Muyiwa Ajoke Akindolire1, Ajay Kumar1, Collins Njie Ateba1,2. 1. Department of Biological Sciences, School of Environmental and Health Sciences, Faculty of Agriculture, Science and Technology, North-West University, Mafikeng Campus, South Africa. 2. Food Security and Safety Niche Area, Faculty of Agriculture, Science and Technology, North-West University, Mmabatho, Mafikeng 2735, South Africa.
Abstract
Food borne diseases are a major public health concern worldwide. Staphylococcus aureus is one of the potential food borne pathogens which causes nosocomial and community acquired infections. In the present study, 74 representative strains of S. aureus isolated and characterized in previous study from different milk samples were subjected to random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) and enterobacterial repetitive intergenic consensus (ERIC)-PCR to generate fingerprints to determine the genetic relationships of the isolated strains. A total of 20 RAPD patterns were generated and the number of amplified fragments obtained ranged from 0 to 8 with molecular weight ranging from 250 to 2000 bp. A dendrogram based on fingerprinting pattern grouped isolates into twelve major clusters (I-XII). In the case of ERIC-PCR 9 banding patterns were obtained with amplicons ranging from 1 to 8 and band sizes ranging from 250 to 2000 bp. A total of four major clusters (I-IV) were observed in the dendrogram based on ERIC fingerprints. The discrete banding patterns obtained both from ERIC-PCR and RAPD-PCR showed remarkably the genetic diversity of S. aureus. The findings of this study indicate that raw, bulk and pasteurized milk in the North-West Province was contaminated with toxigenic and multi-drug resistant S. aureus strains. This emphasizes the need to implement appropriate control measures to reduce contamination as well as the spread of virulent S. aureus strains to reduce the burden of disease in humans.
Food borne diseases are a major public health concern worldwide. Staphylococcus aureus is one of the potential food borne pathogens which causes nosocomial and community acquired infections. In the present study, 74 representative strains of S. aureus isolated and characterized in previous study from different milk samples were subjected to random amplified polymorphic DNA (RAPD) polymerase chain reaction (PCR) and enterobacterial repetitive intergenic consensus (ERIC)-PCR to generate fingerprints to determine the genetic relationships of the isolated strains. A total of 20 RAPD patterns were generated and the number of amplified fragments obtained ranged from 0 to 8 with molecular weight ranging from 250 to 2000 bp. A dendrogram based on fingerprinting pattern grouped isolates into twelve major clusters (I-XII). In the case of ERIC-PCR 9 banding patterns were obtained with amplicons ranging from 1 to 8 and band sizes ranging from 250 to 2000 bp. A total of four major clusters (I-IV) were observed in the dendrogram based on ERIC fingerprints. The discrete banding patterns obtained both from ERIC-PCR and RAPD-PCR showed remarkably the genetic diversity of S. aureus. The findings of this study indicate that raw, bulk and pasteurized milk in the North-West Province was contaminated with toxigenic and multi-drug resistant S. aureus strains. This emphasizes the need to implement appropriate control measures to reduce contamination as well as the spread of virulent S. aureus strains to reduce the burden of disease in humans.
Staphylococcus aureus is a gram positive cocci commonly present on the skin and mucous membranes of animals and humans (Tong et al., 2015). For the past many years, this organism has established itself as a frequent multiple antibiotic resistant (MAR) bacteria particularly to methicillin and vancomycin that may cause nosocomial or community acquired infections (Boucher and Corey, 2008). S. aureus is known to cause a number of pathological conditions in humans and animals that range from mild skin infections, bacteremia, systemic diseases, and osteomyelitis to the more complicated toxic shock syndrome and staphylococcal food poisoning (Abdulgader et al., 2015, Tong et al., 2015). The emergence of MAR S. aureus poses therapeutic challenges to the health/veterinary professionals and dairy cattle producers (Hiramatsu et al., 2014). Nowadays, antimicrobial resistance has become a major public health problem. The development of resistance in bacterial pathogens of humans and animals has been ascribed to the extensive therapeutic use of antimicrobials or their use as growth promoters in animal feed production (Silbergeld et al., 2008, Economou and Gousia, 2015). Resistance to various antimicrobial agents in bacteria is attributed to various genes which are present on the plasmids, transposons, chromosome or gene cassettes which are incorporated into integrons (Rychlik et al., 2006).Food is one of the most common modes of transmission of pathogens to humans and S. aureus is one of the important food-borne pathogens (Schelin et al., 2011). Milk is a nutritious food which is consumed by human beings and may serve as an excellent growth medium for various microorganisms including S. aureus. Raw or processed milk consist of fats, proteins, vitamins, carbohydrates, minerals etc and therefore is extremely susceptible to microbial spoilage (Prescott, 1999, Anderson et al., 2011). S. aureus gets a route into raw milk directly through cows which experience clinical or sub-clinical mastitis and indirectly by unhygienic environment, contaminated utensils used for milking and the milking personnel (Ateba et al., 2010, Anderson et al., 2011). Approximately 105 CFU/g count of S. aureus is sufficient to produce an enterotoxin that can cause human illness. S. aureus contamination of milk can be avoided by heat treatment but it is unable to detoxify the preformed toxin (Barker and Gomez-Tome, 2013). In a few studies, S. aureus was even reported in pasteurized milk samples (Schmid et al., 2009, Vahedi et al., 2011). Therefore, regular surveillance is required to examine the raw as well as pasteurized milk samples for the presence of S. aureus by traditional as well as molecular techniques. Several molecular techniques are available which can be used to characterize S. aureus but enterobacterial repetitive intergenic consensus (ERIC) polymerase chain reaction (PCR) and Random amplification of polymorphic DNA (RAPD) PCR are easier, cheaper and more sensitive as compared to other molecular techniques (Adzitey et al., 2013). In ERIC PCR consensual region of DNA is amplified by a single primer which yields DNA fingerprints whereas in RAPD PCR arbitrary primer amplified random segments from the target nucleic acid which generate a discrete fingerprinting pattern (Tobes and Ramos, 2005, Shi et al., 2010).Plenty of reports are available on MAR S. aureus contamination in milk worldwide (Morandi et al., 2009, Schmid et al., 2009, Haran et al., 2012, Vahedi et al., 2011, Jamali et al., 2015) but scanty reports are available from the South Africa region (Petzer et al., 2009, Ateba et al., 2010). Therefore, knowledge on the occurrence of S. aureus remains limited in South Africa especially in the North-West Province and determination of its prevalence in milk may provide an indication of the health risks associated with the consumption of milk or milk products. Keeping this in view, the present study was designed to study the genetic diversity based on genetic fingerprints of S. aureus isolated from different milk samples from the North-West Province of South Africa using ERIC-PCR and RAPD-PCR.
Materials and methods
Study design, sample collection and isolation
In a previous study S. aureus was isolated by a cross-sectional study design used for the bacteriological analysis of raw, bulk and pasteurized milk in the North-West Province of South Africa. A total of 200 milk samples were randomly collected from 18 sources (supermarkets, shops and farms) in the four districts of the North-west province in South Africa (Table 1). S. aureus was isolated on mannitol salt agar (MSA) media and presumptive isolates were identified by biochemical tests (staining, catalase test, slide agglutination test, DNase test) and molecularly characterized [genus specific 16S rRNA gene amplification and species specific thermonuclease (nuc) gene amplification].
Table 1
Areas of North-West Province of South Africa from which milk samples were collected.
District
Sampling area
Number of samples
Dr. Kenneth Kaunda
Coligny
10
Carletolville
10
Potchefstroom
10
Wolmaransstad
10
Bojanala
Zeerust
10
Swartruggens
10
Rustenburg
10
Luhurutshe
10
Dr. Ruth Mompati
Madibogo
10
Stella
10
Setlagole
10
Vryburg
10
Taung
10
Dr. Modiri Molema
Disaneng
20 [15]⁎
Mafikeng
15 [10]⁎
Mabule
10
Rooigroon
15 [15]⁎
Tshidilamolomo
10
Number of raw milk samples that were collected from the different areas based on availability.
Areas of North-West Province of South Africa from which milk samples were collected.Number of raw milk samples that were collected from the different areas based on availability.In the present study a total of 74 representative S. aureus isolates were further subjected to ERIC-PCR and RAPD-PCR to determine the genetic diversity based on DNA fingerprinting data.
Molecular typing
S. aureus isolates were genotypically characterized using the ERIC and RAPD-PCR protocols. The primer sequences that were used in both typing methods are shown in Table 2. The genomic DNA was isolated using ZR Genomic DNA-Tissue MiniPrep Kit (Zymo Research Corp., Irvine, USA) by following the instructions of the manufacturer.
Table 2
Oligonucleotide primer sequences that were used for RAPD and ERIC-PCR typing of S. aureus isolates.
Primer name
Primer sequence (5′-3′)
Typing procedure
M13a
GAGGGTGGCGGTTCT
RAPD-PCR
ERIC-2b
AAGTAAGTGACTGGGGTGAGCG
ERIC-PCR
Andrighetto et al. (2001).
Vazquez-Sanchez et al. (2012).
Oligonucleotide primer sequences that were used for RAPD and ERIC-PCR typing of S. aureus isolates.Andrighetto et al. (2001).Vazquez-Sanchez et al. (2012).
RAPD-PCR analysis
RAPD-PCR analysis was performed on screened S. aureus isolates using the primer M13 (Andrighetto et al., 2001). The thermal cycling conditions for amplification involved 2 cycles of 94 °C for 30 s, 35 °C for 1 min, 72 °C for 2 min; 40 cycles of 93 °C for 30 s, 35 °C for 1 min, 72 °C for 2 min and a final elongation step of 72 °C for 5 min.
ERIC-PCR analysis
ERIC-PCR analysis was performed on S. aureus isolates using the ERIC-2 primer as described earlier by Vazquez-Sanchez et al. (2012). PCR was performed for amplification at an initial denaturation at 94 °C for 4 min, 35 cycles of 94 °C for 60 s, 25 °C for 60 s, 72 °C for 2 min and a final extension at 72 °C for 5 min.
Agarose gel electrophoresis of the DNA extracted and PCR products
DNA extracted and PCR products were separated by electrophoresis on a 0.8% (w/v) and 2% (w/v) agarose (Seakme®, Rockland, USA) gel respectively, using Tris–acetate-EDTA (1 X TAE) (40 mM Tris, 1 mM EDTA and 20 mM glacial acetic acid; pH 8.0) on a horizontal agarose gel equipment (BiocomDirect, Bridge of Weir, UK). Electrophoresis was performed at 100 V for 10 min and later 80 V for 60 min. After electrophoresis gel was stained in 0.1 μg/ml of ethidium bromide (Bio-Rad Laboratories, Canada) solution. A 1 kb DNA ladder (Fermentas, Glen Burnie, USA) was included in all fingerprinting gels as a molecular weight standard. ChemiDoc™ MP Imaging system (Bio-Rad, Hercules, USA) was used to visualize and capture the images.
Statistical analysis
The genetic profiles generated from the RAPD-PCR and ERIC-PCR were captured using GeneTools (version 3.00.22) software (SynGene, UK). The fingerprints were compared and analyzed with the TotalLab Phoretix 1D Pro software (UK). The presence, absence and intensity of band data were obtained, exported to Microsoft Excel (Microsoft Office, 2003) and used to generate a data matrix. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) and complete linkage algorithms were used to analyze the percentage similarity and matrix data. Relationships between the various profiles and/or lanes were expressed as dendrograms.
Results
The 74 representative S. aureus isolates whose identities had been confirmed through amplification of the thermonuclease gene (nuc) were subjected to the genotypic typing techniques (RAPD and ERIC PCR) to determine the similarities between the isolates from different sampling sites. The reproducibility of RAPD and ERIC PCR were calculated for each isolate independently and it was more than 95% for both PCR techniques.
RAPD-PCR and ERIC-PCR analysis
The 74 antibiotic resistant S. aureus isolates were subjected to RAPD analysis and Fig. 1 shows the DNA fingerprinting profiles obtained. Twenty different band patterns were observed and the number of amplified fragments obtained ranged from 0 to 8 with primer M13. The molecular weight of these fragments ranged from 250 to 2000 bp for different isolates.
Figure 1
RAPD-PCR profiles of representative S. aureus isolates isolated from milk samples from different sampling sites. Lanes 1 = 1 Kb DNA ladder; Lanes 2–20 = A representation of the RAPD profiles for S. aureus isolates.
RAPD-PCR profiles of representative S. aureus isolates isolated from milk samples from different sampling sites. Lanes 1 = 1 Kb DNA ladder; Lanes 2–20 = A representation of the RAPD profiles for S. aureus isolates.Based on these band pattern data, a dendrogram (Fig. 2) was generated using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA). As evident from Fig. 2, twelve RAPD clusters (genotype) with a similarity of 80% were identified. Four profile groups (III, IV, VIII and XII) were the most predominant among the population when compared to the other groups. Profile XII was the most common with 16.2% of the isolates belonging to this group and this was followed by profiles III, IV, and VIII with 12.2% of each isolate. Profile XII had a total of 12 isolates which appeared in all milk types. Profile groups IV and VIII were not present in tank milk but were evident in all other milk types. However, the 9 isolates with profile III were present in all milk types. Isolates from raw milk had the most diverse RAPD-PCR types which appear in 10 out of 12 profile types. Although there was some diversity based on the RAPD analysis among the isolates obtained in the study, a large proportion of the isolates from raw and tank milk showed genetic similarity in clustering patterns (Fig. 2).
Figure 2
RAPD-based dendrogram showing genetic relatedness among S. aureus isolates (Z = Zeerust, RO = Rooigroond, V = Vryburg, MP/MB/M = Mafikeng, B = Disaneng, TP = Taung, CV = Carltolville, ST = Stella, R = Rustenburg, BP = Potchefstroom, PID/PIT = Setlagole).
RAPD-based dendrogram showing genetic relatedness among S. aureus isolates (Z = Zeerust, RO = Rooigroond, V = Vryburg, MP/MB/M = Mafikeng, B = Disaneng, TP = Taung, CV = Carltolville, ST = Stella, R = Rustenburg, BP = Potchefstroom, PID/PIT = Setlagole).All 74 isolates were further subjected to the ERIC genotypic typing technique and the representation of the ERIC-PCR amplicons that was resolved on 2% (w/v) agarose gel is shown in Fig. 3. ERIC profiles produced 9 different banding patterns with amplicons ranging from 0 to 8. The band sizes ranged from 250 to 2000 bp. The dendrogram in Fig. 4 was generated based on the REP-PCR derived fingerprint data using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA).
Figure 3
ERIC-PCR profiles of representative S. aureus isolates isolated from milk samples from different sampling sites. Lanes 1 and 21 = 1 Kb DNA ladder; Lanes 2–20 A, B = A representation of the ERIC profiles for S. aureus isolates.
Figure 4
ERIC-based dendrogram showing genetic relatedness among S. aureus isolates (Z = Zeerust, RO = Rooigroond, V = Vryburg, MP/MB/M = Mafikeng, B = Disaneng, TP = Taung, CV = Carltolville, ST = Stella, R = Rustenburg, BP = Potchefstroom, PID/PIT = Setlagole).
ERIC-PCR profiles of representative S. aureus isolates isolated from milk samples from different sampling sites. Lanes 1 and 21 = 1 Kb DNA ladder; Lanes 2–20 A, B = A representation of the ERIC profiles for S. aureus isolates.ERIC-based dendrogram showing genetic relatedness among S. aureus isolates (Z = Zeerust, RO = Rooigroond, V = Vryburg, MP/MB/M = Mafikeng, B = Disaneng, TP = Taung, CV = Carltolville, ST = Stella, R = Rustenburg, BP = Potchefstroom, PID/PIT = Setlagole).At 80% similarity cut-off value, isolates were divided into 4 clusters (designated by I–IV) (Fig. 4). ERIC profile II was the most common with 40.5% of the isolates and this was followed by ERIC-PCR profiles IV, I, and III with 36.5%, 17.6% and 5.4% of the S. aureus isolates respectively. ERIC profile group II had a total of 30 S. aureus isolated from all milk types. When the profiles were compared for association of isolates from the different milk sources, profiles I and IV had a similar distribution of strains whereas profile II contained isolates from all milk types except for pasteurized milk. Similar to the RAPD-PCR typing, isolates from raw milk had the most diverse ERIC fingerprinting profiles and this was reflected by the fact that isolates from these milk types appear in all the 4 clusters.
Discussion
Food borne diseases are a major public health concern worldwide. S. aureus is a commensal and opportunistic pathogen that causes a variety of infections (Lowy, 1998). This organism is potentially versatile having a combination of antibiotic resistance mechanism, invasiveness, and various toxin producing genes. In recent years, it has emerged as a potential food borne pathogen which causes nosocomial and community acquired infections (Kadariya et al., 2014). S. aureus flourishes well in various food materials as nutrient rich food serves as an optimum growth medium. Various food materials are implicated in S. aureus food disease which may include dairy and dairy products, meat and meat products, poultry products, salad, bakery products etc. (Tamarapu et al., 2001, Argudin et al., 2010).Milk is one of the important foods which is used by human beings almost daily. As it is rich in nutrients it serves as an excellent growth medium for various microbes (Prescott, 1999, Zakary et al., 2011). Therefore, milk may act as a transmission vehicle for various microorganisms including S. aureus from animals to humans. Keeping this in view, a study was conducted previously and S. aureus was isolated from different milk samples from the North-West Province of South Africa. A total of 74 representative S. aureus isolates were subjected to genetic fingerprinting to determine the genetic relationship of these isolates by using RAPD-PCR and ERIC-PCR. In the present study both these techniques give highly reproducible results. The results of RAPD-PCR showed that isolates of the most dominant cluster 12 (XII) were recovered from all milk types which showed the close genetic relationship of these isolates with each other independent of the type of milk sample. Similar types of findings were also reported earlier (Reinoso et al., 2008). Isolates of cluster 4 (IV) and cluster 8 (VIII) were recovered only from raw and pasteurized milk samples. The isolates may be low in number in raw milk which might be the reason that they were not detected in bulk milk samples. Some isolates were detected in pasteurized milk samples and this could be due to the fact that during heat treatment inadequate heat does not inactivate the isolates which persist after pasteurization and accidently microbes may be introduced into milk by handlers hand/unintentionally mixing of raw milk (Seo and Bohach, 2010). The RAPD based dendrogram showed one of the important findings that isolates from raw milk were present in almost all clusters which indicates that raw milk was contaminated with diverse types of S. aureus which were genetically distinct and that is why they were distributed in different clusters. The sources of these genetically diverse microbes may be from infected cowmilk, udder, handlers hand, utensils used for collection of milk, unhygienic farm conditions etc. (Scherrer et al., 2004, Jorgensen et al., 2005, Morandi et al., 2009, Ateba et al., 2010, Daka et al., 2012, Jamali et al., 2015). Similar findings were observed in the case of ERIC-PCR in which four clusters were observed. Similar to the RAPD, dominant cluster 2 (II) of ERIC-PCR contained isolates from all milk types. Also, cluster 1 (I) and cluster 4 (IV) showed similar distributions of isolates as shown in cluster 4 (IV) and cluster 8 (VII) of RAPD-PCR. Isolates from raw milk samples were distributed in all the four clusters as observed in RAPD-PCR for the same reasons. Earlier workers used these molecular techniques to molecularly characterize bacteria from different food samples (Ruzickova et al., 2008, Morandi et al., 2009, Yingwang et al., 2012, Fendri et al., 2013, Kar et al., 2015). A general observation with these two methods used in the present study was that the clustering of isolates was independent of the type of milk sample and the location. Similar findings were observed earlier where no relationship could be ascertained between fingerprinting pattern and product type/category (Morandi et al., 2009, Kar et al., 2015). The present study showed that RAPD-PCR (12 clusters) has more discriminative power than ERIC-PCR (4 clusters) as DNA bands generated in RAPD-PCR was more as compared to ERIC-PCR. In contrast to discriminative power both the techniques showed the same type of clustering pattern of the isolates. Thus, the combination of both these techniques could be very useful to differentiate S. aureus isolates for the purpose of epidemiological surveillance from food samples.
Conclusions
Results of the present study depicted the large genotypic diversity of S. aureus isolated from different milk samples. Both molecular techniques i.e. RAPD-PCR and ERIC-PCR used in the present study gave highly reproducible results with high discriminative power to differentiate genetic dissimilar S. aureus isolated from the same sample. The cause of concern from the present study is that most of the isolates were multiple drug resistant including methicillin and some isolates posed sec gene coding for staphylococcal enterotoxin. Therefore, from the public health point of view good hygienic conditions should be maintained in the farm and strict good manufacturing practices (GMP) should be followed in the production area of the milk plant so as to prevent the transmission of S. aureus and their associated virulence determinants to consumers.
Authors: Daniela Schmid; Rainer Fretz; Petra Winter; Michaela Mann; Gerda Höger; Anna Stöger; Werner Ruppitsch; Johann Ladstätter; Norbert Mayer; Alfred de Martin; Franz Allerberger Journal: Wien Klin Wochenschr Date: 2009 Impact factor: 1.704
Authors: Daniel Vázquez-Sánchez; Marta López-Cabo; Paula Saá-Ibusquiza; Juan José Rodríguez-Herrera Journal: Int J Food Microbiol Date: 2012-06-02 Impact factor: 5.277
Authors: Steven Y C Tong; Joshua S Davis; Emily Eichenberger; Thomas L Holland; Vance G Fowler Journal: Clin Microbiol Rev Date: 2015-07 Impact factor: 26.132
Authors: Fuad Ameen; Shorouk A Reda; Sahar A El-Shatoury; Emad M Riad; Mohamed E Enany; Abdullah A Alarfaj Journal: Saudi J Biol Sci Date: 2019-09-14 Impact factor: 4.219
Authors: Haoming Wu; Yang Wang; Bingyao Du; Huiying Li; Lei Dong; Haiyan Hu; Lu Meng; Nan Zheng; Jiaqi Wang Journal: Front Microbiol Date: 2022-02-25 Impact factor: 5.640
Authors: Geziella Áurea Aparecida Damasceno Souza; Anna Christina de Almeida; Mauro Aparecido de Sousa Xavier; Lívia Mara Vitorino da Silva; Cintya Neves Sousa; Demerson Arruda Sanglard; Alessandra Rejane Ericsson de Oliveira Xavier Journal: Vet World Date: 2019-12-11