| Literature DB >> 30517867 |
Anthony J Bainor1, Siddharth Saini2, Alexander Calderon1, Raquel Casado-Polanco1, Belén Giner-Ramirez1, Claudia Moncada1, David J Cantor1, Amanda Ernlund3, Larisa Litovchick2, Gregory David4.
Abstract
The mammalian DREAM complex is responsible for the transcriptional repression of hundreds of cell-cycle-related genes in quiescence. How the DREAM complex recruits chromatin-modifying entities to aid in its repression remains unknown. Using unbiased proteomics analysis, we have uncovered a robust association between the chromatin-associated Sin3B protein and the DREAM complex. We have determined that genetic inactivation of Sin3B results in the de-repression of DREAM target genes during quiescence but is insufficient to allow quiescent cells to resume proliferation. However, inactivation of APC/CCDH1 was sufficient for Sin3B-/- cells, but not parental cells, to re-enter the cell cycle. These studies identify Sin3B as a transcriptional corepressor associated with the DREAM complex in quiescence and reveals a functional cooperation between E2F target repression and APC/CCDH1 in the negative regulation of cell-cycle progression.Entities:
Keywords: DREAM; E2F; Sin3; cell cycle; quiescence
Mesh:
Substances:
Year: 2018 PMID: 30517867 PMCID: PMC6324198 DOI: 10.1016/j.celrep.2018.11.024
Source DB: PubMed Journal: Cell Rep Impact factor: 9.423
Figure 1.Identification of Sin3B’s Canonical and Additional Interactors
(A) Normalized peptide-spectrum match (PSM) values of canonical and additional interactors. PSM % is the PSM value of each protein normalized to Sin3B signal, related as a percentage. RPD3L, large Sin3 complex; RPD3S, small Sin3 complex.
(B) Co-immunoprecipitations with an anti-FLAG antibody of whole-cell extracts from T98G cells transfected with the indicated plasmids. Immunoblots were performed using the indicated antibodies. 10% input. IP, immunoprecipitation.
(C) Co-immunoprecipitations with an anti-FLAG antibody of whole-cell extracts from T98G cells transiently transfected with Sin3B-FLAG or empty vector (EV). Immunoblots were performed using the indicated antibodies. 10% input. IP, immunoprecipitation.
Figure 2.Sin3B Interacts with the DREAM Complex
(A) Co-immunoprecipitation using an anti-LIN37 antibody of whole-cell extracts from human T98G cells (left) or mouse NIH 3T3 cells (right) transiently transfected with Sin3B-FLAG or empty vector (EV). Immunoblots were performed using the indicated antibodies. 10% input. IP, immunoprecipitation. Top arrow, endogenous Sin3B; bottom arrow, exogenous Sin3B. IgG, immunoglobulin G.
(B) Co-immunoprecipitation on endogenous proteins using an anti-Sin3B antibody of whole-cell extracts from T98G cells either asynchronously growing (Async) or serum starved for 72 hr (T0). Immunoblots were performed using the indicated antibodies. 10% input. IP, immunoprecipitation; IgG, immunoglobulin G.
(C) Left panels: western blot of whole-cell extracts from T98G cells asynchronously growing (Async), serum starved for 72 hr (T0), and serum starved for 72 hr and released for 6–26 hr (T6 to T26) with the indicated antibodies. Right panel: co-immunoprecipitation on endogenous proteins using an anti-Sin3B antibody of same whole-cell extracts. 10% input. IP, immunoprecipitation; IgG, immunoglobulin G.
(D) Co-immunoprecipitation on endogenous proteins using an anti-Lin9 antibody (left panel) or Lin37 antibody (right panel) from growing NIH 3T3 (wild-type [WT]) or Rb-p107-p130 triple knockout spontaneously immortalized mouse embryonic fibroblasts (MEFs) (TKO). Immunoblots were performed using the indicated antibodies. 10% input. IP, immunoprecipitation; IgG, immunoglobulin G.
Figure 3.Sin3B Is Required for the Repression of DREAM Target Genes
(A) Western blot on whole-cell lysate from T98G cells of the indicated genotypes 0 (T0), 10 (T10), and 18 hr (T18) post serum addition and probed using the indicated antibodies.
(B) RNA from T98G cells harvested at the indicated time points was used for deep sequencing. Differential gene expression was performed comparing the averaged wild-type and Sin3B-deleted cell lines at T0. A heatmap representing the expression of the 429 significantly de-repressed genes at T0 is shown here at all time points.
(C) qRT-PCR for the indicated DREAM target genes in serum-starved Sin3B+/+ and Sin3B−/− T98G. n = 6(3 biological replicates using at least 2 independent cell lines per genotype for each point). Error bars represent SEM.
(D) qRT-PCR for the indicated DREAM target genes in serum-starved Sin3B+/+, Sin3B−/−, and Sin3B−/− T98G cells stably expressing FLAG-tagged Sin3B (n = 4 biological replicates).
(E) Chromatin immunoprecipitation (ChIP) in serum-starved Sin3B+/+ (red bars) and Sin3B−/− (blue bars) T98G cells for Sin3B (left), E2F4 (middle), or AcK9-H3/total H3 (right), at the promoter of the indicated genes. An antibody raised against c-kit is used as control (Irr Ab). Shown is the average of three independent biological replicates, and error bars represent SEM.
Figure 4.Sin3B Is Not Required for Entry into Quiescence
(A) Western blot for two independent Sin3B wild-type (left) and two independent Sin3B knockout (right) T98G cell lines. Immunoblotting was performed using 40 μg of whole-cell lysates probed using the indicated antibodies.
(B) Representative flow plots of KI67 staining in Sin3B+/+ and Sin3B−/− T98G cells. Cells were stained for KI67. Cycling, asynchronous, cycling cells; Sync, serumstarved cells for 72 hr; Isotype, isotype control antibody.
(C) Quantification of KI67 mean fluorescence intensity (MFI) from (A). n = 4 (2 independent cell lines per genotype with 2 experimental replicates each).
(D) Representative flow plots of BrdU staining in Sin3B+/+ and Sin3B−/− T98G cells. Cells were starved for 72 hr, pulsed for 2 hr with BrdU, and stained.
(E) Propidium iodide flow plots from (D).
(F) Quantification of (C). n = 4 (2 independent cell lines per genotype with 2 experimental replicates each).
(G) Representative flow plots of PI staining for Sin3B+/+ and Sin3B−/− T98G cells, synchronized in G0 by serum deprivation for 72 hr (T0) or release upon addition of serum for 10 hr (T10) or 18 hr (T18).
(H) Sin3B+/+ and Sin3B−/− T98G cells expressing FUCCI probes (RFP, pFUCCI-G1; GFP, pFUCCI-S/G2/M) were serum deprived for 72 hr and released into 10% serum for the indicated time, and the amount of RFP and GFP fluorescence was quantified. n = 6 (2 independent cell lines per genotype with 3 technical replicates each).
Figure 5.Inhibition of APC/CCDH1 Is Sufficient to Cause Quiescent Sin3B-Deleted Cells to Re-enter the Cell Cycle
(A) Immunoblots with the indicated antibodies of whole-cell lysate from two independent Sin3B+/+ and two independent Sin3B−/− T98G serum-starved cell lines infected with a doxycycline-inducible Emi1 expression vector. Cells were kept in no-serum conditions and doxycycline was added for 24 hr(T24) or 48 hr (T48).
(B) FUCCI-expressing T98G cells were serum deprived for 96 hr prior to doxycycline administration to induce EMI1 expression. Positivity for the FUCCI probes was quantified at 24 and 48 hr post doxycycline addition. Cells expressing Cdt1-RFP were counted as in G0/G1 phase, cells expressing geminin1-GFP as in S/G2/M phases, and cells expressing both Cdt1-RFP and gemini1-GFP as in G1/S. For each condition, at least two independent experiments with each cell line presented in (A) were performed.
(C) FUCCI expressing T98G cells were serum deprived for 96 hr prior to the addition of proTAME. Positivity for the FUCCI probes was quantified at 24 and 48 hr post doxycycline addition to inhibit APC/CCDH1 activity. *p < 0.05.
KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-Sin3B (clone H-4) | Santa Cruz | sc-13145; RRID: AB_628254 |
| Mouse monoclonal anti-Sin3B (clone H-5) | Santa Cruz | sc-55516; RRID: AB_2197789 |
| Rabbit polyclonal anti-Sin3B (AK-12) | Santa Cruz | sc-758 |
| Rabbit polyclonal anti-Sin3A (K-20) | Santa Cruz | sc-994; RRID: AB_2187760 |
| Rabbit polyclonal anti-Ki67 | Millipore Sigma | AB9260; RRID: AB_2142366 |
| Mouse monoclonal anti-α-Tubulin (clone DM1A) | Millipore Sigma | T9026; RRID: AB_477593 |
| Mouse monoclonal anti-α-Tubulin (clone DM1A) | Cell Signaling | 3873; RRID: AB_1904178 |
| Mouse monoclonal anti-Vinculin (clone hVIN-1) | Millipore Sigma | V9131: RRID: AB_477629 |
| Rabbit monoclonal anti-Vinculin (clone E1E9V) | Cell Signaling | 13901; RRID: AB_2728768 |
| Rabbit polyclonal anti-B-Myb (N-19) | Santa Cruz | sc-724; RRID: AB_631985 |
| Mouse monoclonal anti-Rb (clone Rb1) | Santa Cruz | Sc-73598; RRID: AB_1128965 |
| Mouse monoclonal anti-Rb2 (clone 10/Rb2) | BD Transduction Labs | 610262; RRID: AB_397657 |
| Rabbit polyclonal anti-p130 (C-20) | Santa Cruz | sc-317; RRID: AB_632093 |
| Mouse monoclonal anti-Cyclin D1 (clone DCS-6) | Millipore Sigma | CC12; RRID: AB_2070408 |
| Rabbit polyclonal anti-p27 Kip1 | Cell Signaling | 2552; RRID: AB_10693314 |
| Rabbit polyclonal anti-Cyclin A (C-19) | Santa Cruz | sc-596; RRID: AB_631330 |
| Rabbit polyclonal anti-Cyclin A2 | M. Pagano (NYU) | N/A |
| Mouse monoclonal anti-Cyclin E (clone HE12) | Santa Cruz | sc-247; RRID: AB_627357 |
| Rabbit polyclonal anti-Cyclin F (C-20) | Santa Cruz | sc-952; RRID: AB_2071212 |
| Rabbit polyclonal anti-p21 (C-19) | Santa Cruz | sc-397; RRID: AB_632126 |
| Mouse monoclonal anti-GAPDH (clone 6C5) | Millipore Sigma | MAB374; RRID: AB_2107445 |
| Rabbit monoclonal anti-HDAC1 (clone D5C6U) | Cell Signaling | 34589 |
| Rabbit polyclonal anti-HDAC3 | Cell Signaling | 2632; RRID: AB_331545 |
| Rabbit polyclonal anti-Histone H3 | Abcam | ab1791; RRID: AB_302613 |
| Rabbit polyclonal anti-αcetyl-Histone H3 (Lys9) | Millipore Sigma | 06–942; RRID: AB_310308 |
| Mouse monoclonal anti-E2F4 (clone D7) | Santa Cruz | sc-398543 |
| Goal polyclonal anti-cKit (M-14) | Santa Cruz | sc-1494; RRID: AB_631032 |
| Mouse monoclonal FITC anti-BrdU (clone 3D4) | BioLegend | 364103; RRID: AB_2564480 |
| Rat monoclonal APC anti-Ki67 (clone 16A8) | BioLegend | 652405; RRID: AB_2561929 |
| Rabbit anti-Lin9 | ( | N/A |
| Rabbit anti-Lin37 | ( | N/A |
| Mouse monoclonal Anti-FLAG (clone M2) | Millipore Sigma | F1804; RRID: AB_262044 |
| EZview Red ANTI-FLAG tag M2 Affinity Gel | Millipore Sigma | F2426; RRID: AB_2616449 |
| Mouse monoclonal anti-HA tag (clone 12CA5) | Millipore Sigma | SAB1305536; RRID: AB_514505 |
| Mouse monoclonal anti-HA tag (clone F-7) | Santa Cruz | sc-7392; RRID: AB_627809 |
| Mouse monoclonal anti-Myc tag (clone 9B11) | Cell Signaling | 2276; RRID: AB_331783 |
| Mouse monoclonal anti-V5 tag | ThermoFisher | R960–25; RRID: AB_2556564 |
| Rabbit polyclonal anti-V5 tag | Bethyl Laboratories | A190–120A; RRID: AB_67586 |
| Goat polyclonal IRDye 680RD anti-mouse IgG (H+L) | Li-Cor | 925–68070; RRID: AB_2651128 |
| Goat polyclonal IRDye 800CW anti-rabbit IgG (H+L) | Li-Cor | 925–32211; RRID: AB_2651127 |
| Purified Rat APC IgG2a κ Isotype | BioLegend | 400511; RRID: AB_2561754 |
| Purified Rabbit IgG | Bethyl Laboratories | P120–101; RRID: AB_479829 |
| Bacterial and vairus strains | ||
| DH5α ( | New England Biolabs | C2988J |
| Biological Samples | ||
| N/A | N/A | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Fetal Bovine Serum (Premium) | Atlanta Biologicals | S11150 |
| Donor Bovine Serum | Atlanta Biologicals | S11350 |
| FLAG Peptide | Millipore Sigma | F3290 |
| proTAME | Boston Biochem | I-440 |
| Propidium Iodide | Millipore Sigma | P4170 |
| Sodium Orthovanadate (Na3VO4) | NEB | P0758S |
| Sodium Fluoride (NaF) | Millipore Sigma | 201154 |
| Dithiothreitol (DTT) | ThermoFisher | R0861 |
| Phenylmethylsulfonyl fluoride (PMSF) | ThermoFisher | 36978 |
| cOmplete Protease Inhibitor Cocktail | Millipore Sigma | 11697498001 |
| Polyethylenimine, Linear (MW 25,000) | Polysciences, Inc | 23966 |
| 2-Mercaptoethanol | Millipore Sigma | M3148 |
| Protease Inhibitor Cocktail Set I | Millipore Sigma | 539131 |
| Phosphatase Inhibitor Cocktail Set II | Millipore Sigma | 524625 |
| Protein A Sepharose CL-4B | GE Healthcare | 17078001 |
| Criterion gels | BioRad | 5678083 |
| Hoechst 33342 | Millipore Sigma | B2261 |
| Sodium tetraborate | Millipore Sigma | 221732 |
| Trichostatin A | Millipore Sigma | T8552 |
| Critical Commercial Assays | ||
| DC Protein Assay kit | Bio-Rad | 5000111 |
| BCA Protein Assay Kit | ThermoFisher | 23225 |
| RNeasy Mini Kit | QIAGEN | 74104 |
| FITC BrdU Flow kit | BD Pharmingen | 559619 |
| ReliaBLOT IP/Western Blot | Bethyl Laboratories | WB120 |
| Deposited Data | ||
| RNA-Seq | This work | GEO: GSE121857; |
| Experimental Models: Cell Lines | ||
| Human: T98G | ATCC | CRL-1690 |
| T98G Sin3B WT (D11) | This work | N/A |
| T98G Sin3BKO (G6) | This work | N/A |
| T98G Sin3BKO (B5) | This work | N/A |
| T98G + EV (pcDNA3.1 + transient transfection) | This work | N/A |
| T98G + Sin3B-FLAG (pcDNA3.1+ transient transfection) | This work | N/A |
| T98G Sin3BKO (G6) + EV (pBabe puro – retrovirus) | This work | N/A |
| T98G Sin3BKO (G6) + Sin3B-FLAG (pBabe puro – retrovirus) | This work | N/A |
| T98G + Lin9-V5-His (pEF6 – transient transfection) | This work | N/A |
| T98G + Lin9-V5-His (pEF6 – transient transfection) + Sin3B-FLAG (pcDNA3.1+ transient transfection) | This work | N/A |
| T98G + shSCRAMBLE (pTRIPZ – lentivirus) | This work | N/A |
| T98G + shSin3B (pTRIPZ – lentivirus) | This work | N/A |
| T98G + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) | This work | N/A |
| T98G WT (D11) + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) | This work | N/A |
| T98G Sin3BKO (G6) + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) | This work | N/A |
| T98G Sin3BKO (B5) + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) | This work | N/A |
| T98G + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| T98G WT (D11) + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| T98G Sin3B (G6) + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| T98G Sin3BKO (B5) + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| T98G + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| T98G WT (D11) + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| T98G Sin3BKO (G6) + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) + Emi1-FLAG | This work | N/A |
| T98G Sin3BKO (B5) + Cdt1-mKO2 (MaRX hygro – retrovirus) + hGmnn-mAG1 (pLB(N)CX – retrovirus) + Emi1-FLAG (pTRIPZ-Puro – lentivirus) | This work | N/A |
| Human: HEK293T | ATCC | CRL-3216 |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + Sin3B-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Lin37-V5-His (pEF6 – transient transfection) + | This work | N/A |
| HEK293T + Lin37-V5-His (pEF6 – transient transfection) + Sin3B-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Bmyb-V5 (pcDNA3.1 + transient transfection) + EV (pcDNA3.1+ transient transfection) | This work | N/A |
| HEK293T + Bmyb-V5 (pcDNA3.1 + transient transfection) + Sin3B-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + p107-HA (pCMV – transient transfection) + | This work | N/A |
| HEK293T + p107-HA (pCMV – transient transfection) + Sin3B-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + p130-HA (pcDNA3.1+ transient transfection) + | This work | N/A |
| HEK293T + p130-HA (pcDNA3.1+ transient transfection) + Sin3B-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Foxm1 (pMyc – transient transfection) + | This work | N/A |
| HEK293T + Foxm1 (pMyc – transient transfection) + Sin3B-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + Sin3BDHID-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + Sin3B (1-304)-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + Sin3B (1-510)-FLAG (pcDNA3.1 + transient transfection) | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + Sin3B (305-1098)-FLAG (pcDNA3.1+ transient transfection) | This work | N/A |
| HEK293T + Lin9-V5-His (pEF6 – transient transfection) + Sin3B (511-1098)-FLAG (pcDNA3.1+ transient transfection) | This work | N/A |
| Mouse: Embryonic Fibroblasts (Sin3B KO) | ( | N/A |
| MEF Sin3BKO + EV (pBabe puro – retrovirus) | This work | N/A |
| MEF Sin3BKO + Sin3B-FLAG (pBabe puro – retrovirus) | This work | N/A |
| Mouse: Embryonic Fibroblasts (Rb KO; p107 KO; p130 KO) (Triple Knock Out, TKO) | ( | N/A |
| Mouse: NIH 3T3 | ATCC | CRL-1658 |
| NIH 3T3 + EV (pcDNA3.1 + transient transfection) | This work | N/A |
| NIH 3T3 + Sin3B-FLAG (pcDNA3.1+ transient transfection) | This work | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: Sin3B-KO | ( | N/A |
| Mouse: TKO (Rb KO; p107 KO; p130 KO) (Triple Knock | ( | N/A |
| Oligonucleotides | ||
| pTRIPZ-shSin3B-Puromycin (AGGCTGTAGACATCGTCCA) | Dharmacon | V3THS_315587 |
| Sin3B gRNA #1 FWD: CACCGACCAGGTGAAGATCCGCTT | IDT | N/A |
| Sin3B gRNA #2 FWD: CACCGAGAAGACGCCCTCACCTATC | IDT | N/A |
| Sin3B gRNA #3 FWD: CACCGTGCCAAAGCGGATCTTCACC | IDT | N/A |
| Sin3B gRNA #4 FWD: CACCGATCTCCAGGAAGCCGTTGT | IDT | N/A |
| Sin3B gRNA #4 FWD: CACCGATCTCCAGGAAGCCGTTGT | IDT | N/A |
| Sin3B gRNA #5 FWD: CACCGCTCCAGGAAGCCGTTGTAGG | IDT | N/A |
| Sin3B gRNA #6 FWD: CACCGTCACCTGGTCCAGATAGGTG | IDT | N/A |
| Recombinant DNA | ||
| Plasmid: pcDNA3.1 + | ThermoFisher | V79020 |
| Plasmid: pCL-Eco | Addgene | 12371 |
| Plasmid: VSV.G | Addgene | 14888 |
| Plasmid: Gag/Pol | Addgene | 14887 |
| Plasmid: psPAX2 | Addgene | 12260 |
| Plasmid pMD2.G | Addgene | 12259 |
| Plasmid: pBABE-Puro | Addgene | 1764 |
| Plasmid: px330-hSpCas9 | Addgene | 42230 |
| Plasmid: pLB(N)CX | J. DeCaprio (DF/HCC) | N/A |
| Plasmid: MaRX Ivf Hygromycin | R. DePinho (MD Anderson) | N/A |
| Plasmid: pFucci-G1 Orange Cloning Vector (Cdt1-mKO2) | MBL | AM-V9001M |
| Plasmid: pFucci-S/G2/M Green Cloning Vector (hGmnn-hmAGI) | MBL | AM-V9012M |
| Plasmid: pcDNA3.1-Cdt1-mKO2 | This work | N/A |
| Plasmid: pcDNA3.1-hGmnn-hmAG1 | This work | N/A |
| Plasmid: MaRX Ivf Hygromycin-Cdt1-mKO2 | This work | N/A |
| Plasmid: pLB(N)CX-hGmnn-mAG1 | This work | N/A |
| Plasmid: pTRIPZ-shSCRAMBLE | M. Pagano (NYU) | N/A |
| Plasmid: pTRIPZ-EMI1-FLAG-Puro | M. Pagano (NYU) | N/A |
| Plasmid: pcDNA3.1+Sin3B-FLAG | This work | N/A |
| Plasmid: pcDNA3.1+Sin3BDHID-FLAG | This work | N/A |
| Plasmid: pcDNA3.1+Sin3B (1–304)-FLAG | This work | N/A |
| Plasmid: pcDNA3.1+Sin3B (1–510)-FLAG | This work | N/A |
| Plasmid: pcDNA3.1+Sin3B (305–1098)-FLAG | This work | N/A |
| Plasmid: pcDNA3.1+Sin3B (511–1098)-FLAG | This work | N/A |
| Plasmid: pBabe-Lin37-V5-Hygro | ( | N/A |
| Plasmid: pEF6-Lin9-V5-His | ( | N/A |
| Plasmid: pEF6-Lin37-V5-His | ( | N/A |
| Plasmid: pcDNA3.1+ Bmyb-V5 | ( | N/A |
| Plasmid: pCMV-p107-HA | ( | N/A |
| Plasmid: pcDNA3.1+p130-HA | ( | N/A |
| Plasmid: Myc-FoxM1 | P. Raychaudhuri (UIC) | N/A |
| Software and Algorithms | ||
| CRISPR Design | Feng Zhang | |
| FastQC | Simon Andrews | |
| Trimmomatic | ( | |
| TopHat | ( | |
| HTSeq-count | ( | |
| edgeR | ( | |
| GSEA | ( | |
| Enrichr | ( | |
| Sequest | ( | |
| Prism | GraphPad Software | |
| FloJo | FloJo, LLC | |