Authors:  Rasoul Yahyapour; Peyman Amini; Saeed Rezapoor; Abolhasan Rezaeyan; Bagher Farhood; Mohsen Cheki; Hengameh Fallah; Masoud Najafi
Journal:  Curr Mol Pharmacol       Date:  2018       Impact factor: 3.339

3.  Radioprotection by metals: selenium.

Authors:  J F Weiss; V Srinivasan; K S Kumar; M R Landauer
Journal:  Adv Space Res       Date:  1992       Impact factor: 2.152

4.  Up-regulation and sustained activation of Stat1 are essential for interferon-gamma (IFN-gamma)-induced dual oxidase 2 (Duox2) and dual oxidase A2 (DuoxA2) expression in human pancreatic cancer cell lines.

Authors:  Yongzhong Wu; Smitha Antony; Agnes Juhasz; Jiamo Lu; Yun Ge; Guojian Jiang; Krishnendu Roy; James H Doroshow
Journal:  J Biol Chem       Date:  2011-02-14       Impact factor: 5.157

5.  High-dose selenium for the mitigation of radiation injury: a pilot study in a rat model.

Authors:  Fritz Sieber; Sarah A Muir; Eric P Cohen; Paula E North; Brian L Fish; Amy A Irving; Marylou Mäder; John E Moulder
Journal:  Radiat Res       Date:  2009-03       Impact factor: 2.841

6.  Portrait of inflammatory response to ionizing radiation treatment.

Authors:  Federica Maria Di Maggio; Luigi Minafra; Giusi Irma Forte; Francesco Paolo Cammarata; Domenico Lio; Cristina Messa; Maria Carla Gilardi; Valentina Bravatà
Journal:  J Inflamm (Lond)       Date:  2015-02-18       Impact factor: 4.981

7.  Effects of NOX1 on fibroblastic changes of endothelial cells in radiation‑induced pulmonary fibrosis.

Authors:  Seo-Hyun Choi; Miseon Kim; Hae-June Lee; Eun-Ho Kim; Chun-Ho Kim; Yoon-Jin Lee
Journal:  Mol Med Rep       Date:  2016-04-05       Impact factor: 2.952

8.  Evaluating Radioprotective Effect of Hesperidin on Acute Radiation Damage in the Lung Tissue of Rats.

Authors:  A Rezaeyan; R Fardid; G H Haddadi; M A Takhshid; M Hosseinzadeh; M Najafi; A Salajegheh
Journal:  J Biomed Phys Eng       Date:  2016-09-01

Review 9.  Radiation-induced inflammation and autoimmune diseases.

Authors:  Rasoul Yahyapour; Peyman Amini; Saeed Rezapour; Mohsen Cheki; Abolhasan Rezaeyan; Bagher Farhood; Dheyauldeen Shabeeb; Ahmed Eleojo Musa; Hengameh Fallah; Masoud Najafi
Journal:  Mil Med Res       Date:  2018-03-20

10.  Metformin Protects Against Radiation-Induced Heart Injury and Attenuates the Upregulation of Dual Oxidase Genes Following Rat's Chest Irradiation.

Authors:  Rasoul Yahyapour; Peyman Amini; Hana Saffar; Saeed Rezapoor; Elahe Motevaseli; Mohsen Cheki; Bagher Farhood; Farzad Nouruzi; Dheyauldeen Shabeeb; Ahmed Eleojo Musa; Masoud Najafi
Journal:  Int J Mol Cell Med       Date:  2018-10-21
View more
  6 in total

1.  The radioprotective effect of N-acetylcysteine against x-radiation-induced renal injury in rats.

Authors:  Tolga Mercantepe; Atilla Topcu; Sema Rakici; Levent Tumkaya; Adnan Yilmaz; Filiz Mercantepe
Journal:  Environ Sci Pollut Res Int       Date:  2019-08-07       Impact factor: 4.223

2.  Proteomic Evaluation of the Natural History of the Acute Radiation Syndrome of the Gastrointestinal Tract in a Non-human Primate Model of Partial-body Irradiation with Minimal Bone Marrow Sparing Includes Dysregulation of the Retinoid Pathway.

Authors:  Weiliang Huang; Jianshi Yu; Tian Liu; Gregory Tudor; Amy E Defnet; Stephanie Zalesak; Praveen Kumar; Catherine Booth; Ann M Farese; Thomas J MacVittie; Maureen A Kane
Journal:  Health Phys       Date:  2020-11       Impact factor: 2.922

3.  Shashen-Maidong Decoction-Mediated IFN-γ and IL-4 on the Regulation of Th1/Th2 Imbalance in RP Rats.

Authors:  Yuan Yang; Yanping Zhou
Journal:  Biomed Res Int       Date:  2019-06-24       Impact factor: 3.411

4.  Radioprotective Effects of Zinc and Selenium on Mice Spermatogenesis.

Authors:  Bagheri H; Salajegheh A; Javadi A; Amini P; Shekarchi B; Shabeeb D; Eleojo Musa A; Najafi M
Journal:  J Biomed Phys Eng       Date:  2020-12-01

Review 5.  Immunomodulatory and Anti-Inflammatory Properties of Selenium-Containing Agents: Their Role in the Regulation of Defense Mechanisms against COVID-19.

Authors:  Valentina N Mal'tseva; Michael V Goltyaev; Egor A Turovsky; Elena G Varlamova
Journal:  Int J Mol Sci       Date:  2022-02-21       Impact factor: 5.923

Review 6.  Radiation-Induced Normal Tissue Damage: Oxidative Stress and Epigenetic Mechanisms.

Authors:  Jinlong Wei; Bin Wang; Huanhuan Wang; Lingbin Meng; Qin Zhao; Xinyu Li; Ying Xin; Xin Jiang
Journal:  Oxid Med Cell Longev       Date:  2019-11-12       Impact factor: 6.543

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.