Literature DB >> 30496224

Development and validation of a method for human papillomavirus genotyping based on molecular beacon probes.

Jiangfeng Lyu1, Yuefeng Yu1, Caixia Pan1, Jing Zhou1, Xuyi Ren1.   

Abstract

We describe a new assaying system for the detection and genotyping of human papillomavirus (HPV) based on linear-after-the-exponential-PCR(LATE-PCR) and melting curve analysis. The 23 most prevalent HPV strains (types 6, 11, 16, 18, 31, 33, 35, 39, 42, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73, 81, 82, and 83) are assayed in two sealed reaction tubes within 2 h. Good sensitivity and specificity was evaluated by testing cloned HPV DNA and clinical samples. The detection limit was 5-500 copies/reaction depending on the genotype. No cross-reactivity was observed with the other HPV types that are not covered by our method or pathogens tested which were commonly found in female genital tract. When compared with the HPV GenoArray Diagnostic kit, the results from 1104 clinical samples suggest good overall agreement between the two methods,(98.37%, 95% CI: 97.44%-98.97%) and the kappa value was 0.954. Overall, this new HPV genotyping assay system presents a simple, rapid, universally applicable, sensitive, and highly specific detection methodology that should be useful for HPV detection and genotyping, therefore, is potentially of great value in clinical application.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30496224      PMCID: PMC6264813          DOI: 10.1371/journal.pone.0207930

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Cervical cancer is one of the most prevalent cancers in women worldwide, with estimated 527,624 new cases and 265,672 deaths in 2012. Over 85% cervical cases were diagnosised in developing countries [1]. Cytological screening—the Papanicolaou (Pap) test—has greatly reduced the incidence of invasive cervical cancer over the past 50 years [2]. However, Pap test has limited diagnosis sensitivity, which leads to missed diagnosis of grade II, grade III cervical intraepithelial neoplasia (CIN) and even cervical cancer[3]. The majority of cervical cancer cases are caused by persistent infection with HPV, particularly with high-risk genotypes (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68) [1, 4, 5]. Molecular assays for the detection of HPV DNA in cervical specimens and have been developed and widely used in clinics. These molecular methods are more sensitive than the Pap test for the detection of CIN II and CIN III [6, 7]. Currently, the most commonly used HPV detection and genotyping method in China is the GenoArray test (HPV GenoArray test kit; Hybribio Ltd, Hong Kong). However, the limitations of these assays are that they are prone to contamination and are time consuming. In addition, the diagnosis of borderline cases is difficult because of the read-outs being solely based on direct visualization [8]. In this study, we developed a new assay that uses LATE-PCR and Melting curve analysis (LPM) for the DNA detection and genotyping of the 23 most common HPV strains (types 6, 11,16, 18, 31, 33, 35, 39, 42, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73, 81, 82, and 83) [9-10]. We evaluated this new method based on its clinical performance and concluded that it is faster and more convenient than the current commercially available kits.

Materials and methods

Sample collection

One liquid-based cytology (LBC) sample was collected from each of 1108 patients aged 19–89 years (median age, 43 years) who visited the DiAn Medical Laboratory for routine HPV screening or genotyping from August to December 2017. Additional 920 HPV carrying samples (40 samples for each HPV type including HPV types 6, 11, 16, 18, 31, 33, 35, 39, 42, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73, 81, 82, and 83), which diagnosised positive using the HPV GenoArray test kit or by type-specific PCR sequencing (for HPV types 70, 73, 82, and 83), were selected and stored at −80°C until use. The chosen samples were collected from 920 patients aged 23–92 years (median age, 45 years) from January 2016 to May 2017. All samples were collected using a cervical cytobrush and stored in PreservCyt solution (U.S. Cyt Company)tubes along with the cytobrush. The cervical sample collection and followup studies were approved by the ethics committee of DiAn Medical Laboratory (Reference number DA-YXLC-20170619-1).

DNA extraction

The LBC samples were used for genomic DNA extraction using a QIAamp DNA Mini kit (Qiagen, Hilden, Germany) as per manufacturer’s instruction. DNA was eluted from the columns with 100 μL AE buffer and stored at −20°C.

Primers and molecular beacon probes design

Various consensus primers have been reported for the amplification of a specific fragment of L1 the region of HPV DNA, including GP5+/6+, MGP, MY09/11, and PGMY09/11 [11-13]. After considering amplification efficiency and the need for molecular beacon designation, GP6+/MY11 were chosen as the LATE-PCR primer set to generate the single strand DNA template for hybridization of the corresponding molecular beacon probe. The design of molecular beacon probes were aided by the DNA folding program mfold (http://unafold.rna.albany.edu/?q=DINAMelt/Quickfold) and the probe–target hybrid folding program DINAMelt (http://unafold.rna.albany.edu/?q=DINAMelt/Two-state-melting) was used to predict the possible hybrid structures and Tm values. Sample quality is monitored by amplifying a 100-base pair (bp) fragment of the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene using the primers G100f 5′-CTGCTCACATATTCTGGAGGAG-3′ (forward) and G100r 5′- AAAAGCAGCCCTGGTGACC-3′ (reverse). All molecular beacon probe sequences and corresponding targets are listed in Table 1.
Table 1

Molecular beacon probes used in LATE-PCR and their corresponding hybridized target sequences.

ProbeNucleotide Sequence 5′→3′
P6FAM-CCGGC ACGCAGTACCAACATGACACTATGTGCATC GCCGG-DAB
HPV6ACGCAGTACCAACATGACATTATGTGCATC
HPV11ACGCAGTACAAATATGACACTATGTGCATC
HPV16ACGCAGTACAAATATGTCATTATGTGCTGC
P58HEX-CCGGC TCGTAGCACTAACATGACATTATGCACTGAAG GCCGG-DAB
HPV58TCGTAGCACTAATATGACATTATGCACTGAAG
HPV52TCGTAGCACTAACATGACTTTATGTGCTGAGG
HPV33TCGCAGTACTAATATGACTTTATGCACACAAG
P68HEX-CCCCG TACCACTCCCAGGACCAATTTAACTTT CGGGG-DAB
HPV68TACCACTCGCAGTACCAATTTTACTTT
HPV18TACCACTCGCAGTACCAATTTAACAAT
P59CY5-CCGGC CGTAGTACCAATCTGTCTGTGTGTGCTTC GCCGG-DAB
HPV31CGTAGTACCAATATGTCTGTTTGTGCTGC
HPV59CGCAGCACCAATCTTTCTGTGTGTGCTCT
HPV35CGTAGTACAAATATGTCTGTGTGTTCTGC
HPV42CGTAGTACTAACATGACTTTGTGTGCCAC
P51FAM-CCGGC TAGAAGTACTAATTTGACTATTAGCACTGCTGCTGCTCAG GCCGG-DAB
HPV51TAGAAGTACAAATTTAACTATTAGCACTGCCACTGCTGCG
HPV56TAGAAGTACTAACATGACTATTAGTACTGCTACAGAACAG
HPV81CAGAAGCACCAATTTTACTATTTGCACAGCTACATCTGCT
MM4TAGAAGTACCAATTTAACCATTAGCACTGCTGTTACTCAA
P66FAM-CCCGC ACCAACATGACTATTAATGCAGCTAAAAGC GCGGG-DAB
HPV66ACCAACATGACTATTAATGCAGCTAAAAGC
P83XHEX-CCCCG AGTACCAATATTACTATTACAGCTGCTAC CGGGG-DAB
HPV83AGTACCAATATTACTATTTCAGCTGCTGC
HPV84AGCACCAATTTTACTATTAGTGCTGCTAC
P73HEX-CCCGC AAGCACTAATTTTTCTGTATGTGTAGGTACA GCGGG-DAB
HPV73AAGCACTAATTTTTCTGTATGTGTAGGTACA
P45CY5-CCGC GTACTAACTTTACATTATGTGCCT GCGG-DAB
HPV45GTACTAATTTAACATTATGTGCCT
HPV39GTACCAACTTTACATTATCTACCT
HPV70GTACTAATTTTACATTGTCTGCCT
P53XCY5-CCCGC AACCACACAGTCTATGTCTACATATTCTTC GCGGG-DAB
HPV53AACCACACAGTCTATGTCTACATATAATTC
GAPDHPTXR-CCCGC CCCAATACGACCAAATCTAAGAGACAAGAGGC GCGGG-BQ2

LATE-PCR

LATE-PCR was performed in a volume of 40 μl with 5 μl of extracted DNA as template. Each sample was tested in two reactions: A and B. Both reaction mixture contains 1× PCR Buffer (Takara, Japan), 2 mM MgCl2 (Promega, USA), 12.5 nM dU plus deoxynucleotide triphosphates (dNTPs, Takara), 37.5 nM limiting primer MY11 (5′-GCMCAGGGWCATAAYAATGG-3′), 500 nM excess primer GP6+ (5′-GAAAAATAAACTGTAAATCATATTC-3′), two units Hot-Start Taq polymerase (Takara), and one unit Uracil DNA Glycosylase (UNG, Takara). Probes in reaction A were P6(25 nM), P58 (15 nM ), P68(15 nM), and P59(20 nM), and for reaction B there were P51(25 nM), P66(25 nM), P73(15 nM), P83(15 nM), P45(20 nM) and P53(20 nM). Reaction B also contained internal control primers G100f /R (50 nM) and probe GAPDHP(20nM). All primers and probes were ordered and purchased from Invitrogen Life Technologies (Shanghai, China). A LightCycler480 (Roche, Germany) real time quantative thermo cycler was used for LATE-PCR. The PCR was programmed as below: 10 min at 50°C and 5min at 95°C, followed by 55 cycles (95°C for 15sec, 45°C for 30sec, and 72°C for 30 sec), preceded by a melting program starts at 37°C with 1°C increment per 30 sec interval until 85°C. Fluorescence signals in four different channels were collected and analyzed: FAM (465–510), HEX (533–580), TXR (533–610), and CY5 (618–660). To generate the Tm values, melt-curve analysis using the first derivative of fluorescence at temperatures between 37°C and 85°C was used to process the fluorescence data of the probe–target hybridizations.

Determination of reference value

The 920 HPV-positive samples were further tested using the LPM genotyping assay described above and Tm values were collected. The nonparametric rank percentile method determinations of the 2.5th and 97.5th individual percentiles, as well as 95% confidence intervals for the upper and lower limits of each reference interval was used to calculate the reference interval. Results were evaluated using SPSS 16.0 statistical software. The normal distribution was examined by Kolmogorov–Smirnov Z-test.

Analytical sensitivity and specificity

Recombinant plasmids containing the cloned full-length L1 gene were used to assess the analytical sensitivity of our method. The inserted DNA fragments of each HPV type were PCR amplified from corresponding HPV positive samples that were diagnosised by the HPV GenoArray test. The pMD19-T vector(Takara) was used as the carrier and the construction of pMD19-T-L1 was performed following the manufacturer’s instruction. The accuracy of cloned L1 fragments were examined by DNA sequencing follow by BLAST, the results were 100% identical to the reference sequences. An ABI3130 genetic analyzer (Applied Biosystems, USA)sequencing instrument was used for sequencing in our experiment. The concentration of purified plasmids were quantified using a NanoDrop1000 Spectrophotometer (NanoDrop, DE). Copy numbers of the cloned HPV L1 genes in the stock were calculated using the molecular weights of the recombinant plasmids; Quantified plasmids were diluted with TE buffer (pH 8.0) to prepare serial of dilutions with concentration from 1 to 106 copies/ml. Equal amount (40 ng/ml) of human genomic DNA was added into each dilution. Five μl of each plasmid dilution were used as template in LATE-PCR and each HPV type run in 20 replicate reactions per dilution. To evaluate the specificity of our method, DNA was purified from LBC samples that were diagnosised Neisseria gonorrhoeae (ATCC49226)/ Candida albicans (ATCC90028)/ Escherichia Coli (ATTCC25922)/ Staphylococcus aureus (ATTCC25923)/ Herpes simplex virus type II/ Treponema pallidum/ Ureaplasma urealyticum,/Mycoplasma hominis positive using the QIAamp DNA Mini kit. Five microliter of HPV26, 40, 43, 44, 54, 61, 67, 69, 71, and 72 plasmids at a concentration of 108 copies/ml purchased from National Institutes for Food and Drug Control were used as templates in LATE-PCR ().

Comparison of the HPV GenoArray test with the LPM genotyping assay

We next compared our method with the GenoArray test, 1108 LBC samples were tested by both method in parallel. The GenoArray test is an L1 consensus primer-based PCR assay that covers 21 HPV genotypes, including type16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 53, 66, 6, 11, 42, 43, 44 and 81. The low-risk HPV genotypes 43 and 44 were out of the detection range of the LPM assay and genotypes 70, 73, 82, and 83 could be detected, but not quantified by LPM assay. All GenoArray detection procedures were performed according to the manufacturer’s instructions, and LPM genotyping was conducted as described above. All data were analyzed with SPSS statistical software(version 16.0). The coincidence rate between the two detection methods was assessed using absolute agreement and Cohen’s kappa. The nonparametric McNemar test was used to analyze the complementarity of the two methods and if there was significant difference between the results obtained by the two methods. Difference with P value≥0.05 was considered not statistically significant.

Type-specific sequencing analysis

Sequencing was performed when there was discrepancy in the results between the two assays as described by Peng et al. [3]. The PGMY09/11 primer set was used to amplify a specific fragment of the L1 gene from purified DNA. HPV was typed by the sequence of amplified fragments using a type-specific sequencing primer. Sequencing was performed using the BigDye Terminator v3.1 cycle sequencing kit with AmpliTaq DNA polymerase (Applied Biosystems) according to the protocols provided by the manufacturer. The sequences obtained were aligned with reference HPV sequences using the BLAST tool (http://www.ncbi.nlm.nih.gov/BLAST).

Results

Reference Tm values of each HPV type

For each HPV type, the results from forty HPV-positive clinical sample were used to establish reference intervals that are with statistically significance. All samples were tested with the LPM assay as described above and the Tm values were recorded. Each Tm value were normal distribution tested; The reference Tm values were generated and evaluated using SPSS 16.0 software. Reference Tm value intervals for each HPV type are shown in Table 2. In separate reactions (A or B), no Tm value overlapping was observed.
Table 2

Tm value of each HPV type.

ReactionFluorescent labelingExcitation and Emission wavelengths (nm)HPV typeTm Value
AFAM465–5104549.82–51.00
1653.33–55.45
1158.00–59.41
664.44–67.22
HEX533–5806847.09–48.63
1851.40–53.00
3354.69–55.90
5257.11–59.13
5861.77–63.89
CY5618–6604247.49–49.24
5952.17–54.13
3555.62–56.59
3159.93–64.00
BFAM465–5108150.65–52.10
5653.84–55.35
8257.03–58.18
5159.66–61.20
6664.98–66.49
HEX533–5808357.79–59.75
7363.72–65.41
CY5618–6603945.35–47.35
7054.89–56.04
5360.46–66.92

Analytical sensitivity and specificity of the LPM assay

Constructed L1 gene carrying plasmids with gradient concentration (1 to 106 copies/ml) and added human genomic DNA were used as mimic of HPV DNA extracted from clinical sample to assess the sensitivity of LPM assay. The analytical sensitivity was defined as the lowest concentration (target gene copy number per reaction) that ≥ 95% of test runs produced positive results. The detection limit for HPV6, 11, 16, 18, 33, 35, 45, 52, 56, 58, 66, 68, 73, and 81 was 50 copies/reaction; 500 copies/reaction for HPV31, 42, 51, 53, and 59; and 5 copies/reaction for HPV39, 70, 82, and 83.

HPV genotyping results of GenoArray test and LPM assay

Both assay detects largely overlapping sets of HPV genotypes, and HPV genotyping results from 1108 LBC samples were compared; the results were mostly concordant or compatible. Out of the 1108 samples tested, four failed to generate melting peak in the control channel of the LPM assay, suggesting that there was either insufficient cells in the collected sample or presence of PCR inhibitor in the extracted DNA. Therefore, results from 1104 samples with used to compare the performance of the two methods. Overall, the absolute agreement between the tests was 98.37% (95% CI: 97.44%–98.97%) and the kappa value was 0.954, indicating good agreement. The positive concordance rate was 98.94% (95% CI: 98.00%–99.44%) and the negative concordance rate was 96.43% (95% CI: 93.35–98.11%) (Table 3). Subsequently, a comparison of the identification of HPV genotypes was made and the results are summarized in Table 4. The two assays were in perfect agreement for the majority of HPV types within the scope, with kappa values of >0.75 except for HPV45, for which the two assays exhibited only moderate agreement (kappa values, 0.40–0.75). More HPV45 positive cases were detected by LPM assay than the by GenoArray, the presence of HPV45 in those samples were further confirmed by sequencing, indicating that the LPM assay was more sensitive in HPV45 detection.
Table 3

Comparison of results for the overall detection of HPV DNA by the two assays.

LPM assay resultGenoArray assay result
PositiveNegativeTotal
Positive8439852
Negative9243252
Total8522521104
Table 4

Interassay agreements for individual HPV genotypes detected by two assays.

HPV genotypeNo. of samples positive byAbsolute agreement (%)Kappa value
LPMGenoArray/SequencingBoth
641414099.820.975
1125262499.730.940
1614114414099.550.980
1842433698.820.841
3124262499.820.959
3329372999.280.875
3525262599.910.980
3954555399.730.971
4220251999.370.841
45239998.730.557
5151535099.640.960
5216115815699.370.974
5381818099.820.987
5660615999.730.974
5810310110099.640.978
5934413399.180.876
6639383899.910.987
6814171499.730.902
7015141499.910.965
7398899.910.941
8160605999.820.982
8222202099.820.951
8311101099.910.952
Among the 1104 cases studied, 73 had discordant GenoArray and LPM assay results, six exhibited discordant sequencing and LPM assay for HPV70, 73, 82, and 83. The 73 discordant cases were further analyzed by type-specific PCR followed by sequencing (Table 5). According to the results of sequencing, 40 of them matched the LPM assay results and 31consist with the GenoArray results, the sequencing results disagreed with neither assays in two cases.
Table 5

Counts of samples with discordant genotypes reassessed by sequencing.

TotalDetected by GenoArrayConfirmed by sequencingDetected by LPM assayConfirmed by sequencing
621011
1132111
1654211
18137566
3122200
3388600
3511100
3932211
4276111
4514001414
5143111
5272055
5321111
5632211
5841133
5998711
6610011
6833100
8121011
702//20
731//10
822//20
831//10
Some patients suffered from infection from more than one type of HPV, in the aspect of detecting multiple HPV infection, minor variations were observed between the GenoArray/Sequencing and LPM assay (P≥0.05) (Table 6). Both assays detected multiple infections in about 16.0% of the samples, suggesting promising overall agreement (kappa value = 0.88). Details about multiple infections detected by the two methods are as presented in Table 7, the majority of the mixed HPV infections detected were double infections: 81.1% (146 out of 180) and 79.7% (141 out of 177) by the GenoArray and the LPM assays, respectively. The most complex HPV infection was diagnosis by GenoArray assay, six HPV types were found in single LBC sample.
Table 6

The counts of negative, single and multiple HPV infections identified by GenoArray/Sequencing and LPM assay and the consistent or varied results between the two methods (shadded cells).

GenoArray/SequencingLPM assay
Single HPV typeMultiple HPV typeNegativeTotal
Single HPV type644238675
Multiple HPV type221541177
Negative63243252
Total6721802521104
Table 7

Numbers of multiple genotypes identified by GenoArray/Sequencing and LPM assay.

No. of HPV genotypesGenoArray/SequencingLPM
Total177180
Two141146
Three3230
Four22
Five12
Six10

Discussion

Since the discovery of HPV as the major cause of cervical cancer, various methods have been developed for HPV detection and genotyping. The majority of which are based on molecular biology techniques. The Hybrid Capture 2 system (HC2, Digene Corp., USA) detects 13 HR-HPV types (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68) and five LR-HPV types (6, 11, 42, 43, and 44) by signal amplification technique. It distinguishes high-risk from low-risk types, but incapable of HPV genotyping [11]. However, identifying HPV to genotype is clinically important. International consensus is that persistent infection of HR HPVs such as HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, can lead to cervical cancer, while LR viruses infection causes benign cervical tissue alterations or genital warts [12]. Typing HPV infection can provide extra support for disease management and novel primary cervical cancer screening strategies based HPV DNA detection are becoming widely accepted [13]. In addition, new broad-spectrum HPV vaccines are in development [14]. Bivalent (against types 16 and 18), quadrivalent (against types 6, 11, 16, and 18) and nonavalent (against types 6, 11, 16, 18, 31, 33, 45, 52, and 58) vaccines have went through clinical trial [15-21]. Integration of vaccination with screening could reduce not only cervical cancer onset but also risks associated with over-treatment. Currently, HPV GenoArray test is one of the most used methods for HPV genotyping in China. This method covers 21 HPV genotypes including 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 53, 56, 58, 59, 66, 68 and 81. Numerous studies have proven its reproducibility and clinical sensitivity. Therefore, we used it as reference for the LPM assay in this study [8, 22]. However, we found the drawbacks of GenoArray are being prone to contamination and its time-consuming procedure [8]. In addition, it is sometimes difficult to give an unambiguous result for samples with low viral load, because the determination of results is solely based on direct visualization. Real-time PCR has long been used in Vitro pathogen detection and identification, its limitation is only limited number of targets can be detected in one reaction, due to the limited fluorescence channel provided by the real-time PCR instrument [23-26]. However, it is often desirable to detect and identify multiple types of pathogen that potentially present in a clinical sample. To addressing this problem, molecular beacons labeled with different fluorophores that specific to certain target sequences are introduced to simultaneously detect and identify multiple targets in a single reaction [27]. Chakravorty et al. performed rapid universal identification of bacterial pathogens from a list of 111 species in 64 different genera using a molecular beacon melting temperature signature technique [28]. Additionally, El-Hajj et al. described a molecular beacon based system that successively distinguished 27 different Mycobacterium species [29]. These assays identify multiple targets by fluorescence signals in combination with the melting temperatures of the hybridized probe-target dimmer. Based on the above technique, we developed a new HPV detection and genotyping system—the LPM assay, and its performance was validated on clinical samples by comparing with the GenoArray test. In HPV typing, excellent agreement (kappa = 0.954; 95% CI, 97.44%–98.97%) between the two assays was observed, which was in line with data previously reported comparison between another assay based on LATE-PCR and lateral flow and the GenoArray test [30]. The sensitivity, specificity and accuracy of the LPM assay were 98.94%, 96.43% and 98.37%, respectively. Suggests HPV genotypes can be successfully identified by the LPM assay with high accuracy. For individual HPV genotype, the GenoArray and LPM assays were in near-perfect agreement, the majority of targeted HPV types are with kappa values >0.75 except for HPV45, where the two assays had moderate agreement (kappa values, 0.40–0.75) and the LPM assay showed better sensitivity to HPV 45 than GenoArray. Of the 1104 LBC samples tested with the LPM assay, only 33 of them had disagreement with GenoArray or type-specific sequencing. These results indicate that the LPM method can successfully detect HPV infections and identify HPV genotypes with high accuracy. Additional practical advantages with the LPM assay are that it costs less (less than 1.5 US dollars per sample) and is faster (<2 h) than the GenoArray assay; On the other hand, because in our assay the LATE-PCR and fluorescence measurement is conducted in sealed tubes, carryover contamination is less likely to happen. In conclusion, in our study, the LPM assay showed similar clinical performance for genotyping as the HPV GenoArray test and seemed to be a promising alternative approach for HPV testing. It is sensitive, economical and high throughput that could be used for rapid and specific detection of 23 high- and low-risk HPV genotypes.
  28 in total

1.  IARC monographs on the evaluation of carcinogenic risks to humans. Volume 97. 1,3-butadiene, ethylene oxide and vinyl halides (vinyl fluoride, vinyl chloride and vinyl bromide).

Authors: 
Journal:  IARC Monogr Eval Carcinog Risks Hum       Date:  2008

2.  Use of sloppy molecular beacon probes for identification of mycobacterial species.

Authors:  Hiyam H El-Hajj; Salvatore A E Marras; Sanjay Tyagi; Elena Shashkina; Mini Kamboj; Timothy E Kiehn; Michael S Glickman; Fred Russell Kramer; David Alland
Journal:  J Clin Microbiol       Date:  2009-01-26       Impact factor: 5.948

3.  Human papillomavirus is a necessary cause of invasive cervical cancer worldwide.

Authors:  J M Walboomers; M V Jacobs; M M Manos; F X Bosch; J A Kummer; K V Shah; P J Snijders; J Peto; C J Meijer; N Muñoz
Journal:  J Pathol       Date:  1999-09       Impact factor: 7.996

4.  Molecular Detection and Differentiation of Mycobacterium Tuberculosis Complex and Non-tuberculous Mycobacterium in the Clinical Specimens by Real Time PCR.

Authors:  M M Rahman; M R Rahim; A Khaled; T A Nasir; F Nasrin; M A Hasan
Journal:  Mymensingh Med J       Date:  2017-07

5.  A multiplex real-time RT-PCR for simultaneous detection of four most common avian respiratory viruses.

Authors:  Nacira Laamiri; Rim Aouini; Boutheina Marnissi; Abdeljelil Ghram; Issam Hmila
Journal:  Virology       Date:  2017-12-08       Impact factor: 3.616

Review 6.  Chapter 7: Achievements and limitations of cervical cytology screening.

Authors:  Henry C Kitchener; Philip E Castle; J Thomas Cox
Journal:  Vaccine       Date:  2006-08-31       Impact factor: 3.641

7.  Cervical human papillomavirus prevalence in 5 continents: meta-analysis of 1 million women with normal cytological findings.

Authors:  Laia Bruni; Mireia Diaz; Xavier Castellsagué; Elena Ferrer; F Xavier Bosch; Silvia de Sanjosé
Journal:  J Infect Dis       Date:  2010-11-10       Impact factor: 5.226

8.  Type specific persistence of high risk human papillomavirus (HPV) as indicator of high grade cervical squamous intraepithelial lesions in young women: population based prospective follow up study.

Authors:  Susanne K Kjaer; Adriaan J C van den Brule; Gerson Paull; Edith I Svare; Mark E Sherman; Birthe L Thomsen; Mette Suntum; Johannes E Bock; Paul A Poll; Chris J L M Meijer
Journal:  BMJ       Date:  2002-09-14

9.  Fall in human papillomavirus prevalence following a national vaccination program.

Authors:  Sepehr N Tabrizi; Julia M L Brotherton; John M Kaldor; S Rachel Skinner; Eleanor Cummins; Bette Liu; Deborah Bateson; Kathleen McNamee; Maria Garefalakis; Suzanne M Garland
Journal:  J Infect Dis       Date:  2012-10-19       Impact factor: 5.226

10.  Biomarkers of cervical dysplasia and carcinoma.

Authors:  Sonya J Hwang; Kenneth R Shroyer
Journal:  J Oncol       Date:  2011-10-29       Impact factor: 4.375

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.