Mohsina Khan1, Dattatraya Muzumdar2, Anjali Shiras3. 1. National Centre for Cell Science (NCCS), SP Pune University Campus, Ganeshkhind, Pune, 411007, India. 2. Department of Neurosurgery, King Edward Memorial Hospital, Parel, Mumbai 400 012. India. 3. National Centre for Cell Science (NCCS), SP Pune University Campus, Ganeshkhind, Pune, 411007, India. Electronic address: anjali@nccs.res.in.
Abstract
Glioblastoma (GBM) is one of the most aggressive and lethal types of brain tumor. Despite the advancements in conventional or targeted therapies, median survival of GBM patients is less than 12 months. Amongst various signaling pathways aberrantly activated in glioma, active Wnt/β-catenin signaling pathway is one of the crucial oncogenic players. β-catenin, an important mediator of Wnt signaling pathway, gets phosphorylated by GSK3β complex. Phosphorylated β-catenin is specifically recognized by β-Trcp1, a F-box/WD40-repeat protein and with the help of Skp1 it plays a central role in recruiting phosphorylated β-catenin for degradation. In GBM, expression of β-TrCP1 and its affinity for β catenin is reported to be very low. Hence, we investigated whether any other members of the E3 ubiquitin ligase family could be involved in degradation of nuclear β-catenin. We here report that FBXO16, a component of SCF E3 ubiquitin ligase complex, is an interacting protein partner for β-catenin and mediates its degradation. Next, we show that FBXO16 functions as a tumor suppressor in GBM. Under normal growth conditions, FBXO16 proteasomally degrades β-catenin in a GSK-3β independent manner. Specifically, the C-terminal region of FBXO16 targets the nuclear β-catenin for degradation and inhibits TCF4/LEF1 dependent Wnt signaling pathway. The nuclear fraction of β-catenin undergoes K-48 linked poly-ubiquitination in presence of FBXO16. In summary, we show that due to low expression of FBXO16, the β-catenin is not targeted in glioma cells leading to its nuclear accumulation resulting in active Wnt signaling. Activated Wnt signaling potentiates the glioma cells toward a highly proliferative and malignant state.
Glioblastoma (GBM) is one of the most aggressive and lethal types of brain tumor. Despite the advancements in conventional or targeted therapies, median survival of GBM patients is less than 12 months. Amongst various signaling pathways aberrantly activated in glioma, active Wnt/β-catenin signaling pathway is one of the crucial oncogenic players. β-catenin, an important mediator of Wnt signaling pathway, gets phosphorylated by GSK3β complex. Phosphorylated β-catenin is specifically recognized by β-Trcp1, a F-box/WD40-repeat protein and with the help of Skp1 it plays a central role in recruiting phosphorylated β-catenin for degradation. In GBM, expression of β-TrCP1 and its affinity for β catenin is reported to be very low. Hence, we investigated whether any other members of the E3 ubiquitin ligase family could be involved in degradation of nuclear β-catenin. We here report that FBXO16, a component of SCF E3 ubiquitin ligase complex, is an interacting protein partner for β-catenin and mediates its degradation. Next, we show that FBXO16 functions as a tumor suppressor in GBM. Under normal growth conditions, FBXO16 proteasomally degrades β-catenin in a GSK-3β independent manner. Specifically, the C-terminal region of FBXO16 targets the nuclear β-catenin for degradation and inhibits TCF4/LEF1 dependent Wnt signaling pathway. The nuclear fraction of β-catenin undergoes K-48 linked poly-ubiquitination in presence of FBXO16. In summary, we show that due to low expression of FBXO16, the β-catenin is not targeted in glioma cells leading to its nuclear accumulation resulting in active Wnt signaling. Activated Wnt signaling potentiates the glioma cells toward a highly proliferative and malignant state.
Gliomas are the most common and lethal tumors of the Central Nervous System (CNS) [1]. The grade IV glioma known as glioblastoma (GBM) is very fatal, with median survival of patients being only about 12–14 months [2]. GBM is considered to be driven by a subpopulation of cells known as “Glioma Stem Cells” (GSC) that perpetuate tumor growth and are considered to be responsible for therapy resistance [3]. Molecular events including mutations in IDH1 [4] and TP53 [5] genes, loss of heterozygosity (LOH) with 1p/19q co-deletion [6], loss of tumor suppressive miRNAs [7] and activation of oncogenic miRNAs [8] are some of the important mediators known to contribute to glioma initiation and progression.Several developmental signaling pathways like Notch or Hedgehog pathways are shown to be deregulated in glioma [9], [10], [11]. Our earlier studies have reported the role of Wnt signaling pathway in glioma progression, wherein we have shown that an over activated Wnt signaling pathway mediated through stabilization of β-catenin is an important driver in propelling glioma progression and pathogenesis [12]. Several studies have extensively elaborated on mechanisms of active Wnt signaling in cancer and have shown that the deregulation is mediated mainly through the destruction complex- AXIN, APC, GSK-3β and β-TrCP1 [13]. Under normal conditions in the absence of a Wnt signal, this complex is constitutively active, phosphorylating specific residues in the N-terminus of β-catenin, leading to its ubiquitination and subsequent proteasomal degradation [14], [15]. Later, the SCF-β-TrCP complex mediates destruction of cytoplasmic fraction of β-catenin [16], [17]. The SKP1–Cullin–F-box protein (SCF) E3 ubiquitin ligase complex regulates multiple cellular processes through ubiquitination and subsequent degradation of target proteins.To understand the mechanisms that lead to nuclear stabilization of β-catenin, we generated a model system comprising of a pair of cell lines derived from single GBM tumor tissue. Interestingly, the parental cell line was non-tumorigenic in nature, whereas the spontaneously emerged clones were highly proliferative and showed malignant phenotypes. Using this system of paired cell lines, we delineated the events responsible for nuclear β-catenin stabilization. Our studies have led to the functional annotation of a member of FBXO family of proteins, FBXO16 as a tumor suppressor that is downregulated in GBM in a graded manner. Next, we provide evidence of a specific interaction of FBXO16 with an important mediator of Wnt signaling pathway, β-catenin and prove the significance of this interaction to glioma progression. Our data demonstrate that under physiological conditions, FBXO16 effectively targets β-catenin for degradation and thereby maintains Wnt Signaling in an OFF state. In contrast, in GBM tumors where the FBXO16 levels are low, β-catenin is stabilized and retained in the nucleus leading to a hyperactivated Wnt signaling. In summary, we demonstrate the role of FBXO16 as a tumor suppressor and unequivocally establish deregulated Wnt signaling as a main driver for oncogenesis in GBM.
Materials and Methods
Tumor Tissues and Patient-Derived Tumor Cell Lines
The glioma and epileptic tissue resection samples were obtained from AFMC Hospital, Pune and KEM Hospital, Mumbai. The use of clinical specimens was approved by the Institutional Ethics Committees (IEC) of NCCS, AFMC Hospital; Pune and KEM Hospital, Mumbai, India. Classification of tumor tissues into various glioma grades was performed by a neuropathologist by following the WHO classification system [18]. The cell lines used in this study were established from tumor tissues (Supplementary Table 1) by following the methods described by us earlier [19], [20].
RNA Extraction and Quantitative Real-Time PCR
The tissue samples were homogenized by using liquid nitrogen and total RNA was extracted using TRIzol Reagent (Invitrogen) using manufacturer's instructions. Quantitative RT-PCR (qRT-PCR) was performed using Power-up SYBR Green (Applied Biosystems, Carlsbad, CA) using QuantStudio 6 Flex Real-Time PCR system (Thermo-Scientific). Primer sequences used are listed in Supplementary Table 2.
Plasmids and Transient Transfections
The FBXO16 constructs viz.: FLAG-FBXO16 full length (WT), C-terminal deletion (ΔC), FBOX domain deletion (ΔF) and N-terminal deletion (ΔN) mutants were procured from Genscript; (Piscataway, NJ, USA). Three individual shRNAs to FBXO16 were designed using the RNAi Consortium shRNA library, BROAD institute, Cambridge, MA, and cloned into pLKO.1-TRC plasmid. The sequences of shRNAs designed for targeting FBXO16 transcripts were as follows:sh1 sense - 5′GCTATTGAATGACCGGGTATTCTCGAGAATACCCGGTCATTCAATAGC.3′ antisense - 5′ GCTATTGAATGACCGGGTATTCTCGAGAATACCCGGTCATTCAATAGC 3′,sh2 sense 5′ GATCTGGAAGAAGCACTATATCTCGAGATATAGTGCTTCTTCCAGATC 3′,antisense 5′ GATCTGGAAGAAGCACTATATCTCGAGATATAGTGCTTCTTCCAGATC 3′ and for.sh3 sense 5′ CAAGCTTCCAAGGGTGTTATCCTCGAGGATAACACCCTTGGAAGCTTG 3′,antisense 5′ CAAGCTTCCAAGGGTGTTATCCTCGAGGATAACACCCTTGGAAGCTTG 3′.The sequences of Scrambled shRNA used as sh control were,sense 5′ GCGATCGTAATCACCCGAGTGCTCGAGCACTCGGGTGATTACGATCGC 3′,antisense 5′ GCGATCGTAATCACCCGAGTGCTCGAGCACTCGGGTGATTACGATCGC 3′.The cells were transfected with Polyethyleneimine 25000 (PEI) following manufacturer's protocol [21]. Knockdown efficiencies of individual shRNA sequences were determined by using Western blotting (Supplementary Fig. 3).
Supplementary Figure 3
Knockdown efficiency of FBXO16 shRNA. Western blot of three different pLKO shRNA constructs to knockdown FBXO16 indicated as sh1-FBXO16, sh2-FBXO16 and sh3-FBXO16. Scrambled sequence used was against LacZ and indicated as control.
Stable Cell Line Generation
To generate stable cell lines, control (RANG-2-EV) and FBXO16 overexpressing cells (RANG-2-FLAG-FBXO16) were selected with 750 μg/ml Geneticin (Sigma; San Diego, CA). Three independent clones over expressing FBXO16 were selected.
Western Blotting
Whole cell lysate proteins were prepared using M-per mammalian protein extraction reagent (Thermo Scientific, Waltham, MA, USA) with 1×protease inhibitor cocktail (Sigma) following manufacturer's instructions. Protein expression was detected using ECL-plus kit (Thermo Scientific).
Antibodies
SOX2 (Cat #3579), β-catenin (Cat #9562S & 9582S), FLAG (Cat # 9146S), ϒH2AX (Cat #9712S), H2AX (Cat #2595S) and K-48 (Cat # 8081) were purchased from Cell Signaling, Danvers, MA, USA. C-MYC (Cat # ab32072), Nestin (Cat # ab27952), Ki67 (Cat # ab16667) and Cyclin D1 (Cat # ab16663) were purchased from Abcam, Cambridge, MA, USA. Three individual antibodies to FBXO16 with Cat # NBP1–57614, AV53227 and PA566195 were procured from Novus Biologicals; Littleton, CO, USA, Sigma; St. Louis, Missouri, United States and Pierce; Waltham, MA, USA. The other antibodies used were Ub (Cat # Sc8017, Santa Cruz, Paso Robles, CA; USA), tubulin (Cat # T9026, Sigma) and actin (Cat # 691002, MP Biomedicals, CA, USA).
Immunoprecipitation
Immunoprecipitation was performed using total cell lysates using procedure described earlier [22]. Also, cells were fractionated into nuclear and cytoplasmic fractions. Briefly, the cell lysates were individually immunoprecipitated overnight using antibodies to FBXO16, β-catenin or FLAG-tag. Antigen–antibody complexes were pulled-down using Dynabeads (Invitrogen) following manufacturer's instructions. Proteins were resolved on 10% SDS-PAGE gel and transferred onto PVDF membranes and detected using ECL-plus kit (Thermo Scientific).
Confocal Microscopy
Cells were seeded onto coverslips, transfected with pcDNA-3.1-FLAG (Control), FLAG-FBXO16 (Genscript; Piscataway, NJ) and RFP-β-catenin constructs using PEI. [21] Confocal imaging was performed using method described earlier [23]. For immunohistochemical analyses, tissue sections were deparaffinized by heating in microwave and washed with xylene and alcohol. This was followed by antigen retrieval and staining performed using method described earlier [24]. Images were acquired using Leica TCS SP5II (Leica Microsystems CMS, GmbH, Germany) confocal microscope.
Ubiquitination Assay
Cells were transfected with pcDNA-3.1-FLAG (Control) and pcDNA-3.1-FLAG-FBXO16 (FLAG-FBXO16) constructs for performing the endogenous ubiquitination assay. Cells were treated with 10 μM proteasomal inhibitor MG132 drug (Sigma, Cat #474787) for 6 h before harvesting. Nuclear fractions were immunoprecipitated with β-catenin antibody and probed using ubiquitin antibody.
Wound Healing Assay
The assay was performed using the same protocol as described earlier [24]. Wound healing capabilities were measured using Image J software.
Topflash/Fopflash Reporter Assay
Cells were seeded in a 6-well plate and cultured until confluency. Cells were transfected with either 2 μg of TOPFlash (TCF/LEF Reporter Plasmid) or FOPFlash (mutant, inactive TCF/LEF binding site) plasmids using either FBXO16 or control plasmids. Luciferase activities were measured using Dual-Luciferase Reporter (DLR) assay system following manufacturer's instructions (Promega, Wisconsin USA).
Tumorigenicity Assay
The animal studies were approved by the Institutional Animal Ethics Committee (IAEC) of NCCS. For in vivo tumorigenicity assays, 1 × 106 of FLAG-control and FLAG-FBXO16-RANG-2 cells were injected subcutaneously into NOD-SCID mice. Tumor volumes were determined using the formula: 4/3 Π (major axis/22 × minor axis/2) over a 15 days period and tumor weight was measured using weighing balance.
Statistical Analyses
Data presented here represents: mean +/-SD or mean +/-SEM from at least 3 independent experiments. Statistical analysis was performed using a 1-way ANOVA followed by either Student's t-test or Fisher's exact test. Differences between groups were statistically significant at ∗P ≤ .05; ∗∗P ≤ .01; ∗∗∗P ≤ .001. Graphs were plotted using Sigma Plot 11.
Results
Expression of FBXO16 is Downregulated in GBM tumors
Previously, we have reported development of several model systems to study tumor progression in GBM [25], [26]. Here, we describe generation of a yet another model system comprising of two sequentially developed long-term cultures RANG-1 and RANG-2 from a recurrent glioblastoma tumor tissue. Till p14, the RANG-1 culture showed the presence of flat, elongated neuronal-like cells (Figure 1A). However, at p15 several spontaneously immortalized clones dominated the plate. These spontaneously immortalized clones comprised of individual cells that were small, refractive and exhibited rapid proliferation (Figure 1B). Amongst the various developed clones, we chose two clones from RANG-1 and expanded them into continuously proliferating cell lines RANG-2 and RANG-3. These two immortalized cell lines showed greater than 4 folds increase in cell proliferation (Figure 1C) as compared to RANG-1 cell line. Considering similar growth attributes of the two cell lines, RANG-2 and RANG-3 and to avoid repeatability, we are here presenting data of only one cell line i.e. RANG-2. In line with the MTT assay, the RANG-2 cells showed intense positivity for Ki67 expression (Figure 1D, E). Interestingly, the RANG-2 cells showed presence of stem cell features like the ability to form neurospheres under serum-free condition (Figure 1F), positivity for expression of stem cell markers like CD133 and SOX2 (Figure 1G) and high migratory potential in scratch assay (Figure 1H-I). In contrast, the RANG-1 cells were devoid of neuropshere and tumor forming potential, did not express any of the stem cell markers like CD133 and SOX2 and expressed GFAP (Supplementary Figure 1A). More importantly, the RANG-2 cells formed tumors of size of about 800mm3 +/− 71.6 (mean volume +/− SEM) in NOD-SCID mice within 15 days of injection (Figure 1J-K) highlighting the tumorigenic potential of RANG-2 cell line.
Figure 1
FBXO16 is downregulated in patient derived glioblastoma cell lines. (A) Phase contrast micrograph of RANG-1 cells at p2, Scale bar: 25 μm. (B) Image of a spontaneously immortalized clone at p15 of RANG-1 cell line, Scale bar: 25 μm (C) MTT (proliferation assay) of two spontaneously transformed clones (RANG-2 RANG-3) compared with RANG-1. Data represented as mean (n = 3) +/− SD. (D&E) Confocal imaging of Ki67 expression in RANG-1 and RANG-2 cells and their quantification. (F) Neurosphere assay at 10×, Scale bar: 125 μm. (G) Confocal imaging of neurospheres for expression of CD133 and SOX2 at 60× magnification Scale bar: 30 μm. (H&I) Migration assay and its quantification at 0 h and 20 h in RANG-1 and RANG-2 cells, Scale bar: 50 μm. Data represents mean +/− SD (n = 3); P ≤ .001. (J) Tumorigenicity assay in NOD-SCID mice with RANG-2 cells. (K) Tumor kinetics of RANG-1 and RANG-2 cells injected subcutaneously in NOD-SCID mice. Data represented as mean (n = 5) +/− SEM. (L) Kaplan–Meier curve showing survival in days of glioma patients classified on the basis of their FBXO16 levels using the Rembrandt Database. (M) qRT-PCR analysis for FBXO16 expression in glioma patients of various grades (n = 11). The FBXO16 expression was normalized to that of normal brain (n = 4). 18S rRNA served as an internal control. (N) Western blotting showing FBXO16 levels in patient derived glioma cell lines. β-actin serves as loading control. (O) Immunohistochemistry analysis of FBXO16 expression in patients representative of LGG, Gliosarcoma and Glioblastoma tumors. Scale bar: 100 μm.
Supplementary Figure 1
Characterization of patient derived RANG-1 GBM cell-line and Histopathology of FBXO16 in patient derived GBM tissues. (A) Confocal imaging of glioblastoma markers: CD133, GFAP and SOX2. Marker expressions were visualized using Alexa-594 (red) or Alexa-488 (green) secondary antibodies and nuclei were counterstained with DAPI in RANG-1 cells. 60× magnification, Scale bar: 20 μm. (B) Immunohistochemical analyses of FBXO16 expression in HGG (n = 2). FBXO16 was visualized using Alexa-488 (green) secondary antibody and nuclei were counterstained with DAPI. Scale bar: 30μm.
Next, we mined data from Rembrandt database for expression of FBXO16 in glioma tumor tissues to determine whether there was any correlation between its expression and patient survival. Kaplan-Meir survival curve indicated that gliomapatients with lower levels of FBXO16 survived for 10 years and 9 months, whereas patients with higher FBXO16 levels survived beyond 20 years (Figure 1L). This implied that FBXO16 was important for increasing patient survival and hence we determined levels of FBXO16 at the mRNA level in glioma tumor tissues and compared these levels to that of normal brain by qRT-PCR. A distinct downregulation in levels of FBXO16 was seen in GBM tumor tissues (n = 11) as compared to normal brain tissues (mean, n = 4) (P ≤ .001) (Figure 1M). Further analyses at the protein level using Western blotting indicated downregulation of FBXO16 in RANG-2 cells (Figure 1N). Interestingly, a similar pattern of expression was evident in clinical specimens of glioma tumor tissues, wherein using immunohistochemical analysis we found nuclear positivity for FBXO16 expression in low-grade gliomas but a weaker expression in high-grade gliomas (Figure 1O and Supplementary Figure 1B). In conclusion, a strong downregulation of FBXO16 occurs in high-grade glioma (HGG) suggesting its tumor suppressive role in GBM.
Aberrant Wnt Signaling Pathway in RANG-2 Cells
To determine whether lowered expression of FBXO16 was related to an activated Wnt signaling in RANG-2 cells, we evaluated expression of β-catenin in a panel of patient-derived glioblastoma cell lines. We found an inverse correlation between levels of FBXO16 protein to that of β-catenin in these cell lines (Figure 2A). The RANG-2 cell line demonstrated least level of FBXO16 but showed highest amount of β-catenin (Figure 2A). This reciprocity in levels was also evident in knockdown experiments wherein decrease in FBXO16 levels caused increase in β-catenin levels (Figure 2B). In a parallel experiment, wherein we over-expressed FBXO16 in GBM cell lines, there was a concomitant decrease in β-catenin levels in each of them (Figure 2C). Importantly, the β-catenin expression observed in RANG-2 cells (highly tumorigenic) was predominantly nuclear indicating an activated Wnt signaling in these cells. Levels of nuclear β-catenin got significantly diminished upon ectopic expression of FBXO16 (Figure 2D-E). The non-tumorigenic RANG-1 and HEK293T showed a pre-dominant membranous staining for β-catenin as compared to highly tumorigenic cell lines RANG-2, NSG-K16 and HNGC-2 that showed high accumulation of β-catenin in their nucleus (Supplementary Figure 2). Ectopic expression of FLAG-FBXO16 construct caused dose-dependent downregulation of β-catenin in RANG-2 cells followed by a concomitant decrease in levels of β-catenin downstream target genes like Cyclin D1 [27] and c-Myc [28] (Figure 2F). These downstream target genes are transcriptionally activated as a result of LEF1/TCF4 interaction with β-catenin [29]. We also determined whether the LEF1/TCF4 mediated transcriptional inhibition resulted due to downregulation of β-catenin and was an outcome of FBXO16 overexpression. Hence, an immuno-precipitation assay was performed in RANG-2 cells to analyze interaction of LEF1 with β-catenin. Expectedly, under conditions of low FBXO16 expression, more β-catenin was bound to LEF1 in contrast to cells that had higher levels of FBXO16 (Figure 2G). Similarly, a significantly attenuated TOPFlash luciferase promoter (containing TCF/LEF binding sites for β-catenin) activity was seen in GBM cells upon FBXO16 overexpression (Figure 2H). Collectively, these results establish β-catenin as a novel interactor of FBXO16 and further demonstrate that its nuclear accumulation is an outcome of donwregulated FBXO16 in GBM.
Figure 2
FBXO16 regulates β-catenin and its target genes in glioblastoma. (A) Protein levels of FBXO16 and β-catenin in patient derived GBM cell lines. β-actin serves as loading control. (B) β-catenin expression in RANG-2 cells transiently transfected with control and pLKO-FBXO16 sh2RNA. (C) Expression of β-catenin upon overexpression with FLAG-FBXO16, FLAG serves as transfection control and β-actin serves as loading control. (D) Confocal imaging and its quantitation for β-catenin in FLAG-FBXO16 overexpressing RANG-2 cells. Expression of β-catenin and FLAG-tagged FBXO16 was visualized using Alexa-594 (red) and Alexa-488 (green) secondary antibodies and counterstained with DAPI. (E) β-catenin expression quantitated with densitometry, data represented as mean +/-SD, P ≤ .001. (F) RANG-2 cells were transfected with FBXO16 construct (0, 3 μg and 6 μg) and analyzed for expression of β-catenin, c-Myc and Cyclin D1 by Western blotting. β-actin serves as loading control. (G) IP showing interaction of LEF1 with β-catenin. The inputs for IP LEF1, FLAG and β-actin are shown in lower panel. (H) Super 8×TOPFlash luciferase promoter assay in RANG-2 cells overexpressing FBXO16 construct. The bar graph represents luciferase activity in cells transfected with FBXO16 construct. Cells transfected with pcDNA3.1 served as control. Values represent mean +/− SD (n = 3); P ≤ .001.
Supplementary Figure 2
Localization of β-catenin in various cell-lines. Confocal imaging of β-catenin localization in patient derived HNGC-2, NSGK-16, RANG-1, RANG-2 and HEK cell line. β-catenin localization visualized using Alexa-488 (green) secondary antibodies and counterstained with DAPI in RANG-1 cells. 60× magnification, Scale bar: 10μm.
FBXO16 Proteasomally Degrades β-catenin Independent of GSK-3β
There were no changes in levels of β-catenin upon FBXO16 overexpression in the RANG-2 cells at the transcriptional level (Figure 3A). The cytoplasmic pool of β-catenin is tightly regulated via phosphorylation by the ‘destruction complex’ in the absence of Wnt signaling [30]. Hence, we sought to investigate the mechanism of β-catenin destruction mediated through FBXO16 in RANG-2 cells. We transfected RANG-2 cells with FBXO16 followed by MG132 treatment and compared the expression of β-catenin with the untransfected control cells. Here, the control RANG-2 cells showed high expression of β-catenin, which was substantially decreased upon FBXO16 overexpression (Figure 3B-C). Instead with MG132, the FBXO16 overexpressing cells showed stabilization of β-catenin indicating that its degradation occurred through the proteasome pathway. Since, the FBOX family of proteins mediate their function by interacting with substrate proteins, we analyzed whether β-catenin was one of the interacting protein partners for FBXO16. An immunoprecipitation assay demonstrated a robust interaction of FBXO16 with β-catenin in both RANG-2 and LN229 cell lines (Figure 3D). Subsequently, this interaction was responsible for β-catenin degradation as FBXO16 overexpression prevented β-catenin accumulation in the nucleus of transformed cells.
Figure 3
FBXO16 mediates proteasomal degradation of β-catenin. (A) RT-PCR analyses for expression of β-catenin. β-actin served as loading control. (B) Expression of β-catenin in cells treated with MG132. (C) Quantification of protien levels of β-catenin. Data represents mean +/− SD (n = 3); P ≤ .001 (D) IP showing interaction of FBXO16 with β-catenin in whole cell lysates in RANG-2 and LN-229 cells. (E) Western blotting for β-catenin in cells treated with 5 μM of GSK-3β inhibitor BIO in Control and FLAG-FBXO16 transfected RANG-2 cells. (F) Quantification of protein levels of β-catenin. Data represents mean +/− SD; P ≤ .01 & P ≤ .001 (G&H) Confocal imaging for expression of β-catenin and its quantification in FLAG-FBXO16 or control-EV transfected RANG-2 cells. Cells were treated either with 20 mM of NaCl or LiCl solution (20 mM). Expression of β-catenin and FLAG-tagged FBXO16 was visualized using Alexa-594 (red) and Alexa-488 (green) secondary antibodies and counterstained with DAPI. Quantification data represents mean +/− SD; P ≤ .01 and P ≤ .001 (I) β-catenin expression in cells, co-transfected with FBXO16 and RFP–β-catenin deletion mutant (ΔS33, ΔS37, ΔT43) in HNGC-2 cells. (J) β-catenin expression in cells co-transfected with FBXO16 and RFP–β-catenin deletion mutant (ΔS33, ΔS37, ΔT43) in RANG-2 cells.
FBXO16 is downregulated in patient derived glioblastoma cell lines. (A) Phase contrast micrograph of RANG-1 cells at p2, Scale bar: 25 μm. (B) Image of a spontaneously immortalized clone at p15 of RANG-1 cell line, Scale bar: 25 μm (C) MTT (proliferation assay) of two spontaneously transformed clones (RANG-2 RANG-3) compared with RANG-1. Data represented as mean (n = 3) +/− SD. (D&E) Confocal imaging of Ki67 expression in RANG-1 and RANG-2 cells and their quantification. (F) Neurosphere assay at 10×, Scale bar: 125 μm. (G) Confocal imaging of neurospheres for expression of CD133 and SOX2 at 60× magnification Scale bar: 30 μm. (H&I) Migration assay and its quantification at 0 h and 20 h in RANG-1 and RANG-2 cells, Scale bar: 50 μm. Data represents mean +/− SD (n = 3); P ≤ .001. (J) Tumorigenicity assay in NOD-SCID mice with RANG-2 cells. (K) Tumor kinetics of RANG-1 and RANG-2 cells injected subcutaneously in NOD-SCID mice. Data represented as mean (n = 5) +/− SEM. (L) Kaplan–Meier curve showing survival in days of gliomapatients classified on the basis of their FBXO16 levels using the Rembrandt Database. (M) qRT-PCR analysis for FBXO16 expression in gliomapatients of various grades (n = 11). The FBXO16 expression was normalized to that of normal brain (n = 4). 18S rRNA served as an internal control. (N) Western blotting showing FBXO16 levels in patient derived glioma cell lines. β-actin serves as loading control. (O) Immunohistochemistry analysis of FBXO16 expression in patients representative of LGG, Gliosarcoma and Glioblastoma tumors. Scale bar: 100 μm.FBXO16 regulates β-catenin and its target genes in glioblastoma. (A) Protein levels of FBXO16 and β-catenin in patient derived GBM cell lines. β-actin serves as loading control. (B) β-catenin expression in RANG-2 cells transiently transfected with control and pLKO-FBXO16 sh2RNA. (C) Expression of β-catenin upon overexpression with FLAG-FBXO16, FLAG serves as transfection control and β-actin serves as loading control. (D) Confocal imaging and its quantitation for β-catenin in FLAG-FBXO16 overexpressing RANG-2 cells. Expression of β-catenin and FLAG-tagged FBXO16 was visualized using Alexa-594 (red) and Alexa-488 (green) secondary antibodies and counterstained with DAPI. (E) β-catenin expression quantitated with densitometry, data represented as mean +/-SD, P ≤ .001. (F) RANG-2 cells were transfected with FBXO16 construct (0, 3 μg and 6 μg) and analyzed for expression of β-catenin, c-Myc and Cyclin D1 by Western blotting. β-actin serves as loading control. (G) IP showing interaction of LEF1 with β-catenin. The inputs for IP LEF1, FLAG and β-actin are shown in lower panel. (H) Super 8×TOPFlash luciferase promoter assay in RANG-2 cells overexpressing FBXO16 construct. The bar graph represents luciferase activity in cells transfected with FBXO16 construct. Cells transfected with pcDNA3.1 served as control. Values represent mean +/− SD (n = 3); P ≤ .001.FBXO16 mediates proteasomal degradation of β-catenin. (A) RT-PCR analyses for expression of β-catenin. β-actin served as loading control. (B) Expression of β-catenin in cells treated with MG132. (C) Quantification of protien levels of β-catenin. Data represents mean +/− SD (n = 3); P ≤ .001 (D) IP showing interaction of FBXO16 with β-catenin in whole cell lysates in RANG-2 and LN-229 cells. (E) Western blotting for β-catenin in cells treated with 5 μM of GSK-3β inhibitor BIO in Control and FLAG-FBXO16 transfected RANG-2 cells. (F) Quantification of protein levels of β-catenin. Data represents mean +/− SD; P ≤ .01 & P ≤ .001 (G&H) Confocal imaging for expression of β-catenin and its quantification in FLAG-FBXO16 or control-EV transfected RANG-2 cells. Cells were treated either with 20 mM of NaCl or LiCl solution (20 mM). Expression of β-catenin and FLAG-tagged FBXO16 was visualized using Alexa-594 (red) and Alexa-488 (green) secondary antibodies and counterstained with DAPI. Quantification data represents mean +/− SD; P ≤ .01 and P ≤ .001 (I) β-catenin expression in cells, co-transfected with FBXO16 and RFP–β-catenin deletion mutant (ΔS33, ΔS37, ΔT43) in HNGC-2 cells. (J) β-catenin expression in cells co-transfected with FBXO16 and RFP–β-catenin deletion mutant (ΔS33, ΔS37, ΔT43) in RANG-2 cells.The GSK-3β kinase is involved in phosphorylation of β-catenin at Serine 33, Serine 37 and Threonine 41 residues and the phosphorylated β-catenin is targeted for ubiquitination followed by degradation by β-TrCP1 [31]. To determine whether FBXO16 mediated degradation of β-catenin was GSK-3β dependent, we treated RANG-2 cells with GSK-3β inhibitor BIO (5 mM) [32]. Here, we found that cells treated with BIO showed significant reduction in β-catenin expression in FBXO16 overexpressing RANG-2 cells (Figure 3E-F). In a parallel experiment, RANG-2 cells were treated with another GSK-3β inhibitor, LiCl and a similar decrease in β-catenin expression was obtained in FBXO16 overexpressing cells (Figure 3G-H). These experiments confirmed that FBXO16 mediated degradation of β-catenin was GSK-3β independent. Next, we used a deletion mutant of RFP-β-catenin that lacked all the three GSK-3β phosphorylation sites at the Serine 33, Serine 37 and Threonine 41 residues and co-transfected it along with FLAG-FBXO16 construct in HNGC-2 (Figure 3I) and RANG-2 (Figure 3J) cell lines. We found that cells overexpressing RFP-β-catenin co-transfected with FBXO16 construct showed decreased β-catenin expression as compared to control vector co-transfected cells. These results establish a specific role of FBXO16 in proteasome-mediated degradation of β-catenin that is independent of GSK-3β.
FBXO16 Restrains Tumorigenic Potential by Degrading Nuclear β-catenin
The differential localization of β-catenin either to the nucleus, cytoplasm or to the cell membrane is a major determinant of Wnt activity [33]. Hence, to determine the fraction of β-catenin undergoing degradation, we performed subcellular fractionation assay. Overexpression of FBXO16 caused a substantial decrease in nuclear β-catenin, whereas the cytoplasmic β-catenin levels remained unchanged. This indicated that FBXO16 was selectively involved in degradation of nuclear β-catenin (Figure 4A). Similar findings were reiterated by confocal microscopy in RANG-2 cells co-transfected with FBXO16 and RFP-β-catenin constructs, wherein we found 4 fold reduction in accumulation of RFP-β-catenin speckles in the nucleus of FBXO16 overexpressing cells as compared to control cells (Figure 4B-C). A specific interaction of FBXO16 with nuclear β-catenin in RANG-2 cells was confirmed by the IP assay (Figure 4D). For this, the nuclear lysate proteins from the EV and FBXO16 overexpressing cells were immunoprecipitated with β-catenin and immunoblotted with K48-linked antibody. Being a component of E3 ligase, FBXO16 overexpression also enhanced ubiquitination of nuclear β-catenin and K48-linked poly-ubiquitination of β-catenin (Figure 4E-F). Importantly, FBXO16 regulated proteasome mediated degradation of the nuclear pool of β-catenin. The effects of β-catenin on cellular proliferation and metastasis are mediated through its various downstream target proteins like Cyclin D1, c-Myc and matrix metalloproteinases [34], [35], [36]. The FBXO16 over-expressing cells showed weaker expression of Ki67 (Figure 4G) and a significantly reduced migration of about 30% (P ≤ .008) as compared to control cells indicating tumor suppressive effect of FBXO16 (Figure 4H, I). More importantly, the cells upon FBXO16 overexpression exhibited significantly reduced tumors as compared with control cells (Figure 4J and Supplementary Figure 4A & B). Collectively, these results establish role of FBXO16 as a tumor suppressor in GBM.
Figure 4
FBXO16 proteasomally degrades nuclear β-catenin and functions as tumor suppressor. (A) β-catenin level in cytoplasmic vs nuclear fractions of control and FLAG-FBXO16 transfected RANG-2 cells. α-tubulin served as cytoplasmic control and H2AX served as nuclear control in subcellular-fractionation. (B) Confocal imaging for β-catenin in RANG-2 cells co-transfected with RFP–β-catenin (Δ S33, Δ S37, Δ T43) and FLAG-FBXO16. Expression of FLAG-tagged FBXO16 was visualized using Alexa-488 (green) secondary antibody; RFP-labeled β-catenin was visualized at 594 wavelength and counterstained with DAPI. (C) Quantification data represents mean +/− SD; P ≤ .001. (D) Immunoprecipitation assay showing interaction of FBXO16 with β-catenin in cytoplasmic vs nuclear fractions. α-tubulin and H2AX serve as controls. IP showing (E) poly-ubiquitination and (F) K48-linked polyubiquitination of nuclear β-catenin, in RANG-2 cells transfected with control vector or FBXO16 construct. (G) Confocal staining of Ki67 in FBXO16 overexpressing RANG-2 cells. Expression of Ki67and FLAG-tagged FBXO16 was visualized using Alexa-594 (red) and Alexa-488 (green) secondary antibodies and counterstained with DAPI. 60× magnification, Scale bar: 20 μm. (H) Cell migration assay in RANG-2 cells transfected with control vector or FBXO16 construct at 4× magnification, Scale bar: 50 μm. (I) Quantification of cell migration, data as mean +/− SD (n = 3); P ≤ .008 (J) Subcutaneous tumors in SCID mice with control vector and FLAG-FBXO16-RANG-2 cells.
Supplementary Figure 4
Bar graph representing tumor volume and weight in NOD-SCID. Comparison of Tumorigenic potential of control and FBXO16 stable RANG-2 cells. Cells injected subcutaneously in NOD-SCID mice (A) bar graph representing mean tumor volumes (B) representing mean tumor weight +/− SD (n=3) P ≤ 0.01.
C-Terminal of FBXO16 Interacts With β-Catenin And Mediates Its Degradation
To map the region of FBXO16 that was responsible for interacting with β-catenin, we used several deletion mutants of FBXO16 protein. Besides the full-length (292 aa) FBXO16 protein, we used three FBXO16 deletion mutants corresponding to deletions at the N-terminus (1 to 85aa), F box (86 to 132aa) and C-terminal (133 to 292aa) (Figure 5A) regions of the FBXO16 protein and performed IP studies. The nuclear fraction of cells overexpressing these deletion mutants were immunoprecipitated with the FLAG antibody and probed with β-catenin. We found that the C-terminal deletion mutant of FBXO16 completely lost its interaction with β-catenin, whereas cells transfected with F-box and N-terminal deletion mutants were able to interact with β-catenin (Figure 5B). We also performed a Super 8×TOPFlash luciferase promoter assay with each of the deletion mutants of FBXO16 and compared the luciferase activity of the mutants to that with the full-length FBXO16. Interestingly, we found that the N-terminal deleted FBXO16 significantly showed lower luciferase activity as compared to the C-terminal and F-box domain deleted mutants (Figure 5C). This data indicated that the C-terminal region of FBXO16 was required for interaction with β-catenin. Furthermore, we analyzed the effect of each of these mutants on β-catenin levels. Interestingly, it was only the N-terminal deleted cells that had lower levels of β-catenin. This specified that the N-terminal of FBXO16 was not involved in degradation of β-catenin but in the ubiquitination of β-catenin; whereas the C-terminal region was important for interaction with β-catenin. Therefore, levels of β-catenin were unaffected by overexpression of C-terminal and F-box deletion constructs (Figure 5D). Similar findings were represented in confocal staining of β-catenin expression in cells transfected with the deletion mutants of FBXO16, wherein we observed that the N-terminal deletion mutant of FBXO16 showed significantly downregulated β-catenin staining in the nucleus as compared to the C-terminal and F-box deletion mutants (Figure 5E). A schematic representation of β-catenin stabilization in the context of tumor suppressive role of FBXO16 in GBM is represented in Figure 5F. Collectively, these results indicate that the F-box domain is involved in the ubiquitination whereas the C-terminal region is required for its interaction with β-catenin.
Figure 5
Interacting region of FBXO16 with β-catenin. (A) Schematic representation of deletion mutants for N-terminal, C-terminal and F-Box region along with full length FBXO16 gene. (B) IP of individual FBXO16 deletion mutants and β-catenin in nuclear fractions. (C) Super 8× TOPFlash luciferase promoter activities in RANG-2 FBXO16 (WT) compared with RANG-2-deletion mutant cells, Data represents as mean +/− SD (n = 3); P ≤ .001 (D) RANG-2-FBXO16 deletion mutants analyzed for β-catenin using Western blotting. H2AX served as loading control. (E) Confocal imaging for β-catenin in RANG-2-FBXO16-FLAG deletion mutants. β-catenin was visualized using Alexa-594 (red) and FLAG-tagged FBXO16 mutant's staining was visualized using Alexa-488 (green) secondary antibodies and counterstained with DAPI. (F) Schematic representation of the mechanism of β-catenin stabilization in glioblastoma.
FBXO16 proteasomally degrades nuclear β-catenin and functions as tumor suppressor. (A) β-catenin level in cytoplasmic vs nuclear fractions of control and FLAG-FBXO16 transfected RANG-2 cells. α-tubulin served as cytoplasmic control and H2AX served as nuclear control in subcellular-fractionation. (B) Confocal imaging for β-catenin in RANG-2 cells co-transfected with RFP–β-catenin (Δ S33, Δ S37, Δ T43) and FLAG-FBXO16. Expression of FLAG-tagged FBXO16 was visualized using Alexa-488 (green) secondary antibody; RFP-labeled β-catenin was visualized at 594 wavelength and counterstained with DAPI. (C) Quantification data represents mean +/− SD; P ≤ .001. (D) Immunoprecipitation assay showing interaction of FBXO16 with β-catenin in cytoplasmic vs nuclear fractions. α-tubulin and H2AX serve as controls. IP showing (E) poly-ubiquitination and (F) K48-linked polyubiquitination of nuclear β-catenin, in RANG-2 cells transfected with control vector or FBXO16 construct. (G) Confocal staining of Ki67 in FBXO16 overexpressing RANG-2 cells. Expression of Ki67and FLAG-tagged FBXO16 was visualized using Alexa-594 (red) and Alexa-488 (green) secondary antibodies and counterstained with DAPI. 60× magnification, Scale bar: 20 μm. (H) Cell migration assay in RANG-2 cells transfected with control vector or FBXO16 construct at 4× magnification, Scale bar: 50 μm. (I) Quantification of cell migration, data as mean +/− SD (n = 3); P ≤ .008 (J) Subcutaneous tumors in SCID mice with control vector and FLAG-FBXO16-RANG-2 cells.Interacting region of FBXO16 with β-catenin. (A) Schematic representation of deletion mutants for N-terminal, C-terminal and F-Box region along with full length FBXO16 gene. (B) IP of individual FBXO16 deletion mutants and β-catenin in nuclear fractions. (C) Super 8× TOPFlash luciferase promoter activities in RANG-2 FBXO16 (WT) compared with RANG-2-deletion mutant cells, Data represents as mean +/− SD (n = 3); P ≤ .001 (D) RANG-2-FBXO16 deletion mutants analyzed for β-catenin using Western blotting. H2AX served as loading control. (E) Confocal imaging for β-catenin in RANG-2-FBXO16-FLAG deletion mutants. β-catenin was visualized using Alexa-594 (red) and FLAG-tagged FBXO16 mutant's staining was visualized using Alexa-488 (green) secondary antibodies and counterstained with DAPI. (F) Schematic representation of the mechanism of β-catenin stabilization in glioblastoma.
Discussion
GBM inadvertently suffers from high levels of intra-tumoral heterogeneity. The cell line RANG-1 developed by us from a recurrent glioblastoma tumor tissue contains a mixed population of cells with varying growth potential. RANG-1 cells upon continuous passaging (p15) showed development of several spontaneously immortalized clones. We chose two clones and established long term cell lines from them and termed them as RANG-2 and RANG-3 cell lines respectively. These cell lines consisted of small, refractive cells that were highly tumorigenic as they were able to successfully engraft in the mouse subcutaneously. In the present study, we analyzed differences between the spontaneously immortalized cells like RANG-2, RANG-3 with pre-malignant cells like RANG-1 and thereby determined mechanisms that contribute to their malignant potential. In line with our previous studies, wherein we had documented role of activated Wnt signaling in glioma progression [37], we here proceeded to investigate whether there was specific activation of β-catenin mediated Wnt pathway in RANG-2 cells. We observed a specific enrichment of β-catenin in the nucleus of RANG-2 cells demonstrating that an activated Wnt signaling was responsible for development of its highly malignant state. Besides RANG-2 cells, nuclear localization of β-catenin was also evident in other high-grade glioma cell lines like in the HNGC-2 and NSG-K16 cell-lines as well. Cytoplasmic level of β-catenin is tightly regulated via its phosphorylation by the ‘destruction complex’ consisting of APC, AXIN and GSK-3β [38]. β-TrCP1, a member of the FBXW family is known to degrade the phosphorylated β-catenin by ubiquitin-proteasome pathway in cytoplasm [39]. Lower levels of β-TrCP protein in glioma cells as compared to normal brain is associated with poor survival in patients with glioma [40]. However, the affinity of β-TrCP1 for β catenin is very low. This suggests that there could also be other members of the E3 ubiquitin ligase family that may be involved in degradation of nuclear β-catenin. In a search to determine whether other members of F-box family proteins might also be involved in degradation of nuclear β-catenin, we hit upon a hereto unidentified member of the FBXO family, FBXO16 as a novel interactor of β-catenin. Here, we show that FBXO16 is causal for targeting β-catenin for degradation and maintaining Wnt signaling in an Off State. We also report a tumor suppressive role for FBXO16 in GBM. The various proteins of the FBXO family are known to exert either an oncogenic or tumor suppressive function, depending on whether the deregulated degradation was occurring for oncoproteins or tumor suppressors by SCF E3 ubiquitin ligases [41]. Out of 36 well-characterized FBOX proteins, many were shown to be downregulated in various cancers like FBXO1 in hepatocellular carcinomas. Mice with homozygous FBXO1 deletion were found to be embryonically lethal and showed developmental abnormalities. Multiple reports have indicated role of various members of FBXO family in degradation of several substrates leading to tumorigenesis. To name a few are Cyclin B1 for FBXO1, Cyclin D1 for FBXO4 and HURP a cell cycle regulated oncogene for FBXO7. However, there are no reports regarding functional characterization of FBXO16 in cancer except a cytogenetic study in humanBRCA2-mutated breast cancer xenografts, where a loss of 8p21.1 chromosome loci is reported [42]. To date, this is one of our initial reports for functional annotation of FBXO16 in GBM pathogenesis. In summary, our results indicate that activation of Wnt signaling mediated through failure of β-catenin degradation occurring through its interaction with FBXO16 is a pivotal mechanism of oncogenesis in GBM.
Conclusions
Amongst the various FBXO proteins identified in cancer, we conclusively show that FBXO16 functions as a tumor suppressor in GBM. The growth suppression is mediated by the degradation of nuclear β-catenin by a novel FBOX protein, FBXO16. We show that the C-terminal region of FBXO16 is important for interaction specifically with nuclear β-catenin and its degradation. Lower FBXO16 expression is associated with poorer prognosis in malignant gliomapatients, suggesting that strategies aiming at restoring FBXO16 levels could open up new vistas in GBM therapy.The following are the supplementary data related to this article.
Supporting Information Table 1
Details of surgically resected glioma tumor tissues and epileptic tissues obtained from KEM and AFMC Hospital, Pune
Supporting Information Table 2
List of primers used in semi-quantitative and RT-PCRCharacterization of patient derived RANG-1 GBM cell-line and Histopathology of FBXO16 in patient derived GBM tissues. (A) Confocal imaging of glioblastoma markers: CD133, GFAP and SOX2. Marker expressions were visualized using Alexa-594 (red) or Alexa-488 (green) secondary antibodies and nuclei were counterstained with DAPI in RANG-1 cells. 60× magnification, Scale bar: 20 μm. (B) Immunohistochemical analyses of FBXO16 expression in HGG (n = 2). FBXO16 was visualized using Alexa-488 (green) secondary antibody and nuclei were counterstained with DAPI. Scale bar: 30μm.Localization of β-catenin in various cell-lines. Confocal imaging of β-catenin localization in patient derived HNGC-2, NSGK-16, RANG-1, RANG-2 and HEK cell line. β-catenin localization visualized using Alexa-488 (green) secondary antibodies and counterstained with DAPI in RANG-1 cells. 60× magnification, Scale bar: 10μm.Knockdown efficiency of FBXO16 shRNA. Western blot of three different pLKO shRNA constructs to knockdown FBXO16 indicated as sh1-FBXO16, sh2-FBXO16 and sh3-FBXO16. Scrambled sequence used was against LacZ and indicated as control.Bar graph representing tumor volume and weight in NOD-SCID. Comparison of Tumorigenic potential of control and FBXO16 stable RANG-2 cells. Cells injected subcutaneously in NOD-SCID mice (A) bar graph representing mean tumor volumes (B) representing mean tumor weight +/− SD (n=3) P ≤ 0.01.
Authors: Geng Wu; Guozhou Xu; Brenda A Schulman; Philip D Jeffrey; J Wade Harper; Nikola P Pavletich Journal: Mol Cell Date: 2003-06 Impact factor: 17.970
Authors: Rajani Rajbhandari; Braden C McFarland; Ashish Patel; Magda Gerigk; G Kenneth Gray; Samuel C Fehling; Markus Bredel; Nicolas F Berbari; Hyunsoo Kim; Margaret P Marks; Gordon P Meares; Tanvi Sinha; Jeffrey Chuang; Etty N Benveniste; Susan E Nozell Journal: Oncotarget Date: 2015-07-10