Literature DB >> 30542456

Anti-inflammatory effects of bone marrow mesenchymal stem cells on mice with Alzheimer's disease.

Yan Wei1, Zhaohong Xie1, Jianzhong Bi1, Zhengyu Zhu1.   

Abstract

Anti-inflammatory effects of bone marrow mesenchymal stem cells (BMSCs) on mice with Alzheimer's disease (AD) were investigated. Twenty amyloid precursor protein (APP)/presenilin-1 (PS1) double transgenic mice were randomly divided into two groups: the AD control group and the stem cell treatment group. The normal control group consisted of 10 non-transgenic mice. The stem cell treatment group was injected with BMSCs, and the two control groups were given the same volume of normal saline. The Morris water maze test was used to compare the memory function of mice, and the relative expression levels of β-site APP cleaving enzyme 1 (BACE1) and α-2-macroglobulin (A2M) genes were detected by fluorescence quantitative polymerase chain reaction (qPCR). Amyloid β (Aβ)1-42 content in brain tissues of mice and inflammatory cytokines, interleukin (IL)-1, IL-2, IL-10, tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ) were detected using enzyme-linked immunosorbent assay (ELISA). Compared with that in the AD control group, the escape latency in the water maze in the stem cell treatment group was shortened, the time of crossing the ring for the first time was decreased, but the frequency of crossing the ring was increased (P<0.05). Aβ1-42 content in the AD control group was higher than that in the stem cell treatment group and the normal control group (P<0.05). The relative expression level of BACE1 gene in the stem cell treatment group was lower than that in the AD control group (P<0.05), but that of A2M gene was increased (P<0.05). At 14 days after treatment, the contents of IL-1, IL-2, TNF-α and IFN-γ in blood in the stem cell treatment group were lower than those in the AD control group (P<0.05). Human BMSCs can ameliorate the symptoms of AD by decreasing the levels of inflammatory cytokines and regulating the expression of Aβ-related genes.

Entities:  

Keywords:  Alzheimer's disease; amyloid precursor protein/presenilin-1 mouse; bone marrow mesenchymal stem cells; inflammatory cytokines

Year:  2018        PMID: 30542456      PMCID: PMC6257159          DOI: 10.3892/etm.2018.6857

Source DB:  PubMed          Journal:  Exp Ther Med        ISSN: 1792-0981            Impact factor:   2.447


Introduction

Alzheimer's disease (AD) is a neurological type of neurodegenerative disease. It is mainly caused by aging and apoptosis of nerve cells affected by internal and external environmental factors, and a large amount of degeneration and loss of dopaminergic neurons. AD mainly occurs in the elderly at the age of >65 years and is manifested as memory loss and cognitive problems resulting in serious inconvenience of their daily lives (1,2). In Europe, the United States and other countries, AD is a major neurological disease that causes the death of the elderly. The number of deaths from AD in China also ranks in the top 10 countries (3). At present, popular drugs used in the treatment of AD on the market do not substantially improve the loss of dopaminergic neurons, especially in patients with advanced AD (4). However, AD patients are often accompanied by an increase of inflammatory cytokines in the body and brain, and inflammation is considered by many researchers as one of the key causes of neurodegenerative diseases that trigger AD and dementia. Therefore, many traditional Chinese and Western anti-inflammatory drugs also appear in various studies on treating AD (5,6). Stem cells can be renewable and differentiable, and thus considered to be a promising material for the treatment of AD. Bone marrow mesenchymal stem cells (BMSCs) have been characterized as having a wide range of sources, easiness to draw materials, simple to culture and difficult in tumor formation in vivo, thereby differentiating them into dopaminergic neurons in brain tissues to make up for the loss of cells caused by AD, thus fundamentally treating AD. (7–9). In this study, the improvement of AD symptoms by BMSCs and the effects of BMSCs on in vivo inflammatory cytokines were observed and investigated through studying AD mice.

Materials and methods

Experimental animals

A total of 20 amyloid precursor protein (APP)/presenilin-1 (PS1) double transgenic mice (Beijing Biocytogen Co., Ltd., Beijing, China) were randomly divided into two groups: the AD control group (n=10) and the stem cell treatment group (n=10). Ten C57 black 6 bred in the Jackson Laboratory (C57BL/6J) non-transgenic mice were included in the normal control group. The mice were kept in cages with controlled temperature and light cycles (24°C and 12/12 light cycles) and had free access to food and water. The humidity was 60±10%. There were no statistically significant differences in age, sex and weight among the three groups of mice (P>0.05), and the data were comparable (Table I). The study was approved by the Ethics Committee of the Second Hospital of Shandong University (Jinan, China).
Table I.

Comparisons of general data among the three groups of mice (mean ± SD).

GroupnAge (weeks)Weight (g)Sex (male/female)
Normal control107.2±0.324.2±4.25/5
AD control107.1±0.223.4±3.95/5
Treatment106.9±0.223.7±3.85/5
P-value>0.05>0.05>0.05

AD, Alzheimer's disease.

Reagents

Cell culture Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS) and trypsin powder were purchased from Gibco (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNAiso Plus, PrimeScript® Real-Time (RT) Reagent kit with genomic deoxyribonucleic acid (gDNA) Eraser (Perfect Real-time) and SYBR® Premix Ex Taq™ II [Tli ribonuclease H (RNase H) Plus] were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). Enzyme-linked immunosorbent assay (ELISA) kits were purchased from Zhongshan Golden Bridge Biotechnology Co., Ltd. (Zhongshan Golden Bridge Biotechnology Co., Ltd.; OriGene Technologies, Beijing, China).

Separation and culture of BMSCs

Operations were conducted under aseptic environment. A 200-mesh sieve was used for cell screening. The parameters of cell and tissue centrifugation for the separation process were 800 × g/min at 4°C for 3 min. Phosphate-buffered saline (PBS) was used for thorough washing, as the clearer and cleaner the solution was the better the results would be. The washing was conducted each time for approximately ≥2 times. In addition, the number of living cells was determined using trypan blue staining, and counted using a cell counter. Cell culture reagents, consumable items and environmental conditions (temperature and humidity) were strictly adjusted in accordance with the characteristics of the cell growth. After the cell growth area reached ~80% of the total area of the flat bottom, the passage could be performed, and the passage ratio would be determined according to the amount of cells required for the next experiment.

Determination by flow cytometry

Flow cytometry detection (10): i) the test objects were the fourth-generation BMSCs. ii) The centrifugation parameters for the preparation of the flow cytometry samples were 800 × g/min at 4°C for 3 min. iii) The cells were mixed and suspended in PBS, and the number of cells was 1–2×106. ⅳ) Surface antibody (4 µl) was added in each tube and incubated at 25°C for 30 min avoiding light. v) PBS (500 µl) was used to wash the cells. Then the cells were collected and centrifuged at 800 × g for 5 min. The supernatant was discarded. vi) PBS (500 µl) was added for resuspension. Then the cells were added to the BD FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). ⅶ) The cell flow rate was moderate, and the cell population conforming to the characteristics was selected according to forward scatters (FSCs) and side scatters (SSCs). ⅷ) The voltage was adjusted according to the graphics to make the graphics easy to observe and for better display results.

Tail intravenous injection of mice

BMSC suspension was prepared. Stem cells for intravenous injection were digested from the adherent state to the suspended state, and washed with normal saline, followed by centrifugation at 800 × g/min at 4°C for 3 min twice and filtering by a cell sieve filter once. Then the filtered stem cell suspension was immediately placed on ice and transferred to the intravenous injection site. The mice aged 7 weeks were fixed in a rat fixator, and 1 ml suspension containing 2×106 stem cells was injected using a 2.5 ml syringe each time. The normal control group and the AD control group were injected with the same volume of normal saline once a day.

Morris water maze test (11)

The experiment began on the 22nd day after gavage treatment and was divided into two stages. In the first stage, mice received 3-day continuous training twice a day, and the experimental time was not recorded. In the second phase, mice underwent the fixed-position cruise for 5 consecutive days, once daily: the mice were placed facing the wall of the pool and put in pools from different quadrants to record the time they searched for the underwater surface hidden in the third quadrant (escape latency). If the mice could not find the platform within 90 sec, they were guided to the platform for a rest for 30 sec, and the latency was recorded as 90 sec. At the end of fixed-position cruise, the space exploration experiment was conducted for 1 day: the platform was withdrawn, the time occupied by the mice in the third quadrant within the 90 sec and the frequency of crossing the original platform were recorded. Morris water maze image automatic monitoring and processing system was applied to collect and process data.

Indicator detection

ELISA kits were used to detect the contents of interleukin (IL)-1, IL-2, IL-10, tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ) in plasma as well as amyloid β (Aβ)1–42 content in brain tissues. The relative expression levels of β-site APP cleaving enzyme 1 (BACE1) and α-2-macroglobulin (A2M) genes were detected by fluorescence quantitative polymerase chain reaction (qPCR), and the primer sequences are shown in Table II. mRNA levels were determined by Bio-Rad CFX96 fluorescence qPCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The thermocycling conditions were as follows: 5°C for 5 min; 94°C for 10 sec, 50°C for 30 sec, 40 cycles; 72°C for another 10 min. The image was analyzed with GraphPad Prism statistical software (GraphPad Software, Inc., La Jolla, CA, USA).
Table II.

qPCR primer sequences.

Gene namePrimer sequence
BACE1F: 5′-3′CAAGTTCATTACCTCCCTA
R: 5′-3′CGACTGACCCTTGTGG
A2MF: 5′-3′AAAGGAAATCGCATCG
R: 5′-3′CATGTTCATTGTCACGGTTT
β-actinF: 5′-3′TCAGGTCATCACTATCGGCAAT
R: 5′-3′ACGCAAATGTGGGAAAGAAA

qPCR, quantitative polymerase chain reaction; BACE1, β-site APP cleaving enzyme 1; A2M, α-2-macroglobulin; F, forward; R, reverse.

Statistical methods

All data were processed using Statistical Product and Service Solutions (SPSS) 16.0 software (Cabit Information Technology Co., Ltd., Shanghai, China). Measurement data were expressed as mean ± SD, and the comparison of mean was conducted using t-test and one-way analysis of variance. The post hoc test used was LSD test. P<0.05 was considered to indicate a statistically significant difference.

Results

Separation and identification of BMSCs

BMSCs were successfully isolated. They were spindle-shaped and spirally arranged, and grew adhering to the culture dishes (Fig. 1). The obtained BMSCs were identified using a flow cytometer, which revealed that cluster of differentiation (CD)29, CD44 and CD90 were positive, whereas CD45 and human leukocyte antigen antigen-D-related (HLA-DR) were negative (Fig. 2).
Figure 1.

Separation and culture of BMSCs. There is no difference in cell morphology between cells at (A) P0 and those at (B) P4. BMSCs, bone marrow mesenchymal stem cells; P0, passage 0; P4, passage 4.

Figure 2.

Identification results of BMSCs by a flow cytometer. CD29, CD44 and CD90 are positive, whereas CD45 and HLA-DR are negative. BMSCs, bone marrow mesenchymal stem cells; CD, cluster of differentiation; HLA-DR, human leukocyte antigen antigen-D-related.

Comparison of memory function using the water maze test

From day 2, the escape latency in the water maze in the stem cell treatment group was shortened compared with that in the AD control group (P<0.05). From day 3, there was no significant difference in the escape latency between the stem cell treatment group and the normal control group (P>0.05) (Fig. 3). The space exploration experiment showed that the time of crossing the ring for the first time in the stem cell treatment group was shorter than that in the AD control group (P<0.05), but the frequency was higher than that in the AD control group (P<0.05) (Table III).
Figure 3.

Effect of stem cells on the escape latency time of AD mice. *P<0.05, compared with the AD group. #P<0.05, compared with the cell treatment group. AD, Alzheimer's disease.

Table III.

The time of crossing the ring for the first time and its frequency (mean ± SD).

GroupTime of crossing the ring for the first time (sec)Frequency of crossing the ring (times)
Normal control16.32±9.324.8±1.3
AD control27.32±12.431.5±0.4
Stem cell treatment22.38±11.54[a]4.9±0.9[a]

P<0.05, compared with the AD control group. AD, Alzheimer's disease.

Aβ1–42 content and the relative expression levels of BACE1 and A2M genes in brain tissues

Aβ1–42 content in the AD control group was higher than that in the stem cell treatment group and the normal control group (P<0.05). The expression level of BACE1 in the stem cell treatment group was lower than that in the AD control group (P<0.05), while the expression level of A2M gene was increased in the stem cell treatment group compared to that in the AD control group (P<0.05) (Fig. 4).
Figure 4.

Detection of Aβ1–42 content via ELISA reveals that Aβ1–42 content in the AD control group is higher than that in the stem cell treatment and the normal control group (*P<0.05). Detection of the relative expression levels of BACE1 and A2M genes in brain tissues was performed using qPCR. The expression level of BACE1 in the stem cell treatment group is lower than that in the AD control group (*P<0.05), while the expression level of A2M gene was increased in the stem cell treatment group compared to that in the AD control group (*P<0.05). Aβ, amyloid β; AD, Alzheimer's disease; BACE1, β-site APP cleaving enzyme 1; A2M, α-2-macroglobulin; qPCR, quantitative polymerase chain reaction.

Comparison of inflammatory cytokines between the three groups

At 14 days after treatment, the contents of IL-1, IL-2, TNF-α and IFN-γ in blood in the stem cell treatment group were lower than those in the AD control group (P<0.05) (Table IV).
Table IV.

Comparison of several inflammatory cytokines in blood (mean ± SD).

GroupIL-1 (pg/ml)IL-2 (pg/ml)TNF-α (pg/ml)IFN-γ (pg/ml)IL-10 (pg/ml)
Normal control43.36±12.3259.33±21.3249.55±19.3439.44±15.2154.22±24.54
AD control143.21±34.21121.32±12.43109.22±22.12108.23±35.2141.21±19.32
Stem cell treatment53.21±19.43[a]67.35±21.11[a]55.21±20.32[a]44.43±19.54[a]47.43±17.43

P<0.05, compared with the AD control group. AD, Alzheimer's disease; IL, interleukin; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ.

Discussion

AD has been characterized as a refractory disease worldwide and has long been a hotspot in the field of neuromedicine. Research on AD mainly focuses on the pathogenesis and treatment of the disease. The pathogenesis of AD is very complex, and the two currently-recognized theories are the reduction of cholinergic and the increase of Aβ protein (12,13). AD is treated mainly through drug actions on different neurotransmitter systems, so as to enhance the high-level activities of the central nervous system, reduce the symptoms occurring in the disease process, and delay the further development of dementia. However, most of the oral drugs exert certain effects in the treatment of AD in the early stage, but in the late stage, due to the large-scale decline of nerve cells in the hippocampus, drugs cannot fully pass the blood-brain barrier and exert few effects (14). In addition, AD is often accompanied by an increase of inflammatory cytokines, causing other complications, so it is also treated by a combination of multiple drugs (15). As a bioactive material, stem cells can be transformed into nerve cells by environmental stimuli to make up for the lack of original nerve cells, and they can be expanded in vivo to some extent so that the therapeutic effects endure longer. Besides, MSCs can also secrete factors that promote cell growth such as epidermal growth factor (EGF), vascular endothelial growth factor (VEGF) and insulin-like growth factor (IGF) under the action of paracrine and reduce the complications such as inflammation caused by AD (16,17). Compared with embryonic stem cells, BMSCs, as a type of stem cells, are easier to obtain and to be isolated and cultured in vitro, and it is not easy for them to form tumors. Therefore, BMSCs have the advantages of low cost and high safety. Han and He (18) treated Aβ modeling Sprague-Dawley (SD) rats with MSCs in the umbilical cord. At 14 days after injection, the water maze test demonstrated that the frequency of mice in stem cell treatment group crossing the target quadrant was significantly increased. Some studies have pointed out that if stem cells are induced into neural stem cells in vitro, the direct injection of neural stem cells into the hippocampus of the brain will be more effective in the treatment of AD, but the difficulty lies in how to inject neural stem cells into a designated place and avoid trauma to the brain (19). It was found in the study of Farina et al (20) that BMSCs can attenuate the memory impairment of Aβ deposits and stimulate the signal pathways of the primary tumor, change the expression levels of relevant genes, and inhibit apoptosis of nerve cells. Other studies have revealed that the occurrence process of AD is accompanied by inflammation, which can cause inflammation responses, resulting in changes in the in vivo contents of some factors associated with the verification. This study showed that the escape latency in the water maze in the stem cell treatment group was shortened, the time of mice crossing the ring for the first time was reduced, and the frequency of crossing the ring was increased. The relative expression level of BACE1 gene in the stem cell treatment group was decreased compared with that in the AD control group, while that of A2M gene was increased. The increased level of BACE1 gene would produce more encephaloclastic Aβ proteins, while A2M gene encoded inhibitors that eliminated Aβ proteins, and helped eliminate Aβ proteins. However, at 14 days after treatment, Aβ1–42 content in brain tissues in the stem cell treatment group was lower than that in the AD control group, and the expression levels of IL-1, IL-2, TNF-α and IFN-γ in blood and hippocampus tissues in the stem cell treatment group were lower than those in the AD control group. In conclusion, human BMSCs can ameliorate the symptoms of AD by decreasing the level of inflammatory cytokines and regulating the expression levels of Aβ-related genes.
  20 in total

1.  Curcumin Micelles Improve Mitochondrial Function in a Mouse Model of Alzheimer's Disease.

Authors:  S Hagl; M Heinrich; A Kocher; C Schiborr; J Frank; G P Eckert
Journal:  J Prev Alzheimers Dis       Date:  2014

2.  Impaired IL-17 Production in Gut-Residing Immune Cells of 5xFAD Mice with Alzheimer's Disease Pathology.

Authors:  Tamara Saksida; Ivan Koprivica; Milica Vujičić; Stanislava Stošić-Grujičić; Milka Perović; Selma Kanazir; Ivana Stojanović
Journal:  J Alzheimers Dis       Date:  2018       Impact factor: 4.472

Review 3.  Toward a Rational Design to Regulate β-Amyloid Fibrillation for Alzheimer's Disease Treatment.

Authors:  Xu Han; Gefei He
Journal:  ACS Chem Neurosci       Date:  2018-01-03       Impact factor: 4.418

Review 4.  Nutrition: Review on the Possible Treatment for Alzheimer's Disease.

Authors:  Benson O A Botchway; Masania K Moore; Faith O Akinleye; Ishwari C Iyer; Marong Fang
Journal:  J Alzheimers Dis       Date:  2018       Impact factor: 4.472

5.  A New Era: Disease Modifying Alzheimer Disease Prevention Trials.

Authors:  R J Bateman; J C Morris
Journal:  J Prev Alzheimers Dis       Date:  2014

6.  Dietary supplementation with Allium hirtifolium and/or Astragalus hamosus improved memory and reduced neuro-inflammation in the rat model of Alzheimer's disease.

Authors:  Zahra Bahaeddin; Asal Yans; Fariba Khodagholi; Shamim Sahranavard
Journal:  Appl Physiol Nutr Metab       Date:  2017-12-20       Impact factor: 2.665

Review 7.  Emerging Roles of Sirtuin 6 in Alzheimer's Disease.

Authors:  Nurul Fatihah Mohamad Nasir; Azalina Zainuddin; Shaharum Shamsuddin
Journal:  J Mol Neurosci       Date:  2017-12-19       Impact factor: 3.444

8.  A selenium species in cerebrospinal fluid predicts conversion to Alzheimer's dementia in persons with mild cognitive impairment.

Authors:  Marco Vinceti; Annalisa Chiari; Marcel Eichmüller; Kenneth J Rothman; Tommaso Filippini; Carlotta Malagoli; Jennifer Weuve; Manuela Tondelli; Giovanna Zamboni; Paolo F Nichelli; Bernhard Michalke
Journal:  Alzheimers Res Ther       Date:  2017-12-19       Impact factor: 6.982

9.  Investigation of the neuroprotective effects of Lycium barbarum water extract in apoptotic cells and Alzheimer's disease mice.

Authors:  Xinyu Hu; Yidi Qu; Qiubo Chu; Wenshu Li; Jian He
Journal:  Mol Med Rep       Date:  2017-12-19       Impact factor: 2.952

Review 10.  Exploring the Association between Alzheimer's Disease, Oral Health, Microbial Endocrinology and Nutrition.

Authors:  Alice Harding; Ulrike Gonder; Sarita J Robinson; StJohn Crean; Sim K Singhrao
Journal:  Front Aging Neurosci       Date:  2017-12-01       Impact factor: 5.750

View more
  16 in total

Review 1.  Advances in stem cell therapy in Alzheimer's disease: a comprehensive clinical trial review.

Authors:  Nikolaos Karvelas; Samuel Bennett; Georgios Politis; Nikolaos-Iasonas Kouris; Christo Kole
Journal:  Stem Cell Investig       Date:  2022-02-21

Review 2.  The Role of Mesenchymal Stem Cells in Regulating Astrocytes-Related Synapse Dysfunction in Early Alzheimer's Disease.

Authors:  Cong Liu
Journal:  Front Neurosci       Date:  2022-06-21       Impact factor: 5.152

3.  Intracerebral Injection of Extracellular Vesicles from Mesenchymal Stem Cells Exerts Reduced Aβ Plaque Burden in Early Stages of a Preclinical Model of Alzheimer's Disease.

Authors:  Chiara A Elia; Matteo Tamborini; Marco Rasile; Genni Desiato; Sara Marchetti; Paolo Swuec; Sonia Mazzitelli; Francesca Clemente; Achille Anselmo; Michela Matteoli; Maria Luisa Malosio; Silvia Coco
Journal:  Cells       Date:  2019-09-10       Impact factor: 6.600

Review 4.  Therapeutic Properties of Mesenchymal Stem Cell on Organ Ischemia-Reperfusion Injury.

Authors:  Joan Oliva
Journal:  Int J Mol Sci       Date:  2019-11-05       Impact factor: 5.923

Review 5.  The Role of Chronic Inflammatory Bone and Joint Disorders in the Pathogenesis and Progression of Alzheimer's Disease.

Authors:  Robert A Culibrk; Mariah S Hahn
Journal:  Front Aging Neurosci       Date:  2020-12-07       Impact factor: 5.750

Review 6.  Stem Cell Therapy for Pediatric Traumatic Brain Injury.

Authors:  Dana Lengel; Cruz Sevilla; Zoe L Romm; Jimmy W Huh; Ramesh Raghupathi
Journal:  Front Neurol       Date:  2020-12-02       Impact factor: 4.003

Review 7.  Microglia in Alzheimer's Disease: The Role of Stem Cell-Microglia Interaction in Brain Homeostasis.

Authors:  Saeid Bagheri-Mohammadi
Journal:  Neurochem Res       Date:  2020-11-10       Impact factor: 3.996

8.  Anti-inflammatory protein TSG-6 secreted by bone marrow mesenchymal stem cells attenuates neuropathic pain by inhibiting the TLR2/MyD88/NF-κB signaling pathway in spinal microglia.

Authors:  Hao Yang; Lingmin Wu; Huimin Deng; Yuanli Chen; Huanping Zhou; Meiyun Liu; Shaochen Wang; Li Zheng; Lina Zhu; Xin Lv
Journal:  J Neuroinflammation       Date:  2020-05-11       Impact factor: 8.322

Review 9.  An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells.

Authors:  Dinh-Toi Chu; Thuy Nguyen Thi Phuong; Nguyen Le Bao Tien; Dang Khoa Tran; Vo Van Thanh; Thuy Luu Quang; Dang Tien Truong; Van Huy Pham; Vo Truong Nhu Ngoc; Thien Chu-Dinh; Kushi Kushekhar
Journal:  Int J Mol Sci       Date:  2020-01-21       Impact factor: 5.923

10.  Intramuscular Injection of Bone Marrow Stem Cells in Amyotrophic Lateral Sclerosis Patients: A Randomized Clinical Trial.

Authors:  Emilio Geijo-Barrientos; Carlos Pastore-Olmedo; Pedro De Mingo; Miguel Blanquer; Joaquín Gómez Espuch; Francisca Iniesta; Natalia García Iniesta; Ana García-Hernández; Carlos Martín-Estefanía; Laura Barrios; José M Moraleda; Salvador Martínez
Journal:  Front Neurosci       Date:  2020-03-24       Impact factor: 4.677

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.