Literature DB >> 30555653

Effects of Dietary Polyunsaturated Fatty Acids on DNA Methylation and the Expression of DNMT3b and PPARα Genes in Rats.

Ehsan Maktoobian Baharanchi1, Mostafa Moradi Sarabi1, Fakhraddin Naghibalhossaini1,2.   

Abstract

BACKGROUND: Previous studies have suggested a protective role for Polyunsaturated Fatty Acids (PUFA) against cancer, cardiovascular, and other diseases. To provide new insights into the in vivo effects of PUFA on gene expression, the effects of dietary PUFA on DNMT3b and PPARα gene expression and global DNA methylation were investigated in selected rat tissues.
METHODS: Thirty sprague-dawley rats were allotted into 3 dietary groups of ten animals each, received experimental diets containing PUFAs every day by gavages for 12 weeks as follows: control group fed a normal diet and water; n-3 PUFAs group received 300 mg/kg/day n-3 PUFAs supplementation; mixed-PUFAs group received 300 mg/kg/day of a mixture of n-3, -6, -9 PUFAs supplementations. The expressions of DNMT3b and PPARα genes were quantitated using real-time RT-PCR. The genome-wide 5-methylcytosine contents in rat tissues were determined by ELISA method.
RESULTS: The average expression of the DNMT3b mRNA was 50% lower in the colon and liver of rats fed the n-3- or mixed-PUFAs supplemented diet than control group (p=0.00). However, PPARα expression was significantly upregulated both in the colon and liver of PUFAs-supplemented rats (p<0.001). No significant difference was observed in the blood, colon, and liver DNA methylation levels between PUFAs-supplemented and control animals.
CONCLUSION: The results indicate that dietary PUFAs could modulate the expressions of PPARα and DNMT3b genes in various rat tissues. The findings of this study provide additional insights into the in vivo mechanism of PUFA-mediated regulation of gene expression and could provide an opportunity to develop personalized diets for related disease control.

Entities:  

Keywords:  DNA methylation; Dietary supplement regulation; Fatty acids omega-3; Gene expression

Year:  2018        PMID: 30555653      PMCID: PMC6252034     

Source DB:  PubMed          Journal:  Avicenna J Med Biotechnol        ISSN: 2008-2835


Introduction

Nutrigenomics is a well-established field of research that aims to find nutritional influences on gene expression. Exposure to environmental factors such as diet could induce epigenetic changes that lead to altered gene expression 1,2. Omega (ω, n)-3 Polyunsaturated Fatty Acids (PUFAs), a component of marine oils has been implicated in the prevention of cardiovascular disease, cancer, type 2 diabetes mellitus, and neurodegenerative diseases in humans 3–5. There is also evidence suggesting a protective role for n-3 PUFA supplementation in the prevention of Colorectal Cancer (CRC) 3,6. Administration of n-3 PUFAs in both rodent models of CRC and humans has been demonstrated to increase n-3 fatty acids content of tumors and colonic mucosa, respectively 7. Other studies have reported significant reduction of the size of xenograft tumors of human CRC cell lines in rodents supplemented with dietary PUFAs as compared to controls 8,9. Numerous mechanisms have been suggested by which n-3 PUFAs might suppress cancer cell growth, including regulation of gene expression, cell migration, angiogenesis, and apoptosis 10. It has been well-documented that fatty acids, especially PUFAs can regulate genes expression through binding to the intracellular peroxisome Proliferator-Activated Receptors (PPARs) 11. Since many ligands for PPARs, like NSAIDs, have been shown to inhibit tumor cell proliferation 12,13, it has been hypothesized that n-3 PUFAs might exert their antineoplastic activity through differential activation of PPAR-α and PPAR-γ receptors 14. However, data are inconsistent, and little is known about the exact mechanisms by which PPAR activation prevents carcinogenesis 15–17. Aberrant global DNA hypomethylation and CpG Island DNA hypermethylation are the most common epigenetic alterations observed in CRC tumors 18. Clinical and experimental studies indicated that expression of DNA methyltransferases especially that of DNMT3B could contribute to aberrant DNA methylation in CRC tumors 19–21. There are emerging findings indicating that n-3 PUFA treatment can modulate epigenome in cells 22. Such epigenetic changes likely play an important role in the mechanisms involved in the observed n-3 PUFA effects on gene expression. These studies have indicated that PUFAs exposure might modulate gene specific and global DNA methylations as well as histone modifications that are consistent with changes to gene expression 23–26. In humans, maternal supplementation with n-3 PUFA during pregnancy may modify global DNA methylation levels in infants 23. In rodents, dietary n-3 PUFA supplementation during pregnancy or lactation has been reported to induce promoter methylation of Fads2 gene and reduce its mRNA expression in maternal and offspring livers compared to those fed soy bean oil 27. In the present study, the effect of PUFAs supplementation on the expression of DNMT3b and PPARα genes and global DNA methylation was investigated in selected normal rat tissues.

Materials and Methods

Animal procedures

Thirty sprague-dawley rats, 3 weeks old and weighing 160–250 gr were used for this study. Rats were housed at 5 animals per cage and kept in 12h light-dark cycles. All animals had free access to the regular laboratory food pellets (Behparvar, Tehran) containing 3.5–4.5% total lipid and tap water. All protocols were approved by the institutional animal care committee of Shiraz University of Medical Sciences. The rats were divided into 3 dietary groups of 10 (5 females and 5 males/each group) as follows: group 1 (control group) received water every day by gavage for 12 weeks; group 2 (n-3 PUFA group) received 300 mg/kg/day n-3 PUFA (Docosahexaenoic acid, DHA: 120 mg/kg+ Eicosapentaenoic acid, EPA: 180 mg/kg) (Golden Alaska Deep Sea Fish Oil, USA) per day by oral gavage for 12 weeks; group 3 (mixed-PUFA group) received 300 mg/kg/day of a mixture of n-3, -6, -9 [(DHA: 20 mg/kg+EPA: 30 mg/kg+Linoleic acid, LA: 75 mg/kg+α-linolenic acid, α-LNA: 83.4 mg/kg+γ-Linolenic acid, γ-LNA: 33.3 mg/kg+Oleic acid, OA: 58.3 mg/kg) (Nutralife, Numega, Canada)] by gavage for 12 weeks. After treatment period, rats were sacrificed and whole blood was collected by cardiac puncture and sections of colon and liver were then surgically removed, frozen in liquid nitrogen, and stored at −80°C until needed.

DNA extraction and global DNA methylation analysis

High molecular weight genomic DNA was isolated from blood, liver, and colon tissues by the standard protocol of proteinase K digestion and phenol-chloroform extraction. Global DNA methylation was quantified using 5-mC DNA ELISA kit (Zymo Research, Germany), as described previously 28.

RNA extraction and quantitative RT-PCR

Total RNA was extracted from colon and liver tissues using Tripure RNA isolation reagent (Roche Applied Science, Germany), following the manufacturer’s instructions. Purified RNA was stored at −80°C until use. Complementary DNA (cDNA) was prepared from each RNA sample as described previously 29. The expression levels of genes of interest (DNMT3b and PPARα) and reference gene (β-actin) were determined by quantitative real-time RT-PCR using SYBR green-based analysis and Master Mix (ABI, UK). The sequences of primers used for amplification of genes are listed in table 1. To prevent nonspecific amplification of the possible contaminating genomic DNA, the forward and reverse primers were used for RT-PCR amplification of DNMT3b and β-actin genes, designed on different exons with a large intron between them. Reactions were carried out in triplicate and analyzed using an ABI 7500 Sequence Detection System (Applied Biosystems, USA). Amplifications were performed under the following conditions: a pre-cycling heat activation at 95°C for 10 min, followed by 38 cycles of heat denaturation at 95°C for 15 s and annealing and extension at 60°C for 1 min. Relative expression levels were determined using the standard ΔCt method with β-actin internal reference gene used for normalization 30.
Table 1.

Primers’ sequence used for quantitative RT-PCR

GeneForward primer (5′ → 3′)Reverse primer (5′→ 3′)Target size (bp)
DNMT3bGATGATCGACGCCATCAAGCGAGCTTATCATTCTTTGAAGCTA107
PPARαTGAACAAAGACGGGATGTCAAACTTGGGTTCCATGAT106
β-actinAAGGCCAACCGTGAAAAGATACCAGAGGCATACAGGGACA102

Statistical analysis

The data are presented as the mean±SD and SPSS18 analytic software (SPSS, Inc., Chicago) and GraphPad Prism statistical software (version 5; San Diego, CA) were used for data analysis. One-way ANOVA with Tukey’s post hoc test were used to determine differences between groups, as indicated. The significance level was set at p< 0.05. Primers’ sequence used for quantitative RT-PCR

Results

Effect of dietary PUFA on the expression of DNMT3b and PPARα genes in rats

To assess the influence of dietary PUFA supplementation on the regulation of DNMT3b and PPARα genes expression in vivo, 2 groups of rats were fed daily either with 300 mg/kg n-3 PUFA (DHA+EPA) (n-3 PUFAs group) or a mixture of n-3, -6, -9 PUFAS (mixed PUFAs group) for 3 months as described in the Material and Methods section. DNMT3b and PPARα genes expression in the colon and liver tissues was measured and compared with those in the control group (animals on a normal diet). The average expression levels were calculated from the combined expression values for each group (n=10) and are presented as mean±SD. Before quantitation, electrophoresis of RT-PCR pro-ducts on 1.5% agarose gel and visualization under UV illumination confirmed that specific products of about 107, 106, and 102 bp with no non-specific PCR products were obtained upon amplification of DNMT3b, PPARα, and β-actin cDNAs, respectively (Figure 1). To ensure there was no amplification of contaminating genomic DNA, minus RT control PCR reactions were performed in which no reverse transcriptase was added to RNA samples. No amplification product was detected for any specific pair of primers used in these reactions.
Figure 1.

Agarose gel electrophoresis of RT-PCR products of DNMT3b, PPARα and β-actin gene in the colon and liver tissues of rats. The presence of PCR products with the expected lengths of about 107 bp for DNMT3b, 106 bp for PPARα and 102 bp for β-actin was confirmed. M, DNA marker; D, DNMT3b; P, PPARα; A: β-actin.

Agarose gel electrophoresis of RT-PCR products of DNMT3b, PPARα and β-actin gene in the colon and liver tissues of rats. The presence of PCR products with the expected lengths of about 107 bp for DNMT3b, 106 bp for PPARα and 102 bp for β-actin was confirmed. M, DNA marker; D, DNMT3b; P, PPARα; A: β-actin. As shown in figure 2, both n-3 PUFAs and mixed PUFAs significantly decreased DNMT3b mRNA levels in colon and liver tissues as compared to controls (p=0.00). More than 50% reduction in DNMT3b expression was observed in liver tissues from the rats fed with n-3 PUFAs or mixed PUFAs (Figure 2A). The average expression levels of DNMT3b were also found to be 83.5% and 91.4% lower in the colon tissues of rats fed the n-3 PUFA and mixed PUFA supplemented diets, respectively (Figure 2B). However, PPARα expression was significantly higher in the liver and colon tissues of rats fed the n-3 PUFA and mixed PUFA supplemented diets as compared to controls (p<0.001) (Figure 3). In comparison with controls, average expressions of PPARα mRNA were 1.65- and 3.7-fold higher in the liver and colon tissues of n-3 PUFAs group, respectively (Figure 3A). The data also showed an overall about 1.6- and 3.5-fold upregulation of PPARα expression in the liver and colon tissues of the mixed PUFAs group as compared to controls (Figure 3B).
Figure 2.

Relative expression of DNMT3b in A) liver and B) colon tissue of rats fed with the n-3 PUFA and mixed PUFA supplemented diets measured by quantitative RT-PCR. The mean expression of each gene was normalized to β-actin mRNA. Water fed groups were used as controls, whose expression levels were set to 1.0, and expressions of n-3 PUFA and mixed PUFA supplemented groups were expressed as an n-fold difference relative to the control group. Mean values±SEM of three experiments are given. Bars marked with asterisk are significantly different as verified by Tukey’s honestly significant difference multiple comparison test (p<0.001).

Figure 3.

Relative expression of PPARα in A) liver and B) colon tissues of rats fed with the n-3 PUFA and mixed PUFAs supplemented diets measured by quantitative RT-PCR. Mean expression of each gene was normalized to β-actin mRNA. Water fed groups were used as a control, whose expression levels were set to 1.0, and expressions of n-3 PUFA and mixed PUFA groups were expressed as an n-fold difference relative to control group. Mean values±SEM of three experiments are given. Bars marked with asterisk are significantly different as verified by Tukey’s honestly significant difference multiple comparison test (p<0.001).

Relative expression of DNMT3b in A) liver and B) colon tissue of rats fed with the n-3 PUFA and mixed PUFA supplemented diets measured by quantitative RT-PCR. The mean expression of each gene was normalized to β-actin mRNA. Water fed groups were used as controls, whose expression levels were set to 1.0, and expressions of n-3 PUFA and mixed PUFA supplemented groups were expressed as an n-fold difference relative to the control group. Mean values±SEM of three experiments are given. Bars marked with asterisk are significantly different as verified by Tukey’s honestly significant difference multiple comparison test (p<0.001). Relative expression of PPARα in A) liver and B) colon tissues of rats fed with the n-3 PUFA and mixed PUFAs supplemented diets measured by quantitative RT-PCR. Mean expression of each gene was normalized to β-actin mRNA. Water fed groups were used as a control, whose expression levels were set to 1.0, and expressions of n-3 PUFA and mixed PUFA groups were expressed as an n-fold difference relative to control group. Mean values±SEM of three experiments are given. Bars marked with asterisk are significantly different as verified by Tukey’s honestly significant difference multiple comparison test (p<0.001).

Global DNA methylation analysis

Rats were supplemented with n-3 PUFAs or mixed-PUFAs for 3 months and DNA methylation levels in the blood, liver, and colorectal tissues of PUFA-supplemented animals were compared with those of controls. The average methylation levels was calculated from the combined methylation values for each group (n=10) and are presented as mean±SD (Figure 4). There was no difference in the blood, colon, and liver global DNA methylation levels between mixed PUFA, n-3 PUFA, and control groups (Figure 4). The data showed that overall about 0.976%, 0.981%, and 0.976% of the cytosines were methylated in the genomic DNA extracted from colonic tissues of mixed PUFAs, n-3 PUFAs, and control group, respectively (p>0.05) (Figure 4A). The mean global methylation percentage in DNA from blood was 1.006% for n-3 PUFA group, 1.003% for mixed PUFA group, and 1.006% for controls, a non-significant difference (p= 0.79) (Figure 4B). The mean percentage of 5-mC in the DNA extracted from liver of n-3 PUFA group, mixed PUFA group, and controls was 0.958, 0.956, and 0.958%, respectively (p>0.05) (Figure 4C).
Figure 4.

Comparison of mean global DNA methylation levels in A) colon, B) blood, and C) liver tissues between mixed PUFA, n-3 PUFA, and control animals. Percentage of 5-mC in rats was evaluated using ELISA assay. Mean values±SEM of three experiments are given (p<0.05).

Comparison of mean global DNA methylation levels in A) colon, B) blood, and C) liver tissues between mixed PUFA, n-3 PUFA, and control animals. Percentage of 5-mC in rats was evaluated using ELISA assay. Mean values±SEM of three experiments are given (p<0.05).

Discussion

Characterizing the molecular mechanism(s) by which n-3 PUFAs regulate gene regulation will provide an opportunity to develop personalized diets for the related diseases control. Previous studies have suggested that n-3 PUFA might reduce the risk of cancer development through a variety of mechanisms, including inhibition of angiogenesis, modulation of Cyclooxygenase (COX) activity, apoptosis, alterations to cell signaling, and anti-inflammation 14. To provide further insights into the molecular mechanisms of PUFA activities, the influence of dietary PUFAs was investigated on DNMT3b and PPARα expressions in intestine and liver tissues of rats fed n-3 or mixed n-3, 6, 9 PUFAs-supplemented diet. Our findings showed that DNMT3b mRNA levels were significantly lower in liver and colon tissues of animals fed n-3 PUFAs and mixed PUFAs than control group (Figures 2A and B). Mixed PUFAs was more effective than n-3 PUFAs for reducing DNMT3b expression in rat colon (p<0.05). However, there was no statistically significant difference between n-3 PUFAs and mixed PUFAs groups in DNMT3b expression levels in liver tissue. To the best of our knowledge, this is the first report describing the PUFA-mediated downregulation of DNMT3b expression in animal tissues. Deregulation of DNA methylation is the most common epigenetic alteration associated with human cancers 18. Several previous studies have indicated that DNMT3b mRNA is overexpressed in human CRC as compared with matched normal colonic mucosa 20,31. DNMT3B activity has been linked with aberrant methylation of CpG islands in colon cancer 31. Overexpression of DNMT3B has been shown to induce DNA methylation in specific genes promoter and colon tumor formation in mice 19. Other studies have suggested that DNMTs expression levels may directly influence global DNA methylation patterns 28,32. One recent study has investigated the effects of high fat diet and fish oil, rich in n-3 PUFA on DNA methylation in mice. Compared to animals fed control diet, fish oil prevented obesity induced changes in global and Pparg2 promoter DNA methylation in a tissue-specific manner 24. It has been also reported that human maternal supplementation with n-3 PUFA during pregnancy may modulate global DNA methylation levels in infants 23. The finding of other studies has also suggested that dietary fat intake can modulate genome-wide DNA methylation in the skeletal muscle of healthy men 25,33. Such epigenetic changes may have an important role in the observed PUFA effects on gene expression. Given the observed link between DNMTs enzyme activity and regulation of the epigenome, an attempt was made to examine whether dietary PUFA could modulate global DNA methylation in selected rat tissues. The levels of 5-mC in genomic DNA isolated from blood, colon and liver tissues of PUFA-supplemented animals were quantified. As shown in figure 4, the overall 5-mC levels were similar between PUF-As-supplemented animals and controls. DNA methylation is primarily mediated by a family of 3 DNMTs comprising DNMT1, -3A, and -3B in mammals 34. So far, only few studies have investigated the influence of PUFAs on DNA methylation in animal models, and their findings indicated that the epigenetic effect of n-3 PUFAs is gene and tissue specific 22,26,28,35. A positive correlation between mean DNMT1/3A/3B expression and global DNA methylation levels measured in human CRC cell lines was previously reported 28. In the present study, only the effect of dietary PUFAs on the expression of one of 3 DNMT enzymes, DNMT3b, was examined. Whether the intake of PUFA can also modulate the expression of two other DNMTs remains to be investigated. PUFAs regulate the expression of genes in various tissues by directly binding to nuclear receptors, PPARs 36. PPARα is expressed predominantly in liver, heart, and intestine, playing a major role in lipid and carbohydrate metabolism and energy homeostasis 37. The expression of PPARα mRNA was previously correlated with liver and bladder cancers in rodents 38,39. To investigate whether there is an association between PUFA intake and expression of PPARα, the levels of PPARα mRNA in liver and colon of PUFA-supplemented rats were quantified and compared with those in animals on a normal diet. PPARα expression tended to be higher in both liver and colon tissues of PUFAs-supplemented rats compared to animals on a normal diet (p<0.001) (Figure 3). Therefore, our findings agree with the previous studies that reported an association between n-3 PUFAs supplementation and upregulation of PPARα expression in liver and colon tissues 40,41. There was no difference, however, in PPARα gene expression between n-3 PUFAs and mixed PUFAs groups in either tissue. The data suggest that PUFAs, as a natural ligand of PPARs not only increases PPARα activity, but they also modulate its expression in target tissues.

Conclusion

The findings of this study suggest that dietary PUF-As modulate the expressions of PPARα and DNMT3b genes in rat colon and liver tissues. The data provide additional insights into the molecular mechanisms of n-3 PUFAs protective activity against various related diseases.
  41 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  Inactivation of Dnmt3b in mouse embryonic fibroblasts results in DNA hypomethylation, chromosomal instability, and spontaneous immortalization.

Authors:  Jonathan E Dodge; Masaki Okano; Fred Dick; Naomi Tsujimoto; Taiping Chen; Shumei Wang; Yoshihide Ueda; Nick Dyson; En Li
Journal:  J Biol Chem       Date:  2005-03-08       Impact factor: 5.157

3.  Endothelial cell apoptosis induced by the peroxisome proliferator-activated receptor (PPAR) ligand 15-deoxy-Delta12, 14-prostaglandin J2.

Authors:  D Bishop-Bailey; T Hla
Journal:  J Biol Chem       Date:  1999-06-11       Impact factor: 5.157

4.  Molecular recognition of fatty acids by peroxisome proliferator-activated receptors.

Authors:  H E Xu; M H Lambert; V G Montana; D J Parks; S G Blanchard; P J Brown; D D Sternbach; J M Lehmann; G B Wisely; T M Willson; S A Kliewer; M V Milburn
Journal:  Mol Cell       Date:  1999-03       Impact factor: 17.970

Review 5.  The DNA methyltransferases of mammals.

Authors:  T H Bestor
Journal:  Hum Mol Genet       Date:  2000-10       Impact factor: 6.150

6.  Decreased tumor growth in Walker 256 tumor-bearing rats chronically supplemented with fish oil involves COX-2 and PGE2 reduction associated with apoptosis and increased peroxidation.

Authors:  Rogéria C Mund; Nathalia Pizato; Sandro Bonatto; Everson A Nunes; Thiago Vicenzi; Ricardo Tanhoffer; Heloisa H P de Oliveira; Rui Curi; Philip C Calder; Luiz C Fernandes
Journal:  Prostaglandins Leukot Essent Fatty Acids       Date:  2007-01-17       Impact factor: 4.006

7.  Conjugated eicosapentaenoic acid (EPA) inhibits transplanted tumor growth via membrane lipid peroxidation in nude mice.

Authors:  Tsuyoshi Tsuzuki; Miki Igarashi; Teruo Miyazawa
Journal:  J Nutr       Date:  2004-05       Impact factor: 4.798

Review 8.  Alterations of DNA methylation associated with abnormalities of DNA methyltransferases in human cancers during transition from a precancerous to a malignant state.

Authors:  Yae Kanai; Setsuo Hirohashi
Journal:  Carcinogenesis       Date:  2007-09-24       Impact factor: 4.944

Review 9.  Dietary long-chain n-3 fatty acids for the prevention of cancer: a review of potential mechanisms.

Authors:  Susanna C Larsson; Maria Kumlin; Magnus Ingelman-Sundberg; Alicja Wolk
Journal:  Am J Clin Nutr       Date:  2004-06       Impact factor: 7.045

10.  Dnmt3b promotes tumorigenesis in vivo by gene-specific de novo methylation and transcriptional silencing.

Authors:  Heinz G Linhart; Haijiang Lin; Yasuhiro Yamada; Eva Moran; Eveline J Steine; Sumita Gokhale; Grace Lo; Erika Cantu; Mathias Ehrich; Timothy He; Alex Meissner; Rudolf Jaenisch
Journal:  Genes Dev       Date:  2007-12-01       Impact factor: 11.361

View more
  4 in total

Review 1.  Effects of Fat Supplementation in Dairy Goats on Lipid Metabolism and Health Status.

Authors:  Giovanni Savoini; Fabio Omodei Zorini; Greta Farina; Alessandro Agazzi; Donata Cattaneo; Guido Invernizzi
Journal:  Animals (Basel)       Date:  2019-11-04       Impact factor: 2.752

Review 2.  Polyunsaturated fatty acids and DNA methylation in colorectal cancer.

Authors:  Mostafa Moradi Sarabi; Reza Mohammadrezaei Khorramabadi; Zohre Zare; Ebrahim Eftekhar
Journal:  World J Clin Cases       Date:  2019-12-26       Impact factor: 1.337

3.  Epigenetic Regulation of Peroxisome Proliferator-Activated Receptor Gamma Mediates High-Fat Diet-Induced Non-Alcoholic Fatty Liver Disease.

Authors:  Tahar Hajri; Mohamed Zaiou; Thomas V Fungwe; Khadija Ouguerram; Samuel Besong
Journal:  Cells       Date:  2021-05-31       Impact factor: 6.600

4.  Nicotine attenuates global genomic DNA methylation by influencing DNMTs gene expression in human endometrial stromal cells.

Authors:  Fatemeh Zal; Amir Yarahmadi; Hamidreza Totonchi; Mahdi Barazesh; Mostafa Moradi Sarabi
Journal:  Genes Environ       Date:  2020-02-05
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.