Yong-Tao Du1, Meng-Jie Zhao1, Chang-Tao Wang2, Yuan Gao1, Yan-Xia Wang3, Yong-Wei Liu4, Ming Chen1, Jun Chen1, Yong-Bin Zhou1, Zhao-Shi Xu5, You-Zhi Ma1. 1. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (CAAS)/National Key Facility for Crop Gene Resources and Genetic Improvement, Key Laboratory of Biology and Genetic Improvement of Triticeae Crops, Ministry of Agriculture, Beijing, 100081, China. 2. Beijing Advanced Innovation Center for Food Nutrition and Human Health/Beijing Key Lab of Plant Resource Research and Development, Beijing Technology and Business University, Beijing, 100048, China. 3. Shijiazhuang Academy of Agricultural and Forestry Sciences, Research Center of Wheat Engineering Technology of Hebei, Shijiazhuang, 050041, Hebei, China. 4. Institute of Genetics and Physiology, Hebei Academy of Agriculture and Forestry Sciences/Plant Genetic Engineering Center of Hebei Province, Shijiazhuang, 050051, Hebei, China. 5. Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (CAAS)/National Key Facility for Crop Gene Resources and Genetic Improvement, Key Laboratory of Biology and Genetic Improvement of Triticeae Crops, Ministry of Agriculture, Beijing, 100081, China. xuzhaoshi@caas.cn.
Abstract
BACKGROUND: Abiotic stress severely influences plant growth and development. MYB transcription factors (TFs), which compose one of the largest TF families, play an important role in abiotic stress responses. RESULT: We identified 139 soybean MYB-related genes; these genes were divided into six groups based on their conserved domain and were distributed among 20 chromosomes (Chrs). Quantitative real-time PCR (qRT-PCR) indicated that GmMYB118 highly responsive to drought, salt and high temperature stress; thus, this gene was selected for further analysis. Subcellular localization revealed that the GmMYB118 protein located in the nucleus. Ectopic expression (EX) of GmMYB118 increased tolerance to drought and salt stress and regulated the expression of several stress-associated genes in transgenic Arabidopsis plants. Similarly, GmMYB118-overexpressing (OE) soybean plants generated via Agrobacterium rhizogenes (A. rhizogenes)-mediated transformation of the hairy roots showed improved drought and salt tolerance. Furthermore, compared with the control (CK) plants, the clustered, regularly interspaced, short palindromic repeat (CRISPR)-transformed plants exhibited reduced drought and salt tolerance. The contents of proline and chlorophyll in the OE plants were significantly greater than those in the CK plants, whose contents were greater than those in the CRISPR plants under drought and salt stress conditions. In contrast, the reactive oxygen species (ROS) and malondialdehyde (MDA) contents were significantly lower in the OE plants than in the CK plants, whose contents were lower than those in the CRISPR plants under stress conditions. CONCLUSIONS: These results indicated that GmMYB118 could improve tolerance to drought and salt stress by promoting expression of stress-associated genes and regulating osmotic and oxidizing substances to maintain cell homeostasis.
BACKGROUND: Abiotic stress severely influences plant growth and development. MYB transcription factors (TFs), which compose one of the largest TF families, play an important role in abiotic stress responses. RESULT: We identified 139 soybeanMYB-related genes; these genes were divided into six groups based on their conserved domain and were distributed among 20 chromosomes (Chrs). Quantitative real-time PCR (qRT-PCR) indicated that GmMYB118 highly responsive to drought, salt and high temperature stress; thus, this gene was selected for further analysis. Subcellular localization revealed that the GmMYB118 protein located in the nucleus. Ectopic expression (EX) of GmMYB118 increased tolerance to drought and salt stress and regulated the expression of several stress-associated genes in transgenic Arabidopsis plants. Similarly, GmMYB118-overexpressing (OE) soybean plants generated via Agrobacterium rhizogenes (A. rhizogenes)-mediated transformation of the hairy roots showed improved drought and salt tolerance. Furthermore, compared with the control (CK) plants, the clustered, regularly interspaced, short palindromic repeat (CRISPR)-transformed plants exhibited reduced drought and salt tolerance. The contents of proline and chlorophyll in the OE plants were significantly greater than those in the CK plants, whose contents were greater than those in the CRISPR plants under drought and salt stress conditions. In contrast, the reactive oxygen species (ROS) and malondialdehyde (MDA) contents were significantly lower in the OE plants than in the CK plants, whose contents were lower than those in the CRISPR plants under stress conditions. CONCLUSIONS: These results indicated that GmMYB118 could improve tolerance to drought and salt stress by promoting expression of stress-associated genes and regulating osmotic and oxidizing substances to maintain cell homeostasis.
Drought, salt and temperature stresses severely affect plant growth and agricultural production, threatening the survival of plants. Under stressful conditions, transcriptomic changes were the earliest responses in plants [1]. Gene expression analyses in plants have revealed that stress-responsive genes can be divided into two categories: effector genes and regulatory genes [2]. The products of regulatory genes, which include membrane-localized receptors, calcium sensors, kinases and transcription factors (TFs), participate in further signal transduction regulation and gene expression [1]. TFs regulate gene expression by specifically binding to the cis-acting elements of downstream genes to influence many important cellular processes, such as signal transduction, morphogenesis and environmental stress responses [3, 4].Based on the characteristics of their DNA-binding domain (DBD), TFs were divided into different families, such as bZIP, MYB, NAC, ERF, WRKY and AP2 families [5-9]. The MYB TFs, which represent the largest family in plants, can be divided into different subfamilies depending on the number of adjacent repeats within the MYB domain. Each repeat forms a helix-turn-helix structure of approximately 53 amino acids [10]. MYB-like proteins with one repeat were considered MYB-related (containing a single or a partial MYB repeat), those with two were regarded as R2R3-type MYBs (2R-MYB), those with three were regarded as R1R2R3-type MYBs (3R-MYBs), and those with four repeats were regarded as 4R-MYBs [5, 9, 11–15].The majority of MYB TFs, especially R2R3-MYBs, play important roles in response to abiotic stresses [6, 16–19]. For example, Chen identified 30 MYB genes that respond to multiple abiotic stresses in peanut [19]. TaMYB80 improved tolerance to high temperature and drought in wheat [6]. TaMYB56-B enhanced tolerance to freezing and salt stresses in transgenic Arabidopsis [16]. Compared to R2R3-MYB TFs, the MYB-related genes were mainly characterized for their role in processes, such as the control of cellular morphogenesis, flavonoid biosynthesis, hypocotyl elongation and circadian rhythm [20-24]. AtWER was an early regulator of epidermal cell fate in the root and hypocotyl [21]. Ammixta participated in the transcriptional control of epidermal cell shape [22]. Yi et al. reported that an R1 MYB transcription factor, GmMYB176, regulates GmCHS8 expression and isoflavonoid synthesis in soybean [25]. However, there were few reports that the MYB-related gene involved in abiotic stresses [12, 26]. It is important to make clear whether more MYB-related genes participate in abiotic stresses.Soybean (Glycine max) is widely cultivated and is one of the most important cash crops because of its high protein and oil content. However, its growth and grain yield are severely affected by drought and salt stresses. In some crops, different MYB TFs were characterized by their support of specific roles in response to water deficit and salt stress [6, 13, 17, 19]. Despite the whole genome of soybean being sequenced years ago [27], few studies have investigated the MYB-related TFs in this species. In this study, we provided a list of MYB-related family members based on soybean genome sequencing. Further investigation revealed that a MYB-related gene, GmMYB118, was significantly regulated by salt and drought treatment, and overexpression of GmMYB118 improved tolerance to drought and salt in both Arabidopsis and soybean. In contrast, the transformed plants of GmMYB118 via the clustered, regularly interspaced, short palindromic repeat (CRISPR) system exhibited reduced drought and salt tolerance. Our study provides a foundation for understanding the functions of the GmMYB118 gene in abiotic stress responses.
Results
Identification and chromosomal distribution of soybean MYB-related genes
The species of MYB-related TF genes were various in different species (Table 1). To analyze the entire MYB-related family in soybean, we queried several databases such as Phytozome, TFDB, Pfam, SMART and ScanProsite [10]. Previous work revealed 127 MYB-related TF genes in soybean [28]; and these genes were searched against the above websites. After deleting redundant sequences and screening typical MYB-related domains, we identified 139 genes in soybean. All the MYB-related genes located on twenty chromosomes (Chrs) by using MapInspect software. Chrs 4 and 6 of soybean contain many MYB-related genes—approximately 14.8%, while fewer numbers of MYB-related genes located on Chrs 7 and 20. Chrs 5 to 9 presented a relatively uniform distribution (Fig. 1a). As shown in Fig. 1b, the MYB-related genes tended to be distributed on both arms of Chrs 9, 10, 11, 12, 15, 16, 17 and 18. On the other Chrs, the MYB-related genes were evenly distributed (Chrs 7, 8 and 13) or were abundantly distributed at either end.
Table 1
Numbers of MYB-related TFs in different species
Species
Number
Reference
Arabidopsis thaliana
68
Du et al, 2013 [28]
Arachis hypogaea
20
Chen et al, 2014 [19]
Oryza sativa
70
Dubos et al, 2010 [14]
Zea mays
72
Du et al, 2013 [28]
Glycine max
127
Du et al, 2013 [28]
Fig. 1
Chromosomal distribution of 139 MYB-related genes in soybean. We identified 139 MYB-related genes in soybean by researching several databases such as Phytozome, TFDB, Pfam, SMART and ScanProsite. The members of MYB-related genes were distributed on different Chr (numbers 1–20) (a). The physical location of each member was shown in Figure (b). The deep blue bars represent the Chrs, and the Chr numbers were shown on the top of the bars. The length of the bar was not represented the size of the Chr. The numbers on the left side of the bars show the distances in megabases (Mb) between neighboring genes
Numbers of MYB-related TFs in different speciesChromosomal distribution of 139 MYB-related genes in soybean. We identified 139 MYB-related genes in soybean by researching several databases such as Phytozome, TFDB, Pfam, SMART and ScanProsite. The members of MYB-related genes were distributed on different Chr (numbers 1–20) (a). The physical location of each member was shown in Figure (b). The deep blue bars represent the Chrs, and the Chr numbers were shown on the top of the bars. The length of the bar was not represented the size of the Chr. The numbers on the left side of the bars show the distances in megabases (Mb) between neighboring genes
Phylogenetic tree analysis with amino acid sequence of 139 MYB-related genes
Alignment of the amino acid sequences was used to construct a phylogenetic tree by MEGA 6 via the neighbor-joining (NJ) method. As shown in Fig. 2, the phylogenetic tree was divided into 5 groups (I-V). The sequence SHAQK(Y/F) F was highly conserved in group I. Group II shared a consistent DLKDKW sequence. For other groups, although these MYB proteins have no conserved domain, they have conserved amino acid sites. The high bootstrap values for the node supported that the other members of 139 MYB proteins were clustered in three groups (III, IV and V), respectively.
Fig. 2
Phylogenetic tree of the MYB-related TFs subfamily in soybean. Amino acid sequences were aligned via ClustalX and were manually corrected. The phylogenetic tree was constructed with MEGA 6 in conjunction with the NJ method. The same color represents the same group
Phylogenetic tree of the MYB-related TFs subfamily in soybean. Amino acid sequences were aligned via ClustalX and were manually corrected. The phylogenetic tree was constructed with MEGA 6 in conjunction with the NJ method. The same color represents the same group
Screening candidate genes for further analysis
According to the gene accession number we submitted to the soybase website (http://soybase.org/soyseq/) [10], we obtained the tissue expression data of quantified prediction for a diverse set of fourteen tissue types (Additional file 1: Figure S1). It showed that the expression level of several genes in roots, leaf nodes, leaves and flowers was higher than that in seeds and pods. It may suggest that these genes play a crucial role in soybean growth and development. For further analysis, we screened 10 members from the 139 MYB genes that according to the amount of expression level more than 300 from soybase website prediction in root, including GmMYB7/20/31/49/75/81/92/105/110/118 (Fig. 3a). It may suggest that these genes play an important role in soybean roots.
Fig. 3
Quantified prediction of tissue expression in soybean and sequence conservation analysis of the ten selected MYB-related TF genes. In accordance with the quantified prediction of fourteen tissue expression provided by SoyBase, the ten MYB-related TF genes that according to the quantified expression level of more than 300 were screened from the 139 MYB-related genes for further analysis. The deeper color represents a greater quantity (a). We analyzed the structure using Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/) by submitting CDSs and genomic sequences (b)
Quantified prediction of tissue expression in soybean and sequence conservation analysis of the ten selected MYB-related TF genes. In accordance with the quantified prediction of fourteen tissue expression provided by SoyBase, the ten MYB-related TF genes that according to the quantified expression level of more than 300 were screened from the 139 MYB-related genes for further analysis. The deeper color represents a greater quantity (a). We analyzed the structure using Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/) by submitting CDSs and genomic sequences (b)
Gene structure analysis of the ten selected MYB-related TFs
To characterize the ten select MYB-related genes, we analyzed their structure using Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/) by submitting coding DNA sequences (CDS) and genomic sequences, and we retrieved basic information (Table 2). As shown in Fig. 3b, the ten MYB-related genes presented with an exon-intron structure. The results showed that the MYB-related genes tended to have closer genetic relationships with more similar structures. For example, GmMYB7/31/118, GmMYB75/92/105 and GmMYB20/31/110 exhibit similar gene structures, which suggests that they evolved from the same pattern.
Table 2
Basic information concerning ten MYB-related genes in soybean
Gene
Gene ID number
Amino acids
pI
Molecular mass (kD)
Chromosome
Domain location
GmMYB7
Glyma02g03020
300
10.41
32.16
2
94–138
GmMYB20
Glyma03g42260
748
6.15
82.07
3
24–68
GmMYB31
Glyma05g01640
285
9.66
31
5
80–124
GmMYB49
Glyma07g05410
750
6.55
82.3
7
24–68
GmMYB75
Glyma11g15180
204
4.48
22.8
11
8–62, 68–113
GmMYB81
Glyma12g07110
750
6.2
82.4
12
8–62, 68–113
GmMYB92
Glyma13g40830
350
9.09
38.12
13
8–55, 61–106
GmMYB105
Glyma15g04620
192
4.61
21.5
15
8–55, 61–106
GmMYB110
Glyma16g01980
194
5.07
22.13
16
24–68
GmMYB118
Glyma17g10250
194
4.79
22.14
17
144–188
Basic information concerning ten MYB-related genes in soybean
Promoter regions of the ten MYB-related genes contain various stress-responsive elements
The 2000 bp region upstream of the ATG start codon in the promoters of the ten MYB-related genes was selected. To investigate the mechanism involved in the response to abiotic stresses, plant cis-acting elements and PLACE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) were used to analyze the regions of the ten gene promoters. A number of regulatory elements that respond to drought and salt stress were identified, including ABRE (ABA-induced), DRE (drought-induced), GT-1 (salt-induced), MYB (drought) and MYC (drought and cold) elements. In addition, the numbers of cis-elements for MYB, MYC and GT-1 TFs were greater than other cis-elements in these promoters of the ten genes (Table 3). This information revealed that the ten MYB-related genes may be involved in abiotic stress responses, such as drought, salt and cold responses.
Table 3
Distribution of cis-acting elements within ten MYB-related gene promoters in soybean
Gene
ABRE
DRE
ERE
GARE
GT-1
LTRE
MYB
MYC
GmMYB7
9
1
0
1
43
0
14
10
GmMYB20
7
0
0
0
23
1
16
20
GmMYB31
1
0
0
0
25
0
15
20
GmMYB49
16
0
1
0
34
1
20
14
GmMYB75
1
4
1
4
28
7
21
24
GmMYB81
0
3
0
3
27
5
10
14
GmMYB92
7
0
3
1
34
1
20
24
GmMYB105
6
0
5
2
27
1
20
22
GmMYB110
12
2
1
1
52
3
24
24
GmMYB118
3
4
0
3
34
3
16
22
Distribution of cis-acting elements within ten MYB-related gene promoters in soybean
Several candidates are involved in multiple abiotic stresses
To gain insight into potential functions, we initially examined the expression patterns of the ten MYB-related genes in response to various abiotic stresses by quantitative real-time PCR (qRT-PCR) (Fig. 4). Under drought treatment, the expression of GmMYB20/31/118 increased by 2.42, 3.98 and 3.11-fold at 1, 5 and 5 h, respectively, the transcription levels of other genes did not change significantly (A). For salt treatment, the expression peaks of GmMYB7/31/118 occurred at 5, 5 and 12 h, respectively, which were equivalent to 6.45, 6.06 and 6.54-fold increases, respectively. The expression of other genes did not change significantly (B). Under heat treatment, the expression of GmMYB7/31/75/118 increased by 3.41, 1.96, 1.89 and 2.40-fold at 5 h, respectively, the expression levels of other genes did not change significantly (C). Under cold treatment, the accumulation of GmMYB20/49/110/118 transcripts increased gradually and peaked at 1, 5, 5 and 12 h; however, the accumulation of GmMYB118 transcript level was rapidly decreased, it was similar to the CK plants at 12 h. The highest levels of GmMYB20/49/110/118 were equivalent to 4.16, 7.6, 6.05 and 5.2-fold increases, respectively (D). These results indicated that the accumulation of transcript levels of GmMYB7/20/31/118 was affected by various abiotic stresses. Among those genes, GmMYB118 clearly responded to multiple abiotic stresses, including drought, salt, heat and cold (Fig. 4). For this reason, GmMYB118 was selected for further investigation.
Fig. 4
Expression patterns of the ten selected MYB-related TF genes under salt, drought, cold and heat treatment. Fifteen-year-old seedling of soybean were treated with Drought (a), NaCl (b), Heat (c) and Cold (d) for 0, 1, 5, 12 and 24 h. The expression patterns of the ten select MYB-related TF genes under various abiotic stresses were quantified by qRT-PCR analysis. GmMYB118 clearly responded to multiple abiotic stresses including drought, salt, cold and heat stresses (a-d). The data were shown as the means ± SDs of three experiments
Expression patterns of the ten selected MYB-related TF genes under salt, drought, cold and heat treatment. Fifteen-year-old seedling of soybean were treated with Drought (a), NaCl (b), Heat (c) and Cold (d) for 0, 1, 5, 12 and 24 h. The expression patterns of the ten select MYB-related TF genes under various abiotic stresses were quantified by qRT-PCR analysis. GmMYB118 clearly responded to multiple abiotic stresses including drought, salt, cold and heat stresses (a-d). The data were shown as the means ± SDs of three experiments
Subcellular localization of GmMYB118 in Arabidopsis
To determine the subcellular localization of GmMYB118, GmMYB118 was fused to the N-terminus of the humanized green fluorescent protein (hGFP) reporter gene and ligated into an 16318hGFP expression vector under control of the cauliflower mosaic virus (CaMV) 35S promoter. The cDNA coding sequences of AtWRKY25 (At2g30250) that Located in the nucleus [29] were fused to the N-terminus of the RFP gene under the control of the CaMV 35S promoter. Subcellular localization of GFP and RFP expression in Arabidopsis mesophyll protoplasts was observed after cotransformation. The GmMYB118::hGFP fusion protein localized in the nucleus (Additional file 1: Figure S2A). These observations suggested that GmMYB118 could enter the nucleus to function.
GmMYB118 provided drought tolerance in Arabidopsis
Overexpression of stress-inducible genes in plants represents an effective strategy for improving abiotic stress tolerance [3, 4, 30–32]. To further investigate the biological functions of the GmMYB118 gene, three T3 Ectopic expression (EX) lines were selected for analysis under polyethylene glycol (PEG6000) treatment to simulate drought stress. Before conducting the experiment, three-week-old Arabidopsis seedlings were subjected to qRT-PCR analysis of GmMYB118 gene expression in ectopic expression and wild type (WT) plants (Additional file 1: Figure S2B). Expression of AtActin was analyzed as a loading control (Additional file 1: Table S1). The relative expression level of GmMYB118 was equivalent to 8~12 fold in Arabidopsis.For germination assays, seeds of EX and WT lines were germinated on 1/2-strength Murashige and Skoog (MS) media containing various concentrations of PEG6000, and the germination rates was determined at 0, 12, 24, 36, 48, 60 and 72 h. All lines exhibited similar germination rates on 1/2-strength MS media. However, in the presence of PEG6000, the germination of the EX seeds was inhibited, and the degree of inhibition was greater than that of the WT seeds (Additional file 1: Figure S3A). Under normal condition, the germination rate of the WT and EX seeds was about 94~96% at the time points of 72 h (Additional file 1: Figure S3B). Under 3% PEG6000 treatment, the germination rate of the EX seeds was 64.06~72.91%, which was lower than that of the WT seeds (81.77%) at the time points of 24 h (Additional file 1: Figure S3C). Under 6% PEG6000 treatment, the germination rate of the EX seeds was 33.85~34.89%, which was lower than that of the WT seeds 63.02% at the time points of 24 h (Additional file 1: Figure S3D). Under 9% PEG6000 treatment, the germination rate of the EX seeds was 76.56~81.77%, which was lower than that of the WT seeds (94.79%) at the time points of 48 h (Additional file 1: Figure S3E).For phenotyping of seedlings, the six-day-old Arabidopsis seedlings were transferred to 1/2-strength MS medium contained different concentrations of PEG6000 for 7 days. The phenotypes of the transgenic seedlings were similar to those of the WT seedlings under normal conditions (Fig. 5a). As shown in Fig. 5, PEG6000 treatment reduced the root growth of both EX and WT seedlings to some extent (Fig. 5b–d). Under 3 and 9% PEG6000 treatments, the root lengths of the GmMYB118 lines were 11.86~13.65 cm and 9.34~10.39 cm, respectively, which were significantly longer than those of WT lines (8.38 cm and 6.36 cm, respectively) (Fig. 5f, h). The root length of WT seedlings was also shorter than that EX seedlings under 6% PEG6000 treatment (Fig. 5g). In addition, at the later seedling stage, three-week-old EX and WT seedlings were not watered for 14 days, after which they were pictured after being rewatering 3 days (Fig. 7a). The survival rate of the EX lines after being rewatering 3 days was 90.05~95.63%, which was significantly higher than that of the WT lines (40.50%) (Fig. 7c). These results suggest that GmMYB118 may potentially function to increase the tolerance of the transgenic plants to drought stress.
Fig. 5
Root length phenotypes of EX lines under PEG treatment. The six-day-old seedlings grown on 1/2 MS were transferred to 1/2 MS medium containing different concentrations of PEG6000. A week later, the growth of roots was photographed of EX and WT (Col-0) seedlings under 0, 3, 6 and 9% PEG6000 treatment (a-d). Compared with those of the WT (Col-0) seedlings, the statistical results of total root length were shown of the EX seedlings under 0, 3, 6 and 9% PEG treatment (e-h). The data were shown as the means ± SDs (n = 30) of three experiments. ANOVA test demonstrated that there were significant differences (∗
P < 0.05, ∗∗
P < 0.01)
Fig. 7
Phenotypes of late-stage EX lines under drought and salt treatments. Three-week-old seedlings were subjected to drought and salt treatment for two weeks. Drought tolerance phenotypes of EX and WT (Col-0) lines under water deficit conditions (a). Salinity tolerance phenotypes of EX and WT (Col-0) lines under 250 mM NaCl conditions (b). The survival rate of the water-stressed plants was monitored 3 days after rewatering (c). The survival rate of the transgenic and WT (Col-0) lines under 250 mM NaCl for 14 days (d). The data were shown as the means ± SDs (n = 30) of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)
Root length phenotypes of EX lines under PEG treatment. The six-day-old seedlings grown on 1/2 MS were transferred to 1/2 MS medium containing different concentrations of PEG6000. A week later, the growth of roots was photographed of EX and WT (Col-0) seedlings under 0, 3, 6 and 9% PEG6000 treatment (a-d). Compared with those of the WT (Col-0) seedlings, the statistical results of total root length were shown of the EX seedlings under 0, 3, 6 and 9% PEG treatment (e-h). The data were shown as the means ± SDs (n = 30) of three experiments. ANOVA test demonstrated that there were significant differences (∗
P < 0.05, ∗∗
P < 0.01)
GmMYB118 provided salt tolerance in Arabidopsis
To elucidate the role of the GmMYB118 in plant growth and development under high salt conditions, salt tolerance experiments involving transgenic and WT lines were carried out. For germination assays, seeds of EX and WT lines were germinated on 1/2-strength MS media that contained various concentrations of NaCl, and the germination rates was determined at 0, 12, 24, 36, 48, 60 and 72 h. Both EX and WT seeds exhibited similar germination rates on 1/2-strength MS media without NaCl (Additional file 1: Figure S4B). In the presence of NaCl, the germination of both the EX and WT seeds was inhibited (Additional file 1: Figure S4A). Under 75 mM NaCl treatment, the germination rate of the EX seeds was 30.18~35.37%, which was lower than that of the WT seeds (55.23%) at the time points of 48 h (Additional file 1: Figure S4C). Under 100 mM NaCl treatment, the germination rate of the EX seeds was 50.47~53.29%, which was lower than that of the WT seeds (69.52%) at the time points of 48 h (Additional file 1: Figure S4D). Under 125 mM NaCl treatment, the inhibition of germination was more severe for the EX seeds than for the WT seeds. The germination rate of the EX seeds ranged from 14.28~18.86%, which was lower than that of the WT seeds (47.62%) (Additional file 1: Figure S4E).For phenotyping, transgenic and WT Arabidopsis seeds were grown on 1/2 MS media for 6 days at 22 °C, after which they were transferred to 1/2-strength MS media that contained various concentrations of NaCl and grown for 7 days. The phenotypes of the EX seedlings were similar to those of the WT seedlings under normal conditions (Fig. 6a). As is shown in Fig. 6, under 75, 100 and 125 mM NaCl treatments, the root length of the EX lines was significantly longer than that of the WT lines (Fig. 6b–d). Under 75 and 125 mM NaCl treatments, the total root length of the WT lines (9.39 and 7.69 cm), which was significantly shorter than that of the transgenic lines ranged from 13.11~15.51 and 9.86~10.80 cm (Fig. 6f, h). This difference is most definitive in response to the 100 mM NaCl treatment: the total root length of the EX lines ranged from 11.24~13.51 cm, which was significantly greater than that of the WT lines (8.37 cm) (Fig. 6g). Moreover, at the later seedling stage, three-week-old EX and WT seedlings were grown under 250 mM NaCl for 14 days; their phenotypes are shown in Fig. 7b. The survival rate of the EX lines ranged from 88.32~92.16%, which was significantly greater than that of the WT liens (68.94%) (Fig. 7d). Overall, these results suggested that GmMYB118 may be used to improve tolerance to salt stress in transgenic plants.
Fig. 6
Root length phenotypes of EX lines under NaCl treatment. The six-day-old seedlings grown on 1/2 MS were transferred to 1/2 MS medium containing different concentrations of NaCl. A week later, the growth of roots was photographed of EX and WT (Col-0) seedlings under 0, 75, 100 and 125 mM NaCl treatment (a-d). Compared with those of the WT seedlings, the statistical results of total root length are shown of the EX seedlings under 0, 75, 100 and 125 mM NaCl treatment (e-h). The data were shown as the means ± SDs (n = 30) of three experiments. ANOVA test demonstrated that there were significant differences (∗
P < 0.05, ∗∗
P < 0.01)
Root length phenotypes of EX lines under NaCl treatment. The six-day-old seedlings grown on 1/2 MS were transferred to 1/2 MS medium containing different concentrations of NaCl. A week later, the growth of roots was photographed of EX and WT (Col-0) seedlings under 0, 75, 100 and 125 mM NaCl treatment (a-d). Compared with those of the WT seedlings, the statistical results of total root length are shown of the EX seedlings under 0, 75, 100 and 125 mM NaCl treatment (e-h). The data were shown as the means ± SDs (n = 30) of three experiments. ANOVA test demonstrated that there were significant differences (∗
P < 0.05, ∗∗
P < 0.01)Phenotypes of late-stage EX lines under drought and salt treatments. Three-week-old seedlings were subjected to drought and salt treatment for two weeks. Drought tolerance phenotypes of EX and WT (Col-0) lines under water deficit conditions (a). Salinity tolerance phenotypes of EX and WT (Col-0) lines under 250 mM NaCl conditions (b). The survival rate of the water-stressed plants was monitored 3 days after rewatering (c). The survival rate of the transgenic and WT (Col-0) lines under 250 mM NaCl for 14 days (d). The data were shown as the means ± SDs (n = 30) of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)
GmMYB118 activated stress-responsive genes in Arabidopsis
To elucidate the possible molecular mechanisms of the involvement of GmMYB118 in stress responses, the expression of drought- and salt-responsive marker genes including AtP5CS1 [33], AtDREB2A [34], AtCOR47 [30], AtCOR15A [4], AtRD29A [35], AtKIN1 [36], AtKIN2 [37], AtRD22 [38], AtRAB18 [39], AtADH1 [40], and AtNCED3 [41] was investigated in EX lines. A 2-fold change in expression was arbitrarily considered to represent positive expression induction.qRT-PCR analysis revealed no significant differences at the levels of expression of AtCOR47, AtDREB2A, AtKIN1, AtKIN2, AtRD29A and AtCOR15 between the EX lines and WT lines under normal conditions (Fig. 8a–f). Under drought conditions, the expression of these genes in the EX lines significantly higher than that in the WT lines (Fig. 8a–f), although the expression levels of AtP5CS1 and AtRAB18 did not differ (data not shown). On the other hand, compared with that in the WT lines, the expression levels of AtADH1, AtNCED3, AtCOR15 and AtRD29A in the EX lines significantly increased under salt conditions (Fig. 8g–j), but these levels did not markedly differ under normal conditions (Fig. 8g–j). The expression level of AtRD22 did not significantly differ between the EX lines and the WT lines in either normal or drought conditions (data not shown). These results indicated that overexpression of GmMYB118 may activate the expression of drought- or salt-responsive genes in Arabidopsis, improving the drought and salt stress tolerance of transgenic lines.
Fig. 8
GmMYB118 regulates stress-responsive gene expression in transgenic Arabidopsis plants. Extraction of RNA from two-week-old seedlings grown on 1/2 MS medium with drought and NaCl (100 mM) treatment for 2 h. Gene expression level was quantified by qRT-PCR assays. Expression of AtActin was analyzed as a control. Gene-specific primers were used to detect the expression levels of stress-related genes. The expression levels of drought-related genes significantly increased in transgenic Arabidopsis plants under drought treatment (a-f). The expression levels of salt-related genes significantly increased in the transgenic Arabidopsis plants under salt treatment (g-j). The data were the means ± SDs of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)
GmMYB118 regulates stress-responsive gene expression in transgenic Arabidopsis plants. Extraction of RNA from two-week-old seedlings grown on 1/2 MS medium with drought and NaCl (100 mM) treatment for 2 h. Gene expression level was quantified by qRT-PCR assays. Expression of AtActin was analyzed as a control. Gene-specific primers were used to detect the expression levels of stress-related genes. The expression levels of drought-related genes significantly increased in transgenic Arabidopsis plants under drought treatment (a-f). The expression levels of salt-related genes significantly increased in the transgenic Arabidopsis plants under salt treatment (g-j). The data were the means ± SDs of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)
Targeted mutagenesis in soybean hairy roots and GUS staining
To further confirm the functions of the GmMYB118 gene in soybean, two constructs (pCAMBIA3301-GmMYB118 and pCas9-GmU6-sgRNA) were generated for overexpression and for gene editing analysis with the CRISPR-Cas9 system (OE and CRISPR constructs, respectively) into soybean hairy roots.Because the vector of pCAMBIA3301 carries the β-glucuronidase (GUS) reporter gene, we examined the expression level of GUS in accordance with the protocol of a GUS histochemical assay kit to detect the transformation efficiency of the vector by Agrobacterium rhizogenes (A. rhizogenes)-mediated transformation. The transformation efficiency was approximately 50% (Additional file 1: Figure S5A). It can be inferred from the results of GUS staining that about 50% of the roots of each OE and CRISPR plant were positive roots. To detect the targeted gene mutations in soybean hairy roots, genomic DNA was collected and extracted for further detection of the target gene mutations in the hairy roots. The target gene was amplified with specific primers and sequenced, and the results showed that some bases were replaced without any insertions or deletions (Additional file 1: Figure S5B). Our results shown that 10% of roots of the coding sequence of GmMYB118 was edited in each CRISPR plant. The amino acid (I17, L18, F19) of GmMYB118 in 77.5% CRISPR plants was changed, such as from I17 to M17, L18 to A18, F19 to S19. These findings indicated that the CRISPR-Cas9 system modified the gene during hairy root development.
GmMYB118 improved drought and salt tolerance in transgenic soybean hairy roots
The OE and CRISPR lines were analyzed for drought tolerance [1, 25, 42, 43]. For drought treatment, the hairy roots of the seedlings were not watered for 14 days, then rewatering for 3 days. The survival rate of the OE plants was 83.33%, which was clearly greater that of the CK plants (33.33%); however, the survival rate of the CRISPR plants was 16.67%, which was worse than that of the CK plants (Fig. 9a). Similarly, the survival rate of the OE plants was 66.67% under salt conditions, which was clearly greater than that of the CK plants (48.33%). The survival rate of the CRISPR plants was 25.00% lower than that of the CK plants (Fig. 10a).
Fig. 9
GmMYB118 improves drought stress tolerance in transgenic soybean hairy roots. The seedlings with 2–5 cm hairy roots were grown for 5 days on pot under normal condition, then, the plants were dehydrated for 16 days. Survival rate of the water-stressed plants was monitored 3 days after rewatering. Image of drought resistance phenotypes of OE, CK and CRISPR plants under drought conditions was shown (a). The leaves contents of Chlorophyll (b), Proline (c) and MDA (d) were detected in OE, CK and CRISPR plants under drought or normal growth condition for a week. Trypan blue staining of soybean plant leaves without irrigation for 14 days (e), the dead cells can be strained, but living cells cannot. DAB (f) and NBT (g) staining of the leaves of OE, CK and CRISPR plants after drought treatment or normal condition for 7 days. The depth of color shows the concentration of H2O2 and O2− in the leaves (f-g). The content of H2O2 (h) and O2− (i) in the leaves of OE, CK and CRISPR plants after drought treatment or normal condition for 7 days. The data were means ± SDs of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)
Fig. 10
GmMYB118 improves salt stress tolerance in transgenic soybean hairy roots. The seedlings with 2–5 cm hairy roots were grown for 5 days on pot under normal condition, then, the plants were 250 mM NaCl treated for a week. Image of salinity resistance phenotypes of OE, CK and CRISPR plants under salt conditions was shown (a). The leaves contents of Chlorophyll (b), Proline (c) and MDA (d) were detected in OE, CK and CRISPR plants with 250 mM NaCl treatment or normal growth condition for 3 days. Trypan blue staining of soybean plant leaves without irrigation for a week (e), the dead cells can be strained, but living cells cannot. DAB (f) and NBT (g) staining of the leaves of OE, CK and CRISPR plants after 250 mM NaCl treatment or normal condition for 3 days. The depth of color shows the concentration of H2O2 and O2− in the leaves (f-g). The content of H2O2 (h) and O2− (i) in the leaves of OE, CK and CRISPR plants after 250 mM NaCl treatment or normal condition for 3 days. The data were means ± SDs of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)
GmMYB118 improves drought stress tolerance in transgenic soybean hairy roots. The seedlings with 2–5 cm hairy roots were grown for 5 days on pot under normal condition, then, the plants were dehydrated for 16 days. Survival rate of the water-stressed plants was monitored 3 days after rewatering. Image of drought resistance phenotypes of OE, CK and CRISPR plants under drought conditions was shown (a). The leaves contents of Chlorophyll (b), Proline (c) and MDA (d) were detected in OE, CK and CRISPR plants under drought or normal growth condition for a week. Trypan blue staining of soybean plant leaves without irrigation for 14 days (e), the dead cells can be strained, but living cells cannot. DAB (f) and NBT (g) staining of the leaves of OE, CK and CRISPR plants after drought treatment or normal condition for 7 days. The depth of color shows the concentration of H2O2 and O2− in the leaves (f-g). The content of H2O2 (h) and O2− (i) in the leaves of OE, CK and CRISPR plants after drought treatment or normal condition for 7 days. The data were means ± SDs of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)GmMYB118 improves salt stress tolerance in transgenic soybean hairy roots. The seedlings with 2–5 cm hairy roots were grown for 5 days on pot under normal condition, then, the plants were 250 mM NaCl treated for a week. Image of salinity resistance phenotypes of OE, CK and CRISPR plants under salt conditions was shown (a). The leaves contents of Chlorophyll (b), Proline (c) and MDA (d) were detected in OE, CK and CRISPR plants with 250 mM NaCl treatment or normal growth condition for 3 days. Trypan blue staining of soybean plant leaves without irrigation for a week (e), the dead cells can be strained, but living cells cannot. DAB (f) and NBT (g) staining of the leaves of OE, CK and CRISPR plants after 250 mM NaCl treatment or normal condition for 3 days. The depth of color shows the concentration of H2O2 and O2− in the leaves (f-g). The content of H2O2 (h) and O2− (i) in the leaves of OE, CK and CRISPR plants after 250 mM NaCl treatment or normal condition for 3 days. The data were means ± SDs of three experiments. ANOVA test demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01)To investigate the potential physiological mechanism involved in improving the drought resistance of the OE lines, the proline, malondialdehyde (MDA) and chlorophyll contents in the OE, CK and CRISPR plants were measured under both normal growth and stress conditions. The stress condition was described in the method. The proline and chlorophyll contents were 86.41 μg/g and 0.65 mg/g, respectively, which were significantly greater in the OE plants than in the CK plants (47.16 μg/g and 0.39 mg/g, respectively). The proline and chlorophyll contents in the CRISPR plants (16.44 μg/g and 0.29 mg/g, respectively) were evidently lower than those in the CK plants under drought conditions (Fig. 9b, c). Similarly, the proline and chlorophyll contents were 88.17 μg/g and 0.62 mg/g in the OE plants, respectively, and were significantly greater than those in the CK plants (46.70 μg/g and 0.37 mg/g, respectively). The same contents were evidently 12.45 μg/g and 0.20 mg/g lower in the CRISPR plants than in the CK plants under salt conditions, respectively (Fig. 10b, c). Under both drought and salt conditions, the MDA content in the OE plants was lower than that in both the CK and CRISPR plants (Figs. 9d and 10d). By contrast, the MDA contents among all plants did not differ under normal conditions (Figs. 9b–d and 10b–d).We detected the expression of GmMYB118 in the hairy roots of transgenic plants subjected to drought and NaCl treatments. Compared with that in the CK plants, the expression in the OE plants increased by 7.9 times, while that of the CRISPR plants decreased by 2.3 times under NaCl treatment. The expression in the OE plants was 5 times greater than that in the CK plants, while the expression in the CRISPR plants was 2 times lower than that in the CK plants under drought treatment (Additional file 1: Figure S6).
Overexpression of GmMYB118 reduced the concentration of O2− and H2O2
Because stress and the intracellular reactive oxygen species (ROS) content affect plant growth and development, we stained soybean leaves with 3,3-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) to detect H2O2 and O2− contents under normal or stress conditions in OE, CK and CRISPR plants. The stress condition was described in the method. Under normal growth conditions, the DAB and NBT staining of all plant leaves showed no differences (Figs. 9f–g and 10f–g). Under water deficit or the presence of 250 mM NaCl, the color depth of the OE plants was significantly lower than that of the CK plants. In contrast, the color depth of the CRISPR plants was significantly greater than that of the CK plants (Figs. 9f–g and 10f–g). These results suggested that the concentration of H2O2 and O2− in the CK plants was greater than that in the OE plants but lower than that in the CRISPR plants.The activity of NADPH oxidase (NOX) was closely related to the formation of O2
-, the intermediate product of H2O2 degradation [18, 44, 45]. Therefore, we measured the concentration of H2O2 and NOX activity in soybean roots and leaves in accordance with the protocols of an H2O2 colorimetric assay kit and a NOX assay kit. The results were consistent with the staining results of DAB and NBT; the concentration of H2O2 and the NOX activity in the CK plants were 54.09 U/g and 600.95 U/g, respectively, which were greater than those in the OE plants (130.77 U/g and 1325.62 U/g, respectively), and the same concentration and activity in the CK plants were lower than those in the CRISPR plants (295.52 U/g and 2896.18 U/g, respectively) under drought conditions (Fig. 9h, i). The concentration of H2O2 and NOX activity in the CK plants were 52.93 U/g and 641.35 U/g, respectively, which were higher than those in the OE plants (151.15 U/g and 1658.93 U/g, respectively); in addition, the same concentration and activity in the CK plants were lower than those in the CRISPR plants (276.55 U/g and 2530.05 U/g, respectively) under salt conditions (Fig. 10h, i).In addition, we stained soybean plant leaves with Trypan blue to detect cell activity under normal and stress conditions. As shown in Figs. 9e and 10e, the blue area of the OE plant leaves was obviously smaller than that of the CK plant leaves, and the CK plants were clearly smaller than the CRISPR plants under drought and salt stress conditions. No plant leaves differed under normal growth conditions (Figs. 9e and 10e). These findings suggest that the cell activity in the leaves of the CK plants is lower than that in the leaves of the OE plants but greater than that in the leaves of the CRISPR plants.
Discussion
In this study, we isolated and identified the GmMYB118 gene from 139 MYB-related transcription factors. We obtained transgenic Arabidopsis and soybean to investigate the potential function of GmMYB118. Our results indicated that GmMYB118 could improve tolerance to drought and salt stresses in Arabidopsis and soybean compared to the control lines. In present result, the encoding sequence of GmMYB118 was edited in the CRISPR hairy roots. Interestingly, the expression level of GmMYB118 in CRISPR plants was significantly lower than that in CK plants (Additional file 1: Figure S6). It suggests that the stability of mRNA may be affected after editing of GmMYB118 gene, or the decrease at the expression of GmMYB118 may be due to the removal or repair mechanism from the host itself after CRISPR editing.Root is one of the main vegetative organs of plants, which is responsible for absorbing water and minerals dissolved in water, transporting water and minerals to stems and leaves, and storing nutrients [46]. Under the condition of drought and high salt, the root is faced with how to keep water in order to maintain the osmotic balance and to control the ion in and out of the cell membrane to maintain the ion balance, so as to increase the possibility of plant survival. In our result, the expression of GmMYB118 was the highest in the root (Fig. 3a). No previous studies have shown that the MYB-related gene is the most expressed in the root and performs some certain functions. It can be assumed that GmMYB118 can improve the osmotic balance of water and the balance of Anions and cations in the cells in the root under stresses conditions, which can directly or indirectly improve the drought resistance and salt tolerance of plants.Previous studies showed that R2R3-MYB TFs could increase tolerance to various abiotic stresses by participating in many biochemical and physiological processes [14, 47, 48]. Few reports indicated that MYB-related TFs involved in response to abiotic stresses in plants. The MYB-related genes were mainly involved in processes, such as phytochrome regulation, flavonoid biosynthesis, hypocotyl elongation and circadian rhythm [20-23]. Currently, we have found that the expression of GmMYB118 was induced by drought, salt, heat and cold. Pi et al. reported that GmMYB173 (GmMYB118) interact with the promoter of GmCHS5 in soybean cells to regulate flavonoid biosynthesis [49]. Isoflavones has many biological functions and play an important role in the interaction between plant and environment [47, 50]. Chu et al. was reported that the green and purple leaves of sweet potatoes and the outer leaves of onion possessed higher amounts of flavonoids, and more than 85% of free radical scavenging activities were evaluated [51] It implied that GmMYB118 was involved in abiotic stresses through regulating of flavonoid biosynthesis. It also suggested that MYB-related TFs could response to abiotic stresses and the processes of flavonoid biosynthesis.In present study, the experiments of phenotypic and molecular mechanism show that GmMYB118 improved drought resistance and salt tolerance in soybean with two approaches (OE and CRISPR) through A. rhizogenes-mediated transformation system. However, few months ago, Pi et al. reported that the salt-triggered phosphorylation of GmMYB173, subsequent increased in its affinity to GmCHS5 promoter and the elevated expression of GmCHS5 likely contributed to soybeansalt tolerance by enhancing the accumulation of dihydroxy B-ring flavonoids [49]. Unfortunately, under drought condition, we have not found downstream genes directly regulated by GmMYB118 with some limitations of this study. In the future, it is necessary to investigate whether GmMYB118 elevate expression of GmCHS5 to enhance the accumulation of flavonoids in soybean cells under drought condition. It may reveal that whether GmMYB118 can regulate the same downstream genes to improve tolerance to drought and salt stresses, or different downstream genes to improve drought and salt tolerance. In crop science research, GmMYB118 can be used as one of the candidate genes for soybean molecular breeding in stresses resistances.
Conclusion
GmMYB118 improved tolerance to drought and salt stress by reducing the contents of ROS and MDA.
Methods
Identification of MYB-related TFs in soybean
To obtain probable candidate MYB-related TF family members, several sources such as Phytozome (http://www.phytozome.net/) and TFDB (http://planttfdb.cbi.pku.edu.cn/) were accessed to acquire sequence data for bioinformatic analyses of soybeanMYB-related TF family members. The resulting protein sequences were then examined for the presence of a MYB motif using the hidden Markov model of the SMART/Pfam tool (http://smart.embl-heidelberg.de/ and http://pfam.xfam.org/). Proteins without a MYB motif were omitted from the datasets. By using alignment and eliminating redundant sequences, we obtained 139 MYB-related TF genes, whose expression was predicted via SoyBase (http://soybase.org/sbt/).
Chromosomal distribution of MYB-related genes
Chromosomal distribution was investigated using the chromosomal loci in Phytozome. The MapInspect program was used to map chromosomal distributions. The deep blue bars represent the Chrs, and the Chr numbers are shown on the top of the bars. The length of the bar is not represented the size of the Chr. The numbers on the left side of the bars show the distances in megabases (Mb) between neighboring genes.
Alignment and phylogenetic analysis of MYB-related TFs
Multiple alignment of the amino acid sequences was performed via ClustalX, and the alignments were manually corrected. A phylogenetic tree was constructed with MEGA 6 and the NJ method, and bootstrap analysis with 1000 replicates was used to evaluate the significance of nodes [52].
Plant materials and stress treatments
Soybean seeds (Tiefeng 8) were germinated for 15 days in pots containing vermiculite. The seedlings were then subjected to various abiotic stresses, including drought, salinity, heat, and cold stresses. For drought stress, the soybean seedlings were placed on filter paper for the induction of rapid drought for 0, 1, 5, 12 and 24 h. For temperature treatments, the soybean seedlings were placed in a 4 °C or 42 °C chamber for cold or heat treatment, respectively, for 0, 1, 5, 12 and 24 h. For salt treatment, the seedlings were transferred to 250 mM NaCl solution for 0, 1, 5, 12 and 24 h. All harvested seedlings were submerged immediately in liquid nitrogen and stored at − 80 °C for RNA extraction.Arabidopsis ecotypes Col-0 was used in this study. Seeds were germinated on 1/2 MS medium with 2% sucrose, after 3 days of vernalization at 4 °C, the plates containing the seeds were housed in a growth chamber that was maintained at a temperature of 22 °C, an irradiance of 40 μmol/m2/s1, and a photoperiod of 16 h light/8 h dark.
RNA extraction and qRT-PCR
Trizol reagent was used to extract total RNA in accordance with the manufacturer’s protocol (TIANGEN, China), and the total RNA was treated with DNase I (TaKaRa, Japan) to remove genomic DNA contamination. qRT-PCR was completed with a PrimeScript™ RT Reagent Kit (TaKaRa, Japan) following the manufacturer’s protocol. A pair of gene-specific primers was designed according to soybeanMYB-related genes and stress-responsive genes in Arabidopsis via Primer Premier 5.0. The Arabidopsis and soybean actin gene were used as a control (RT-AtActin and RT-GmActin, Additional file 1: Table S1). qRT-PCR was performed with an ABI Prism 7500 real-time PCR system (ThermoFisher Scientific, USA) equipped with programs in accordance with the methods of Liu [30]. A quantitative analysis was performed using the 2-ΔΔCT method [53]. The primers used for qRT-PCR are listed in Additional file 1: Table S1.
Vector construction
The coding sequences of GmMYB118 were amplified by PCR primers (MYB118-F: ATGTCTCGCGCCTCCTC, MYB118-R: AGCAACACTAATGATGCTTTCT). Then, the restriction site (NcoI and BsTEII) in conjunction with gene-specific primers (MYB118–3301, Additional file 1: Table S2) was added to the ends of the GmMYB118 sequence. The PCR products and pCAMBIA3301 vector were digested with NcoI and BsTEII (ThermoFisher Scientific, USA), after which the products were ligated into pCAMBIA3301 under the control of the CaMV 35S promoter to generate pCAMBIA3301-GmMYB118. For the CRISPR vector, sgRNA seeds of GmMYB118 were designed by CRISPR-P 2.0 (http://crispr.hzau.edu.cn), which provides web services for computer-aided design of highly efficient sgRNA that exert minimal off-target effects [54]. The sequence of sgRNA seeds was GAACAGTATGATCTCACCGG, it was located in the first exon of the GmMYB118 gene. The restriction enzyme site (BsaI) sequences (ATTG and AAAC), respectively, was added to the end of the seed and its reverse sequence (sgRNA seeds, Additional file 1: Table S2) to obtain sgRNAs. The pUC57-GmU6 vector was digested completely with BsaI (NEB, USA); afterward, the sgRNAs was ligated into pUC57-GmU6 to obtain pUC57-GmU6-sgRNA. The primer U6-sgRNA (Additional file 1: Table S2) was used to detect whether the sequence is correct or not. The pUC57-GmU6-sgRNA and pCAMBIA3301-Cas9 vectors were digested completely with EcoRI and HindIII (ThermoFisher Scientific, USA) to obtain the fragment of GmU6-sgRNA and the vector was digested, respectively. After digestion, the fragment of GmU6-sgRNA was cloned into the pCAMBIA3301-Cas9 vector with T4 DNA ligase (TransGene, China) to generate pCas9-GmU6-sgRNA vectors. The primer pCas9 (Additional file 1: Table S2) was used to detect whether the sequence is correct or not. All primers are listed in Additional file 1: Table S2.
A. rhizogenes-mediated transformation of soybean hairy roots
To generate transformed soybean hairy roots, the soybean cultivar Williams 82 was used for A. rhizogenes-mediated transformation [43]. Seeds were germinated under a 16 h light/8 h dark photoperiod at 25 °C in a humidity chamber. After a week, healthy plants were injected with A. rhizogenes strain K599 harboring pCAMBIA3301 (CK) or K599 harboring the construct described above (pCAMBIA3301 or pCas9-GmU6-sgRNA-construct vectors). The infected plants were then transferred to the chamber and kept under high humidity until hairy roots were generated at the infection site and had grown to 2–5 cm in length. The original main roots were removed from the 0.5 cm area below the infection site, then the seedlings with 2–5 cm hairy roots were transferred to pot for 5 days. Afterward, the plants were subjected to drought and 250 mM NaCl treatment for 16 days and 7 days [1, 42].
Promoter analysis of ten select MYB-related TFs
The 2000 bp region upstream of the ATG start codon of the promoters of MYB family-related genes were selected to identify the cis-acting elements by submitting the promoter regions to PLACE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/). The numbers of each element were then counted manually.
Trypan blue, DAB and NBT staining
The seedlings with 2–5 cm hairy roots were transferred to pot for 5 days and then subjected to drought (no irrigation) for a week or 250 mM NaCl for 3 days in a growth chamber. Detached leaves from the treated seedlings were stained separately. For DAB staining, the samples were immersed in DAB solution (Solarbio, China) for 12 h and then in 75% ethanol for decoloring until the leaves become white. For NBT staining, the samples were immersed in NBT staining solution (Creek Huizhi, China) for 12 h and then in 75% ethanol [18] decoloring until the leaves become white. For Trypan blue staining, differently, the plants were subjected to drought for 16 days. The samples were immersed in 0.5% Trypan blue (BioDee, China) solution for 12 h and then in 75% ethanol for decoloring until the leaves become white. Images were taken with Canon 50D (Canon, Japan) camera.
Quantification of the H2O2 content and NOX activity
Prior to H2O2 measurements, the soybean plants that transferred to pot for 5 days were subjected to drought and 250 mM NaCl stress for a week and 3 days. Afterward, the H2O2 content of leaves was determined in accordance with the protocol of an H2O2 colorimetric assay kit (Beyotime, China) [18]. Similarly, the NOX activity of leaves was determined with a NOX assay kit (Solarbio, China) in accordance with the manufacturer’s protocol. All the measurements were repeated three times, and ANOVA test was used for statistical analysis.
Subcellular localization assays
The full-length cDNA sequences of GmMYB118 were fused to the N-terminus of the hGFP gene (MYB118-GFP, Additional file 1: Table S2) under the control of the CaMV 35S promoter. The cDNA coding sequences of AtWRKY25 (At2g30250) that Located in the nucleus [29] were fused to the N-terminus of the mCherry gene (WRKY25-RFP, Additional file 1: Table S2) under the control of the CaMV 35S promoter. The recombinant plasmid of GmMYB118-GFP and AtWRKY25-RFP were cotransformed into Arabidopsis protoplasts via the PEG4000-mediated method [18, 55]. The expression of the fusion protein was observed under dark conditions for 12 h, and GFP and RFP was detected by laser scanning confocal microscopy (Zeiss LSM 700, Germany) [18, 30].
Drought and salt stress assays of transgenic Arabidopsis plants
To obtain EX plants, the full-length cDNA sequence of GmMYB118 was introduced into a pCAMBIA1302 plant transformation vector (MYB118–3301, Additional file 1: Table S2). Recombinant vectors were confirmed by sequencing, after which they were then transformed into Agrobacterium tumefaciens (GV3101). WT Arabidopsis thaliana (Col-0) plants were then infected with the transformed bacteria by the floral dip method [56].The seeds of WT and EX (independent transgenic lines 4, 5 and 6) lines were disinfected with sodium hypochlorite. After 3 days of vernalization at 4 °C, the plates containing the seeds were transferred to a growth chamber. Three-week-old Arabidopsis seedlings were subjected to qRT-PCR analysis of GmMYB118 gene expression in ectopic expression and WT (Col-0) plants (Additional file 1: Figure S2B). Expression of AtActin was analyzed as a loading control (Additional file 1: Table S1).For germination assays, approximately 80 sterilized seeds of every genotype of the WT and EX plants were sown on 1/2-strength MS growth media that were supplemented with various concentrations of PEG6000 (0, 3, 6 and 9%) (Merck, USA) or NaCl (0, 75, 100 and 125 mM) (XiLONG, China). The plates were housed in a growth chamber that was maintained at a temperature of 22 °C, an irradiance of 40 μmol/m2/s1, and a photoperiod of 16 h light/8 h dark, as described previously [57, 58]. The number of germinated seeds was counted every 12 h, and at least 80 seeds per genotype were measured.For root growth assays, sterilized WT and EX seeds were sown on 1/2-strength MS growth media. Five-day-old seedlings were transferred to growth media that contained different concentrations of PEG6000 (0, 3, 6 and 9%) (Merck, USA) or NaCl (0, 75, 100 and 125 mM) (XiLONG, China) for a week. Images were collected after 7 days of growth, and the root lengths were evaluated via an Epson Expression 11000XL root system scanning analyzer (Epson, Japan) [57]. At least 30 seedlings per genotype were measured.To test drought and salt tolerance at later developmental stages, three-week-old seedlings were subjected to dehydration or 250 mM NaCl for 14 days. The plant phenotypes were imaged, and the plants were counted to determine the survival rate. At least 30 seedlings were measured per line in each treatment, and all stress assays were performed at least three times.
Heat and freezing stress assays of transgenic Arabidopsis plants
To test the heat tolerance at the seedling stage, sterilized WT and EX seeds were sown on 1/2-strength MS growth media. Five-day-old seedlings were subjected to 37 °C for 1 h, allowed to recover at 22 °C for 2 h, and then subjected to 44 °C for 4.5 h [59]. For freezing tolerance assays, 5-day-old seedlings were subjected to − 4 °C for 4 h [34]. After the seedlings recovered for 5 days, their phenotypes were imaged, and the plants were counted to determine the survival rate. At least 60 seedlings were measured per line in each treatment, and all stress assays were performed at least three times.
Measurements of proline and MDA contents
Prior to measurements, the soybean plants that transferred into pot for 5 days were subjected to drought or 250 mM NaCl stress for a week or 3 days, after which the proline content of leaves was measured as described previously [60]. Similarly, the MDA content of leaves was determined with an MDA assay kit (Comin, China) in accordance with the manufacturer’s protocol. All the measurements were repeated three times, and ANOVA test was used for statistical analyses.For disinfection of Arabidopsis thaliana seeds, the seeds of WT and EX (independent transgenic lines 4, 5 and 6) lines was disinfected with sodium hypochlorite. After 3 days of vernalization at 4 °C, the plates containing the seeds was transferred to a growth chamber. For statistical methods of data, the data shown are the means ± SDs (n = 80) of three experiments. ANOVA tests demonstrated that there were significant differences (∗ P < 0.05, ∗∗ P < 0.01). Expression of AtActin was analyzed as a loading control in Arabidopsis (Table S1). Expression of GmActin was analyzed as a control in soybean (Table S1.) Figure S1. Quantitative gene expression of all MYB-related TF family members in soybean. The tissue expression data of quantified prediction for a diverse set of fourteen tissue types from the soybase website (http://soybase.org/soyseq/). Figure S2. Subcellular localization and expression level of GmMYB118. GmMYB118 was localized in the nucleus in Arabidopsis mesophyll protoplasts (A). Scale bars = 20 μm. GmMYB118 gene expression in ectopic expression and WT (Col-0) plants (B). Figure S3. Germination rate of OE lines under PEG treatment. Images of germinating EX and WT (Col-0) seeds after 72 h under 0, 3, 6 and 9% PEG6000 treatment (A). The germination of the WT and EX plants of sown on 1/2-strength MS growth media with 0% (B), 3% (C), 6% (D) and 9% PEG6000 (E) were monitored until to 72 h. Figure S4. Germination rate of EX lines under NaCl treatment. Images of germinating EX and WT (Col-0) seeds after 72 h under 0, 75, 100 and 125 mM NaCl treatment (A). The germination of the WT and EX plants of sown on 1/2-strength MS growth media with 0 (B), 75 (C), 100 (D) and 125 mM NaCl (E) were monitored until to 72 h. Figure S5. Targeted mutagenesis in soybean hairy roots and GUS staining. The GUS staining of transgenic hairy roots revealed a transformation efficiency of approximately 50% (A). The target gene was amplified with specific primers and sequenced (AuGCT, China). The results show that some bases have been replaced (B). Figure S6. Expression level of GmMYB118 under drought and salt treatments. Expression level of GmMYB118 under drought (B) and salt (C) treatments was quantified by qRT-PCR assays. The expression level of GmMYB118 under normal condition was shown in Figure S6A.
Table S1. Gene-specific primers used for qRT-PCR. Table S2. Primers used to construct recombinant vectors. (PDF 753 kb)