Cisplatin-Loaded Graphene Oxide/Chitosan/Hydroxyapatite Composite as a Promising Tool for Osteosarcoma-Affected Bone Regeneration.

Presently, tissue engineering approaches have been focused toward finding new potential scaffolds with osteoconductivity on bone-disease-affected cells. This work focused on the cisplatin (CDDP)-loaded graphene oxide (GO)/hydroxyapatite (HAP)/chitosan (CS) composite for enhancing the growth of osteoblast cells and prevent the development of osteosarcoma cells. The prepared composites were characterized for the confirmation of composite formation using Fourier transform infrared spectroscopy, scanning electron microscopy, transmission electron microscopy, and X-ray diffraction techniques. A flowerlike morphology was observed for the GO/HAP/CS-3/CDDP composite. UV-vis spectroscopy was used to observe the controlled release of CDDP from the GO/HAP/CS-3/CDDP composite, and 67.34% of CDDP was released from the composite over a time period of 10 days. The GO/HAP/CS-3/CDDP nanocomposites showed higher viability in comparison with GO/HAP/CS-3 on MG63 osteoblast-like cells and higher cytotoxicity against cancer cells (A549). The synthesized composite was found to show enhanced proliferative, adhesive, and osteoinductive effects on the alkaline phosphatase activity of osteoblast-like cells. Our results suggested that the CDDP-loaded GO/HAP/CS-3 nanocomposite has an immense prospective as a bone tissue replacement in the bone-cancer-affected tissues.

Introduction

Phosphates of calcium are of immense impact due to their astonishing biocompatibility and bioactivity making them useful in biomedicine fields analogous to orthopedics, drug delivery, and dentistry. Among the calcium phosphate compounds, hydroxyapatite (HAP) is the most valuable one because of its potential use in bone tissue engineering and also because it exhibits excellent osteoinductivity.[1] The relevance of HAP in load-bearing implants is constrained because of the typical fragility with small fracture toughness.[2] Generally, HAP can be combined with different varieties of natural polymers, synthetic polymers, and graphene family materials.[3]

The graphene family nanomaterials include several graphene derivatives, such as few-layered graphene, graphene oxide (GO), reduced graphene oxide, ultrathin graphite, and graphene nanosheets that were used in various biomedical applications.[3] These all differ from each other in terms of surface properties, number of layers, and size. GO enhances or alters the required properties for a specific application. Nanosheets of GO is an attractive nanomaterial, which have two-dimensional property, mechanical potency, biocompatibility, quickly accumulated curiosity in the biomedical and pharmaceutical fields,[4] potential release vehicles for drugs, biological macromolecules cellular coloring agents and implantable tissues.[5,6] Current studies signify that the inclusion of GO could substantially provide mechanical strength to GO-related composites[7,8] and also that GO might endorse the adhesion of osteoblasts and propagation of osteoblast activity.[9,10] The concern of promoting apatite nucleation strength opens up a further advantage of GO in HAP-based composite preparation.[11]

Recently, chitosan (CS) has found diversity of applications such as in drug delivery, food packaging, forming a membrane for separation, environmental applications, and tissue engineering for admissible improvement of the bone graft materials.[12] CS possesses a lot of superior biomedical properties such as anti-inflammatory and antimicrobial properties, biocompatibility, biodegradability, nonantigenicity, osteoconductivity, and nontoxicity.[13,14] Moreover, for the CS molecule to be used as a structural sustainer in tissue regeneration, it should have sufficient surface area to accommodate live cells effectively; the CS structure allows appropriate transport of nutrients for cell growth. Its chemical structure possesses the ability to regenerate primary tissue cells.[15,16] In tissue engineering, CS and HAP composites have the ability to promote a great proliferative activity in osteoblasts.[17] A vastly permeable, three-dimensional structure is significant for tissue engineering materials for replicating the extracellular matrix (ECM) to set a proper microenvironment for cell attachment and propagation.[18,19] Among these materials, GO, HAP, and CS are generally chosen because of the effectual functional features such as their bone-resembling properties, which can successfully encourage osteoblast enlargement, stimulate mineralization of osteoid, and suppress the osteosarcoma (OS) cells.[20]

In this study, we evaluate the impact of anticancer drug cisplatin (CDDP) loaded on CS-functionalized HAP on a GO platform composite on bone formation during bone repair in osteosarcoma (OS).[21,22] OS is a greatly malignant mesenchymal cancer of bone in which the malignant cells create osteoid. Among all available chemotherapeutic agents, anthracycline and platinum-based drugs are used most commonly, and particularly CDDP is solitary of the mainly effectual anticancer agents for reducing the feasible cell quantity.[23] This action could lead to the CDDP-induced cell death along with cell propagation reticence.

Results and Discussion

Fourier Transform Infrared (FTIR) Analysis

Figure A,a shows the absorption bands at 473, 565, 602, 963, 1035, and 1098 cm–1, which are the distinguishing peaks of a PO43– group. The small peak at 473 cm–1 is ascribed to the ν2 bending vibration of the PO43– group. The triply degenerated ν4 bending vibrations appeared as the peaks at 565 and 602 cm–1. The band at 963 cm–1 corresponds to ν1, whereas the ν3 vibrations of PO43– ions showed the bands at 1033 and 1098 cm–1. Figure A,b CS polymer N–H and O–H stretching vibration peaks appeared at 1653 and 1635 cm–1, respectively. The spectrum of GO in Figure A,c clearly shows oxygen-possessing groups at 1054, 1223, 1395, 1622, and 1729 cm–1. These correspond to the C–O stretching vibration, C–OH stretching vibration, C–O–H deformation vibration, C–C stretching vibration, and CO stretching vibration of COOH groups.[24] Meanwhile, the spectra of the GO/HAP composite in Figure A,d confirmed the presence of graphene oxide sheets by the emergence of clear absorption bands of methylene (CH2) groups nearly around 2854 and 2918 cm–1. The stretching band of pure HAP peaks shifted from 1035 to 1029 cm–1 (Figure A,d) due to the interaction of HAP with GO. This indicates the formation of strong hydrogen bonding between the HAP and GO sheets.[25−28] In addition, the GO/HAP/CS composite, as revealed in Figure A,e–g, suggests that there is no observable variation in the three compositions following CS functionalization. However, a C=O absorption peak at 1654 cm–1 in CS shifted toward a lower region at 1621 cm–1 in the n-HA/CS/GO composite, which was due to the synergistic effects of hydrogen bonding between the CS and GO/HAP; also, the peak of −NH2 (1598 cm–1) did not appear, which may be due to the development of −NH3+. The peak of asymmetry stretching of −COO– was present at ∼1420 cm–1. These annotations stress upon the fact that there is a presence of electrostatic interaction between −COO– of GO and −NH3+ of CS, which resulted in the creation of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 networks with the inclusion of HAP compound in Figure A,e–g. The FTIR spectrum of the CDDP composite exhibits only a peak in array of the corresponding CDDP characteristic peaks at 799, 1305, 1540, and 1651 cm–1 being visible in CDDP loaded in the GO/HAP/CS-3 composite was confirmed. The broadness of the peak is 3200–3300 cm–1 due to the intermolecular hydrogen bonding between the CDDP and GO/HAP/CS-3 composite. This is due to the electrostatic interaction between CDDP and the polymer matrix. In the spectrum of CS, there are two characteristic absorbance bands centered at 1653 and 1596 cm–1, which correspond to the C=O stretching vibration of −NHCO– and the N–H bending of −NH2, respectively. Compared with those of pure CS and GO, both peaks at 1596 cm–1 related to −NH2 absorbance vibration and at 1730 cm–1 belonging to the C=O stretch of the carboxylic group disappear in the spectra of CS/GO nanocomposites. Moreover, the band corresponding to the C=O characteristic stretching of the amide group shifts to a lower wavenumber, which could be ascribed to the synergistic effect of hydrogen bonding between CS and the oxygenated groups in GO and electrostatic interaction between polycationic CS and the negative charge on the surface of GO in the GO/HAP/CS composite. The transmittance percentage decreased with an increasing in the wt % of CS, as shown in Figure B,e–g.

Figure 1

FTIR spectra of (A) (a) HAP, (b) CS, (c) GO, (d) GO/HAP, (e) GO/HAP/CS-1, (f) GO/HAP/CS-2, (g) GO/HAP/CS-3, and (h) GO/HAP/CS-3/CDDP composites. (B, C) Zoomed FTIR region with wavenumbers 1200–1800 and 3200–3800 cm–1.

X-ray Diffraction (XRD)

The main peaks of HAP were formed at 26, 31.6, 32.92, 35.7, 40, 46.74, and 54.10°, which could be indexed to the (002), (211), (112), (300), (202), (222), and (213) lattice planes of the hexagonal HAP, respectively, as shown in Figure A,a. This demonstrates that diffraction is stronger than the standard diffraction pattern (JCPDS card no. 09-0432). The broad diffraction peaks at 2θ = 9.5 and 19.5° indicate the XRD spectrum of CS, as shown in Figure A,b. GO flakes showed a diffraction peak at 10.9° (Figure A,c). The XRD pattern of GO/HAP shows characteristic diffraction peaks at 2θ = 25.7, 28.79, 32.34, and 39.9° constant with the XRD pattern of pure HAP shown in Figure A,d. Typical peaks of CS around 2θ values of 11.3, 18.2, and 23° can be clearly seen from Figure A,e–g. The two primary peaks of CS and GO resembled the hydrated crystalline arrangement. The broadened peak at around 23° indicates the extension of the amorphous nature.[30,31] In our case, together the hydrogen bonding and electrostatic interaction may have contributed toward a reasonably ordered array of CS chains along the rigid template offered by GO, Figure B,e–g.[29] The two characteristic peaks of CDDP were observed at 2θ about 15 and 20°, as shown in Figure B,h. After incorporation of the CS matrix into GO/HAP, the XRD pattern of the GO/HAP/CS nanocomposite shows only the CS diffraction peaks, and the peak of GO disappears from the diffraction pattern of GO/HAP/CS (Figure A), which clearly demonstrates the formation of GO sheets in the composite CS polymer matrix and the disappearance of the regular and periodic structure of graphene oxide.[30] It is noticed that incorporation of CS less than 30 wt % to GO/HAP slightly increases the intensity of the characteristic peaks of CS. However, the intensity of the characteristic peaks of CS obviously increases in the GO/HAP/CS composites, and characteristic peaks of CS at around (2θ) 8.4, 11.3, 18.2, and 23° can be clearly seen from Figure B. The first two peaks correspond to the hydrated crystalline structure, whereas the broadened peak at about 23° indicates the existence of an amorphous structure.

Figure 2

(A) XRD spectra of (a) HAP, (b) CS, (c) GO, (d) GO/HAP, (e) GO/HAP/CS-1, (f) GO/HAP/CS-2, (g) GO/HAP/CS-3, and (h) GO/HAP/CS-3/CDDP composites. (B) Zoomed spectra of composites between 20 and 40°.

Scanning Electron Microscopy (SEM) and Transmission Electron Microscopy (TEM) Morphological Analyses

The surface morphologies of the GO/HAP, GO/HAP/CS, and CDDP-loaded GO/HAP/CS composites were investigated through SEM and TEM technologies and are presented in Figure . The images in Figure a,b indicate that HAP and GO had spherical and sheetlike morphologies, respectively. Figure c represents GO/HAP composites, and it shows the spherical particles of HAP on the GO surface. Figure d–i shows the morphology of the CS-functionalized GO/HAP composites after hydrothermal treatment with the increasing weight percent of CS. After the hydrothermal treatment, HAP from the GO/HAP/CS composite has grown, and the HAP fabricated by the hydrothermal method shows a typical flowerlike porous morphology. HAP spheres are composed of thin flakes with high aspect ratios of CS forming the flowerlike morphology (Figure d–i), which suggests significant difference in the synthesis of the composite biomaterial. The SEM image of the composite indicates unvarying porous morphology. The HAP spheres are composed of thin flakes with high aspect ratios of CS forming the flowerlike morphology, which suggests significant difference in the synthesis of the composite biomaterial. The c-axis-oriented hydroxyapatite surfaces are likely to promote preferentially oriented growth through a cyclic process of dissolution and re-precipitation, followed by homoepitaxial growth. The remarkable morphological and microstructural changes after dissolution suggest the capability of highly textured hydroxyapatite to act as a tissue engineering scaffold with an interconnecting porous network that may be beneficial for cellular activity. Figure j indicates the CDDP-loaded GO/HAP/CS-3 composites. Figure k,m represents the TEM images of the GO/HAP/CS-3 and CDDP-loaded GO/HAP/CS-3 composites. The TEM image of the GO/HAP/CS-3 flakes of flower structures is well correlated with the SEM images of GO/HAP/CS-3 and GO/HAP/CS-3/CDDP. The CDDP-loaded GO/HAP/CS-3 composite SADE spectrum is shown in the inset image of Figure l,n. It shows the amorphous nature of the overall composite.

Figure 3

SEM images of (a) HAP, (b) GO, (c) GO/HAP, (d, g) GO/HAP/CS-1, (e, h) GO/HAP/CS-2, (f, i) GO/HAP/CS-3 and (j) GO/HAP/CS-3/CDDP composites. TEM images of (k) GO/HAP/CS-3 and (m) GO/HAP/CS-3/CDDP; SADE images of (l) GO/HAP/CS-3 and (n) GO/HAP/CS-3/CDDP.

Energy Dispersive X-ray Analysis (EDAX) Mapping

Moreover, an elemental analysis mapping was carried out to recognize the distribution of elements in the composite material. Figure a,b reveals the SEM image and EDAX spectrum of the GO/HAP/CS-3/CDDP composite. From the EDAX mapping analysis, elemental distribution of the GO/HAP/CS-3/CDDP composite is presented in Figure c. Calcium, phosphorus, oxygen, carbon, and nitrogen were found and are shown in Figure d–h in different colors. This confirms that a part of the GO/HAP/CS-3/CDDP composite clearly shows the distribution of C, Ca, O, N, and P elements in the composite. It is thus clear that the GO/HAP/CS-3/CDDP composite has an immense prospective to be used in the progress of new bone formation and bone repair applications due to the presence of HAP, GO, CS, and CDDP.

Figure 4

(a) SEM images of GO/HAP/CS-3/CDDP; (b) EDAX spectrum of GO/HAP/CS-3/CDDP; (c) elemental mapping of GO/HAP/CS-3/CDDP; and (d–h) elements present in GO/HAP/CS-3/CDDP: Ca, P, O, C, and N.

Barrett–Joyner–Halenda (BJH) and Brunauer–Emmett–Teller (BET) Analyses

The pore volume, surface area, and pore diameter of the GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 composites were investigated through BET analysis, and BJH investigation revealed the mesoporous nature of the composite; the results are presented in Table . A distinctive adsorption/desorption graph of the mesosphere is shown in Figure .

Table 1

Average Structural Parameters and Surface Properties of GO/HAP/CS-3 Nanocomposites

composite ID	surface area (m2/g)	pore volume (cm3/g)	pore diameter (nm)
GO/HAP/CS-1	3.8	0.01854	4.489
GO/HAP/CS-2	5.552	0.01926	5.92
GO/HAP/CS-3	5.7887	0.0970	7.1798

Figure 5

BET analysis: (A, C, E) adsorption of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 and (B, D, F) desorption of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3.

CDDP Loading Capacity (LC) and In Vitro CDDP Release Analysis

The aim of this study is self-curing of bone cancer through anticancer-drug-loaded composites. Thus, the investigation of the CDDP loading capacity and CDDP releasing properties of the GO/HAP/CS composite materials is very important in this regard. Figure a–c indicates UV–visible spectra of the CDDP loading capacity of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 after 3 h. Initially, the CDDP absorption peak appearing at the intensity range is nearly zero, and then, for the composites vortexed for 3 h, the intensity increased to almost 0.89, 1.0, and 1.5, respectively. The loading capacities of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 were around 44.7, 50.44, and 78% respectively. The in vitro UV–visible spectra of CDDP from GO/HAP/CS-3/CDDP were performed in phosphate buffer saline (PBS) medium at pH 7.4, and the corresponding discharge report is depicted in Figure d–f. The CDDP release was 84.84, 74.44, and 67.34% over a period of 10 days for the composites GO/HAP/CS-1/CDDP, GO/HAP/CS-2/CDDP, and GO/HAP/CS-3/CDDP. From the releasing profile, it could be understood that GO/HAP/CS-3/CDDP demonstrated the required quantity of drug release, which was observed with a constant releasing rate. This could be partially due to the flake pore geometry of the flowerlike morphology of the composite and the length of drug releases from the GO/HAP/CS-3/CDDP composites. The constant release rate further affirms that the composite can be a potential candidate for curing of cancer diseases as well as proved to be helpful in new bone formation.[31]Figure g represents the cumulative release of CDDP from the GO/HAP/CS-3/CDDP composites.

Figure 6

UV–vis spectra of Loading Capacity of (a) GO/HAP/CS-1, (b) GO/HAP/CS-2; (c) GO/HAP/CS-3 and CDDP released from (d) GO/HAP/CS-1/CDDP, (e) GO/HAP/CS-2/CDDP, and (f) GO/HAP/CS-3/CDDP; and (g) cumulative release profile of CDDP released from GO/HAP/CS/CDDP composites.

Cell Viability and Cytotoxicity

Figure S3 shows the MG63 osteoblast-like cells cultured with different concentrations (0.2, 0.4, 0.6, 0.8, and 1.0 μg/mL) of GO/HAP/CS-3 and GO/HAP/CS-3/CDDP for 24 h. The viability of MG63 osteoblast-like cells increased with the increasing sample concentration from 0.2 to 1.0 μg/mL. Figure shows augmentation of MG63 osteoblast-like cells cultivated on the GO/HAP/CS-3 and GO/HAP/CS-3/CDDP composites. The 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay shows that the number of MG63 osteoblast-like cells can noticeably increase on HAP, GO/HAP, GO/HAP/CS-1, GO/HAP/CS, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP in comparison to that in pure HAP as control. The culture time is extended from 1 to 7 and 14 days. The outcome shows that MG63 cells can proliferate well on the prepared composite. The viability activities of MG63 osteoblast-like cells cultivated on the as-prepared composite are observed by optical microscopy. As the main inorganic phase of the natural bone tissue, hydroxyapatite (HA) nanoparticles are chosen as ingredients of bone scaffolds, which have the potential to augment bone regeneration capability. Graphene oxide improves the biological properties of scaffold materials and promotes the osteoblast proliferation. Furthermore, the incorporation of GO into HAP (GO/HAP) was nontoxic to osteoblasts and augments propagation and osteogenic discrimination. In addition, one of the most promising polymeric materials seems to be chitosan, a biopolymer.[32] An increase in the concentration of CS (10, 20, 30 wt %) in the GO/HAP composite results in the biocompatibility, osteoconductivity, and a lowest inflammatory response in MG63 osteoblast-like cells on day 1, 7, and 14. The composite exhibits an admirable cell viability performance because the MG63 osteoblast-like cells appear, which can be observed from optical microscopic images. When the culturing time of the MG63 cells is increased from 7 to 14 days, the culture is more obvious on the CDDP-loaded GO/HAP/CS-3 composite. The GO/HAP/CS-3/CDDP composite shows a major difference on day 14 compared with the GO/HAP/CS-3 composite, which is reported to encourage cell propagation and cell expansion.

Figure 7

(A) Cell viability on HAP, GO/HAP, GO/HAP/CS-1, GO/HAP/CS-2, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP analyzed by optical microscopy on 1, 7, and 14 days. (B) Quantification of cell viability of MG63 osteoblast-like cells measured by the MTT assay (n = 3, p < 0.005).

Figure A shows the optical microscopy observation on A549 cells. The cytotoxicity analyses of HAP, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP are revealed in Figure A,B. The considerable variations in the nature of toxicity of the GO/HAP/CS-3/CDDP composite appeared in A549 cells with an increase in the number of days of incubation, and it was attributed to the presence of CDDP in the composite (Figure A). Without CDDP loading, GO/HAP/CS-3 shows slightly toxic nature due to the presence of chitosan molecules in the composites.[32] This consequence established that the GO/HAP/CS-3/CDDP composites abridged the growth of cancer cells (Figure B). The MTT assay showed that the cell viability exceeded 23% and the incubation of A549 cells with GO/HAP/CS-3/CDDP composites concealed cell augmentation after 21 days, as shown in Figure B. Hence, the GO/HAP/CS-3/CDDP composite diminishes osteosarcoma progression because one of the effectual anti-bone-cancer agents is cisplatin.[33] HAP as a prospective material for CDDP confirmed unremitting discharge of the drug from HAP blocks.[34] Chitosan has power over anticancer doings by itself and an eminent study is that chitosan diminishes the viability of osteosarcoma cells, except not the normal cells from which osteosarcoma cells begin osteoblasts.[35] Chitosan was also able to condense the viability property on a prime bone cancer such as osteosarcoma. Thus, a chitosan can be of considerable use for bone cancer patients.

Figure 8

(A) Cytotoxicity on HAP, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP investigated by optical microscopy on 1, 7, 14, and 21 days. (B) Quantification of cell viability of A549 cells measured by the MTT assay (n = 3, p < 0.005).

Cell Adhesion

For the investigation of effects of composites on sustaining cell growth, we seeded MG63 osteoblast-like cells on pure HAP, GO/HAP, GO/HAP/CS-1, GO/HAP/CS-2, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP, which were examined by SEM for morphology after 1 day, 7 days, and 14 days. The SEM micrograph indicates that MG63 cells were spread over the composites. The ability of graphene oxide to improve the biological properties of composite materials and its ability to promote the adhesion of osteoblasts have been noticed in this study. After 7 days of culturing, there were plenty of MG63 osteoblast-like cells observed on the GO/HAP/CS-3/CDDP composite. Figure indicates the micrographs of the adhesion on HAP, GO/HAP, GO/HAP/CS-1, GO/HAP/CS-2, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP composites. Chitosan, a biopolymer, acts as a provider of better environment for MG63 osteoblasts cells. The GO/HAP/CS-3/CDDP composite has a suitable structure to mimic a temporary extracellular matrix (ECM), which can control cellular behaviors, promote MG63 cell adhesion, and provide appropriate microenvironments for MG63 osteoblast cells.[36,37] The GO/HAP/CS-3/CDDP composite revealed an admirable cell adhesion performance because MG63 osteoblast-like cells show cytoplasmic extension and filopodia can be observed on the MG63 osteoblast-like cells.

Figure 9

Morphology of cell adhesion of osteoblast-like cells (MG63) cultured in the presence of HAP, GO/HAP, GO/HAP/CS-1, GO/HAP/CS-2GO/HAP/CS-3, and GO/HAP/CS-3/CDDP on 1, 7, and 14 days.

Alkaline Phosphatase (ALP) Activity

ALP is a significant osteogenic discrimination and biochemical pointer of osteoblasts. The GO/HAP/CS-3 and GO/HAP/CS-3/CDDP composites promote ALP production from osteoblast-like cells (Figure ), which increases with the increasing culture time. For the GO/HAP/CS-3 composites alone, ALP concentration increased from 2.6 mM on day 1 to almost 4.9 mM on day 14. Indeed, with the GO/HAP/CS-3/CDDP composites, ALP activity was 4.2 mM at day 1 and 7.1 mM at day 14 (p < 0.005). The presence of CDDP in the GO/HAP/CS-3/CDDP composites significantly promoted the ALP activity as compared to that of GO/HAP/CS-3 alone.[38] These data show that the ALP activity on osteoblast-like cells increases when CDDP is supplemented with GO/HAP/CS-3.

Figure 10

ALP activity on GO/HAP/CS-3 and GO/HAP/CS-3/CDDP on 1, 7, and 14 days (n = 3, p < 0.005).

Gene Expression

The analysis of gene expression on MG63 osteoblast-like cells using the osteogenic initiation culture was analyzed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) investigation, Figure a–c. The gene articulation like Runx2, ALP, and OCN on GO/HAP/CS-3 and GO/HAP/CS-3/CDDP was investigated. The mRNA transcript levels of ALP in GO/HAP/CS-3 and GO/HAP/CS-3/CDDP composites expanded fundamentally in contrast to those in GO/HAP/CS-3/CDDP congregation. A comparable prototype was seen in the osteogenic transformation factor Runx2 through amplification and partly covering to that on GO/HAP/CS-3 and GO/HAP/CS-3/CDDP. The OCN expression level of GO/HAP/CS-3 and GO/HAP/CS-3/CDDP get together was mainly up-managed with augment and superimpose than GO/HAP/CS-3 and GO/HAP/CS-3/CDDP congregation. It is well known that CDDP fulfills a major purpose in bone mineral homeostasis and that it might in addition perform as a bioactive protein that helps in augmentation of osteogenisis.[39,40]

Figure 11

Gene expression of (a) ALP, (b) Runx2, and (c) osteocalcin in MG63 osteoblast-like cells cultivated on GO/HAP/CS-3 and GO/HAP/CS-3/CDDP for days 1, 7, and 14 (n = 3, p < 0.005).

Conclusions

Hydrothermal-assisted synthesis of GO/HAP/CS-3 was used to achieve a flowerlike morphology of HAP, GO, and CS, which exhibits a facile technique for scheming the morphological characteristics of composites. CDDP acts as a major chemotherapeutic remedy for the action of cancers. The CDDP-loaded composite GO/HAP/CS-3 exhibits an excellent cell viability behavior on MG63 osteoblast-like cells. The augmentation in cell viability of cells of MG63 osteoblasts enhances pertaining to the increase in the porosity, which serves a significant role in the medical trials. The GO/HAP/CS-3/CDDP composite exhibits a cytoplasmic extension, and filopodia can be observed on the MG63 osteoblast-like cells. The GO/HAP/CS-3/CDDP composite should allow artificially favorable biomaterial in the tissue engineering applications.

Materials and Methods

Materials

Ammonia solution (NH4OH), calcium chloride dihydrate (CaCl2·2H2O), chitosan (molecular weight, 50–190 kDa), cisplatin (CDDP), diammonium hydrogen phosphate ((NH4)2HPO4), ethyl alcohol (C2H5OH), graphite, hydrogen peroxide (H2O2), potassium permanganate (KMnO4), phosphate buffer saline (PBS), phosphoric acid (H3PO4), and sulfuric acid (H2SO4) were brought from Sigma-Aldrich, Mumbai, India. Analytical-grade chemicals were used in all of the experiments with no any additional cleansing. Deionized water was used in all of the experiments.

Preparation of GO

GO was synthesized using powder graphite following the modified Hummer’s method.[35] The experimental procedures were slightly modified as follows: before preparation of GO, the graphite flakes were subjected to ultrasonication for the formation of graphene sheets. Then, KMnO4 (18.0 g, 6 wt equiv) was supplemented slowly to a 9:1 mixture of rigorous H2SO4/H3PO4 (360:40 mL) in six equal portions, producing a slight exothermic reaction that should not exceed the temperature 35–40 °C, and a graphene sheet (3.0 g, 1 equiv wt %) was formed. This reaction was passionate to 50 °C with continuous stirring for 12 h. The reaction temperature was reduced to room temperature (27 °C), and the reaction mixture was discharged onto ice (400 mL) containing 30% H2O2 (3 mL).

Preparation of GO/HAP Composite

Distinctively, 3 mg of GO was dispersed in 5 mL of DD water with continuous stirring for 30 min. Then, 0.5 mM CaCl2·2H2O was added into each of the 5 mL GO suspension under stirring for fine mixing of each solution. Then, the 0.3 mM (NH4)2HPO4 aqueous solution was added slowly to the above mixture and stirred vigorously on a magnetic stirrer. The pH of the reaction mixture was maintained at pH 10.0 with the help of ammonia solution. Stirring was continued for about 30 min. The whole solution was ultrasonicated for 30 min, and the solution was slowly filtered using a vacuum-assisted Buchner funnel, followed by washing with 100 mL of water three times to obtain the HAP/GO composite. Finally, the resulting precipitate was dried at 50 °C. Throughout the synthesis, the oxygen-containing functional groups on GO surfaces act as receptor sites for Ca2P through electrostatic interactions; these anchored cations can in situ react with phosphate ions to obtain apatite nanoparticles. The distribution and the microstructures of HAP on graphene are mainly influenced by the amounts and types of oxygenated groups on the GO and the concentration of calcium and phosphorus in the reagents. Composites prepared in this method are expected to increase the interfacial bonding between GO and HAP.

Preparation of GO/HAP/CS Composites

The quantity of CS has considerably influenced the potency of the synthesizing hydrogels. Considering the solubility boundary of CS in acetic acid solution, we used different weight percentages (10, 20, 30 wt %) of CS aqueous solutions to prepare the composites. Different weight percentages of the CS polymer solution were added into the GO/HAP composite, and then it was ultrasonicated for 30 min (5 s on, 3 s off), followed by pouring of the suspension into a sealed autoclave. It was heated to 180 °C for 2 h in a muffle furnace and, afterward, allowed to cool to room temperature (27 °C) to obtain a GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 composites with 10, 20, and 30 wt % CS, respectively. The schematic diagram of GO/HAP/CS-3/CDDP is shown in Figure S1.

Cisplatin (CDDP) Encapsulation/Entrapment on GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 Composites

CDDP (5 mg) was dissolved in acetone (1 mg/1 mL in acetone, 5 mL) along with the addition of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 with the help of stirring using a magnetic stirrer at 1000 rpm. The resultant mixture was centrifuged at 4000 rpm. Finally, the acquired GO/HAP/CS-1/CDDP, GO/HAP/CS-2/CDDP, GO/HAP/CS-3/CDDP powder was lyophilized using a lyophilizer (SSIPL-LYF/065/071216).

Physicochemical Characterizations

Fourier Transform Infrared (FTIR) Spectroscopy

The HAP, GO/HAP, GO/HAP/CS composites and the CDDP-loaded GO/HAP/CS composites were tested by a Bruker Tensor 27 Series FTIR spectrometer, and 16 scans per sample were taken in the region of 400–4000 cm–1 with 2 cm–1 resolution. The pellets were made for the FTIR test by crushing 0.2 g of the sample powder together with 1 g of KBr and then pressing them into a transparent disc.

X-ray Diffraction

The X-ray diffraction (XRD) characterization was done to analyze the phase composition and to precisely obtain the crystallinity of prepared HAP, GO/HAP, GO/HAP/CS composites, and CDDP-loaded GO/HAP/CS composites. This test was accomplished in a Bruker D8 Advance diffractometer with a monochromatic Cu Kα source operated at 40 kV and 30 mA. An acceleration voltage of 30 kV and a current of 15 mA were applied. The operating range of this test was over the 2θ range of 10–60° in step scan mode with a step size of 0.02° and a scan rate of 0.02°/min.

Scanning Electron Microscopy (SEM)

The morphology, EDAX and elemental mapping, and morphologies of the GO/HAP, GO/HAP/CS, and CDDP-loaded GO/HAP/CS composites were examined by SEM (VEGA3 TESCAN) by operating it at a voltage of 10 kV.

Transmission Electron Microscopy

The surface analyses of the synthesized GO/HAP and GO/HAP/CS composites and CDDP-loaded GO/HAP/CS composites were determined by high-resolution transmission electron microscopy (HR-TEM, TECNAI F30). For sample preparation for HR-TEM analysis, the synthesized nanoparticles and their composites were dispersed in ethanol by ultrasonication up to 15 min. Afterward, these were loaded on a carbon-coated copper mesh.

Barrett–Joyner–Halenda (BJH) and Brunauer–Emmett–Teller (BET) Analyses

Nitrogen adsorption/desorption isotherms of GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 were assessed with a Tel Micro Tract analyzer (Bel cork, Japan) under a nonstop adsorption condition at a constant temperature (77 K). At the beginning of the analysis, GO/HAP/CS-1, GO/HAP/CS-2, and GO/HAP/CS-3 were degassed at 100 °C. BJH and BET analyses were used to find out the surface area, pore volume, and pore diameter.[41]

Loading Capacity (LC) on GO/HAP/CS-3

UV–visible spectroscopy was used to study the loading capacity of the composites formed. GO/HAP/CS-1/CDDP, GO/HAP/CS-2/CDDP, and GO/HAP/CS-3/CDDP composites (10 mg of each) were washed using 2 mL of acetone. Later, the solution was centrifuged. Afterward, complimentary CDDP having acetone was freeze-dried. Finally, hexane was used to extract the CDDP and a UV–vis spectrophotometer at 265 nm[31] was used to measure the amount of CDDP loaded into GO/HAP/CS-3.

In Vitro Release Studies

The in vitro discharge behavior of CDDP from CDDP-loaded GO/HAP/CS-1, GO/HAP/CS-2, GO/HAP/CS-3 composites was studied via a dialysis membrane technique using a PBS solution working at pH 7.4. Sample preparation included sealing of 50 mg of GO/HAP/CS-1/CDDP, GO/HAP/CS-2/CDDP, and GO/HAP/CS-3/CDDP composites into separate dialysis bags with the MWCO 12 000 Da. Then, 10 mL of the PBS solution containing CDDP-loaded composites was stirred at 100 rpm and at 37 °C. The supernatant solution was collected at different day interval by measured the concentration of CDDP solution λmax value of 265 nm in a UV-spectroscopy and replenishing among an identical quantity of new PBS medium.[41,42]

The following formula was used to calculate the % of drug releasewhere AR is the absorbance of CDDP discharged from the composite and AC is the total amount of CDDP loaded in the composite.

Biodegradability

The biodegradability of composites was analyzed for a time period of 28 days by putting them in PBS at pH 7.4 and ambient temperature 27 °C, while keeping the liquid-to-solid ratio at 0.5 mg/mL through stirring at 100 rpm. The buffer solution was freshly prepared every 3rd day at 1st, 7th, 14th, 21th, and 28th day; the days were the specimens were taken from them. The solution was then oven-dried at 60 °C for 24 h till the stable weight was achieved. The degradation proportion was calculated using the following formulawhere W0 is the early weight of the composite and W is the weight at later time t after treatment

Cell Viability on Osteoblast-like Cell (MG63)

The National Centre for Cell Science (NCCS), Pune, India, was chosen for the procurement of the osteoblast-like cells MG63. The cells were maintained in a strict stringent condition in Dulbecco’s modified Eagle’s medium (DMEM) in a CO2 incubator at 37 °C (with a humidifier) along with low glucose concentration (1 g/L), fetal bovine serum (FBS-10%), and penicillin/streptomycin (1%). The trypsin/EDTA solution was used after every 3 days to harvest the cells. The effect of HAP, GO/HAP, GO/HAP/CS-1, GO/HAP/CS-2, GO/HAP/CS-3, and GO/HAP/CS-3/CDDP nanocomposites on MG63 was recorded with the help of the corresponding 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. A 24-well plate was used to seed the MG63 osteoblast-like cells at a density of 4 × 104 cells/well and co-cultivated with GO/HAP/CS-3 and GO/HAP/CS-3/CDDP composites with a concentration of 1 μg/mL. The MTT assay was used to assess the viability of MG63 osteoblast-like cells. After an incubation of 1, 7, and 14 days, the sample solutions were taken and the MTT solution (100 μL, 5 mg/mL) was added in 1 mL culture medium to each well plate and then again incubated for 4 h at 37 °C. Afterward, 1 mL of dimethyl sulfoxide was supplemented to it and the supernatant medium was collected separately, followed by centrifugation. The wavelength of 570 nm was used to record the ocular density of the superincumbent solution.[43]

Cytotoxicity

Cell differentiation was studied on human lung cancer (A549) cells, and they were purchased from the National Center for Cell Science (NCCS), Pune, India. A549 cells were seeded in 24-well plates containing Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS and penicillin (100 U/mL)/streptomycin (100 U/mL) (Gibco, Grand Island, CA) and cultivated for 24 h. The cells were incubated at 37 °C (RT) in CO2 and were observed thorough MTT assay techniques. The composite was tested on cells incubated for different days, 1, 7, and 14. The OD values were recorded at a λmax value of 490 nm. The composite morphology was investigated by optical microscopy, and the following formula was used to calculate the cytotoxicity of the composite

MG63 Osteoblast-like Cell Adhesion on Composites

Cell adhesion analysis was recorded using the cell viability protocol. Subsequent to day 1, day 7, and day 14 of incubation, cell-film assemblies were cleaned with PBS and fixed with 3% glutaraldehyde at 4 °C. These samples were dried in air. Dried samples were mounted on aluminum stubs with gold sputter-coating. The prepared samples were hence perspective under SEM at an extent voltage of 10 kV[29] the investigations were continual three times.

Alkaline Phosphatase (ALP) Activity

The expression of alkaline phosphatase was assessed with the composites on 24-well plates at a density of 4 × 104 cells. For each specimen of day 1, day 7, and day 14, the cells were thoroughly washed with PBS solution and lysated in Triton X-100 (0.1 vol %) using the typical freeze–defrost rotations. The calorimetric test was used to determine the ALP activity in the lysate with an ALP reagent consisting of a p-nitrophenyl phosphate substrate.[40] A microplate reader quantifying at 405 nm was used to obtain the absorbance of p-nitrophenol.

Gene Expression

Specific bone-related genes of transcript mRNA from MG63 osteoblast-like cells cultivated on the synthesized nanocomposite with a concentration of 10 μg/mL were tested by real-time qRT-PCR analysis. Full RNA was isolated, and indiscriminate hexamer-primed cDNA production was executed on them. A RevertAid first strand cDNA union pack was used. In a 40-cycle PCR using a Rotor-gene Q analyzer, the cDNA was used as a template base. To determine the real-time PCR, the Maxima SYBR green/ROX qPCR master mix was used. It was further followed by softening bend investigation to verify PCR specificity.[39,40] In Rotor-Gene Q software (Corbett), limit cycle normal was used for calculation and all of the experiments were repeated twice. ΔCt analysis was used to calculate the relative gene expression. Each target gene’s comparative expression levels were normalized besides the general housekeeping gene’s Ct value. The reverse and forward primers of the handpicked genes are listed in Table .

Table 2

Primary Sequences Used for PCR Amplification

genes	forward primer sequence (5′–3′)	reverse primer sequence (5′–3′)	gene bank no.	size
ALP	CGGCCATCCTATATGGTAACGG	CAGGAGGCCATACGCCATCACA	NM_001287172	72
Runx2	CCAACTTCCTGTGCTCCGTG	GTGAAACTCTTGCCTCGTCCG	NM_001146038	151
osteocalcin	GACCCTCTCTCTGCTCACTCT	GACCTTACTGCCCTCCTGCTTG	NM_007541.3	112