Literature DB >> 30475797

Mutations in Kinesin family member 6 reveal specific role in ependymal cell ciliogenesis and human neurological development.

Mia J Konjikusic1,2, Patra Yeetong3,4,5, Curtis W Boswell6, Chanjae Lee2, Elle C Roberson2, Rungnapa Ittiwut3,4, Kanya Suphapeetiporn3,4, Brian Ciruna6, Christina A Gurnett7, John B Wallingford2, Vorasuk Shotelersuk3,4, Ryan S Gray1.   

Abstract

Cerebrospinal fluid flow is crucial for neurodevelopment and homeostasis of the ventricular system of the brain, with localized flow being established by the polarized beating of the ependymal cell (EC) cilia. Here, we report a homozygous one base-pair deletion, c.1193delT (p.Leu398Glnfs*2), in the Kinesin Family Member 6 (KIF6) gene in a child displaying neurodevelopmental defects and intellectual disability. To test the pathogenicity of this novel human KIF6 mutation we engineered an analogous C-terminal truncating mutation in mouse. These mutant mice display severe, postnatal-onset hydrocephalus. We generated a Kif6-LacZ transgenic mouse strain and report expression specifically and uniquely within the ependymal cells (ECs) of the brain, without labeling other multiciliated mouse tissues. Analysis of Kif6 mutant mice with scanning electron microscopy (SEM) and immunofluorescence (IF) revealed specific defects in the formation of EC cilia, without obvious effect of cilia of other multiciliated tissues. Dilation of the ventricular system and defects in the formation of EC cilia were also observed in adult kif6 mutant zebrafish. Finally, we report Kif6-GFP localization at the axoneme and basal bodies of multi-ciliated cells (MCCs) of the mucociliary Xenopus epidermis. Overall, this work describes the first clinically-defined KIF6 homozygous null mutation in human and defines KIF6 as a conserved mediator of neurological development with a specific role for EC ciliogenesis in vertebrates.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30475797      PMCID: PMC6307780          DOI: 10.1371/journal.pgen.1007817

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

The delicate balance of cerebrospinal fluid (CSF) production and flow is important for the morphogenesis and function of the brain during development and homeostasis. CSF circulation in human is largely due to gradients established by the secretion of CSF from the choroid plexuses, and its resorption at the arachnoid granulations [1]. The clinical significance of CSF stasis includes hydrocephalus and intracranial hypertension. Moreover, severely diminished CSF flow combined with increased intracranial pressure can secondarily cause ventriculomegaly, cognitive impairment, as well as degenerative and age-related dementias [2]. For these reasons, the identification of genetic risk factors involved in the pathogenesis of CSF stasis is critical for the development of genetic diagnostics and early interventions for these disorders. One element for circulation of CSF is the multiciliated ependymal cells (ECs), which are specialized glial cells covering the ventricular walls of the brain and spinal canal [3]. In contrast, to primary cilia which are single, immotile cellular organelles extending from most cell types, ECs contain dozens of apically-arranged motile cilia, which beat in a polarized fashion to generate localized or near-wall CSF flows [4]. Defective differentiation or alterations in their stereotyped synchronous, polarized beating leads to alterations of localized CSF flow contributing to increased intracranial pressure, dilation of ventricles, and hydrocephalus in mice [5-8]. Importantly, this EC cilia-driven CSF flow is vital for regulating brain function and neurogenesis during adult development [4, 9]. Impaired motility of cilia due to disruptions of the key kinesins, dyenins, or intraflagellar components, are associated with a syndromic condition known as primary ciliary dyskinesia (PCD) in humans [10, 11]. While hydrocephalus can occur in some PCD patients, it is a less common manifestation of the disease in humans [11]. In contrast, genes implicated in PCD or mutations which disrupt the structure or motility of all motile cilia are strongly correlated with hydrocephalus in mouse [8]. Alternatively, some hydrocephalus in mice with dysfunctional cilia may be the result of altered function of the choroid plexus, prior to the onset of cilia-driven CSF flow [7]. KIF6 (Kinesin family member 6, OMIM: 613919) encodes a member of the kinesin-9 superfamily of microtubules motor proteins which act predominately as "plus-end" directed molecular motors that generate force and movement across microtubules [12]. Kinesins are critical for numerous cellular functions such as intracellular transport and cell division, as well as for building and maintaining the cilium in a process known as intraflagellar transport [13]. During this process, kinesins have been shown to transport cargo within the ciliary axoneme [14], establish motility and compartmentalization of the axoneme [15], or to facilitate plus-end directed microtubule disassembly and control of axonemal length [16]. As such, multiple kinesins have shown to be associated with monogenic disorders affecting a wide-spectrum of tissues, with several modes of inheritance (www.omim.org). Interestingly, KIF6 has previously been proposed as locus for susceptibility to coronary heart disease [17], while other studies did not substantiate this association [18]. We previously reported that kif6 mutant zebrafish are adult viable exhibiting larval-onset scoliosis without obvious heart defects [19]. Because of these conflicting results, and a lack of relevant mouse models, the role of KIF6 in human disease remains an open question. Here, we present a patient with consanguineous parents, presenting with abnormal neurological morphologies and intellectual disability. Homozygosity mapping followed by whole-exome sequencing (WES) identified a novel homozygous frameshift mutation in KIF6 which is predicted to result in the truncation of the C-terminal cargo-binding domain of the kinesin motor protein. We generated an analogous frameshift mutation in mouse and found that these mutant mice displayed progressive, postnatal-onset hydrocephalus with cranial expansion, coupled with an obvious defect in EC cilia formation. In addition, we observed that kif6 mutant zebrafish also display dilation of the ventricular system, coupled with reduced EC cilia. We failed to observe cilia defects in other multiciliated tissues in Kif6 mutant mouse or zebrafish models. Together these results demonstrate that KIF6 has a specific function for the formation of EC cilia. Finally, we propose that KIF6 represents a novel locus for understanding mechanisms of neurological development and intellectual disability in humans.

Results

Clinical features and mutation identification

We identified a Thai boy with intellectual disability and megalencephaly. His parents were first cousins. He was born at 34 weeks gestation with a head circumference of 34 cm (97th centile). APGAR scores were 7 and 9 at 1 and 5 minutes, respectively. Neonatal hypoglycemia (blood sugar of 11 mg/dL) and neonatal jaundice were treated promptly. In the first few months of life, he was found to have delayed neurodevelopment and central hypotonia. He was able to hold his head at 5 months, rolled over at 8 months, walked and had first words at 2 years old. At the age of 9 years and 9 months, an IQ test by Wechsler Intelligence Scale for Children: 4th edition (WISC-IV) revealed that his full-scale IQ was 56, indicating intellectual disability. The patient had possible seizure activity at age 10 described as parasomnias, was found to have intermittent bifrontocentreal rhythmic theta activity, and the spells resolved after valproic acid therapy. His height and weight followed the curve of 50th centile, but his head circumference remained at 97th centile (53.5 cm and 55 cm at 6 and 9 years old, respectively). Physical examination was generally unremarkable except macrocephaly and low-set prominent anti-helical pinnae (Fig 1A). Eye examination, hearing tests, thyroid function tests, chromosomal analysis, and nerve conduction velocity were normal. Both brain CT scans at 4 months and 8 years old and brain MRI at 7 months old showed a slight dolichocephalic cranial shape (cephalic index = 75), without overt structural brain abnormalities (Fig 1B–1D). X-ray analysis of the spine showed no obvious scoliosis at 10-years-old (Fig 1E).
Fig 1

KIF6 mutation in a child with intellectual disability.

(A) A low-set prominent anti-helical left pinna. (B) MRI of the brain at 7 months-old shows dolichocephaly with a normal brain structure. (C) and (D) CT of the brain at 8 years-old, sagittal and axial views, respectively show dolichocephalic shape of the cranium (cephalic index = 75) without demonstrable intracranial abnormality. (E) X-ray of the spine shows no scoliosis (F) Electropherograms of the patient, a control, the patient’s father, mother, and unaffected brother from top to bottom. The patient is homozygous for the c.1193delT mutantion while his father, mother, and unaffected brother are all heterozygous carriers. (G) Pedigree and RFLP, using MfeI restriction enzyme: Lane M = 100 bp marker. The arrow head indicates the 500 bp band. Lanes 1–5 are controls. Lanes 6 and 7 are the proband’s father and mother, respectively, showing that they are heterozygous. Lane 8 is the proband showing that he is homozygous for the c.1193delT. (H) Representative KIF6 structure. The arrow shows the position of the c.1193delT mutation.

KIF6 mutation in a child with intellectual disability.

(A) A low-set prominent anti-helical left pinna. (B) MRI of the brain at 7 months-old shows dolichocephaly with a normal brain structure. (C) and (D) CT of the brain at 8 years-old, sagittal and axial views, respectively show dolichocephalic shape of the cranium (cephalic index = 75) without demonstrable intracranial abnormality. (E) X-ray of the spine shows no scoliosis (F) Electropherograms of the patient, a control, the patient’s father, mother, and unaffected brother from top to bottom. The patient is homozygous for the c.1193delT mutantion while his father, mother, and unaffected brother are all heterozygous carriers. (G) Pedigree and RFLP, using MfeI restriction enzyme: Lane M = 100 bp marker. The arrow head indicates the 500 bp band. Lanes 1–5 are controls. Lanes 6 and 7 are the proband’s father and mother, respectively, showing that they are heterozygous. Lane 8 is the proband showing that he is homozygous for the c.1193delT. (H) Representative KIF6 structure. The arrow shows the position of the c.1193delT mutation. To elucidate the genetic etiology, we performed homozygosity mapping, whole genome array comparative genomic hybridization (CGH), and whole exome sequencing (WES). We identified 83 homozygous variants, which had not been reported as SNPs in dbSNP137 (S1 Table). We then selected only those located within the 63 homozygous regions found by homozygosity mapping (S2 Table). Seven candidate variants (one frameshift and six missense mutations; Table 1) were identified. Of the six missense, five were predicted to be either benign by Polyphen-2 or tolerated by SIFT prediction programs. The remaining variant, c.235G>A; p.V79M of the Carboxypeptidase E (CPE) gene, was not evolutionarily conserved among diverged species (S1 Fig). We, therefore, decided to further our study on the only candidate truncating mutation, a homozygous one base-pair deletion, c.1193delT (p.Leu398Glnfs*2) in exon 11 of Kinesin family member 6 (KIF6) (NM_001289021.2).
Table 1

Seven candidate variants from WES and homozygosity mapping.

#Chromosome (position)GeneZygosityNucleotide changeAmino acid changePolyphen-2 (score)SIFT
16 (39513453)KIF6Homozygousc.1193delTp.L398QfsX399
24 (166300608)CPEHomozygousc.235G>Ap.V79MPossibly damaging (0.889)Deleterious
36 (41895234)BYSLHomozygousc.391C>Tp.R131CProbably damaging (0.975)Tolerated
47 (44120345)POLMHomozygousc.359G>Ap.R120QProbably damaging (0.999)Tolerated
57 (64167644)ZNF107Homozygousc.962T>Gp.I321SProbably damaging (0.969)Tolerated
62 (96148317)TRIM43BHomozygousc.146C>Tp.P49LBenign (0.071)Tolerated
75 (140307142)PCDHAC1Homozygousc.665T>Cp.I222TBenign (0.001)Tolerated
KIF6 is located on human chromosome 6p21.2 and comprises 23 exons. The 2.4-kb KIF6 cDNA encodes a canonical N-terminal kinesin motor domain (amino acid positions 3–353) and three coiled-coil regions (amino acid positions 358–385, 457–493, and 633–683), predicted by SMART server [20]. Segregation of the homozygous sequence variant with the disease phenotype was confirmed by Sanger sequencing (Fig 1F) and by restriction fragment length polymorphism (RFLP) analysis of the pedigree (Fig 1G), while his parents and his unaffected brother were heterozygous for the deletion (Fig 1F and 1G). The deletion was not observed in our 1,600 in-house Thai exomes, the 1000 Genome Database, and the ExAC Database. The pedigree combined with the novelty of the mutation in KIF6 presented here, strongly suggest this C-terminal truncating mutation in KIF6 may be etiologic for neurological developmental defects.

Generation of Kif6 mutation in mouse

To test the functional consequence of the C-terminal truncating p.L398fsX2 mutation (Fig 1H), we generated an analogous frameshift mutation in exon14 of the mouse Kif6 (ENSMUST00000162854) gene, which is ~150bp downstream of the frameshift mutation found in the patient (Fig 2A). After backcross of founder mice to the C57B6/J strain, we identified a nonsense allele with scarless insertion (c.1665ins) of a 3-stop donor cassette -providing integration of an ochre termination codon in all three reading frames into the endogenous Kif6 locus (S2 Fig). This endonuclease-mediated insertional frameshift mutation (Kif6) is predicted to truncate the C-terminal cargo-binding domain of the kinesin motor protein (p.G555+6fs). This novel mutant allele of Kif6 (hereafter called Kif6) is predicted to encode a C-terminal truncated KIF6 protein 168 amino acids longer than is predicted for the human p.L398fsX2 variant (Fig 2A). Real time qualitative-PCR analysis of several Kif6 exon-exon boundaries found no evidence for non-sense mediated decay in Kif6 mutant mice (Fig 2B).
Fig 2

Kif6 mutant mice display progressive hydrocephaly.

(A) Schematic of the non-sense mutation in the patient (KIF6p.L398fsX2) and the mouse mutation (Kif6), both predicted to truncate the C-terminal domain of KIF6 protein. (B) qRT-PCR analyses of fold change of Kif6 expression using cDNA libraries derived from lateral ventricles from WT (black bars) and Kif6 (gray bars) mutant mice. (C) Lateral X-rays of mouse cranium at P14 and P28 showing the progressive cranial expansion in Kif6 homozygous mutant mice. (D) Ventral view of whole mouse P28 brain to highlight hemorrhaging and slight enlargement of total brain size in Kif6 homozygous mutant mice. (E, F) H&E stained coronal sections of the mouse brain (P14), showing dilation of the lateral (LV) and third (3V) ventricles in Kif6 homozygous mutant mice (F). (G) Quantitation of ventricular area over total brain area in Kif6 homozygous mutant mice and heterozygous littermate controls (n = 7 mice per genotype; two-tailed t-test; p = 0.0173). Scale bars: 1cm in (C); 5mm in (D); and 300 μm in (F, F).

Kif6 mutant mice display progressive hydrocephaly.

(A) Schematic of the non-sense mutation in the patient (KIF6p.L398fsX2) and the mouse mutation (Kif6), both predicted to truncate the C-terminal domain of KIF6 protein. (B) qRT-PCR analyses of fold change of Kif6 expression using cDNA libraries derived from lateral ventricles from WT (black bars) and Kif6 (gray bars) mutant mice. (C) Lateral X-rays of mouse cranium at P14 and P28 showing the progressive cranial expansion in Kif6 homozygous mutant mice. (D) Ventral view of whole mouse P28 brain to highlight hemorrhaging and slight enlargement of total brain size in Kif6 homozygous mutant mice. (E, F) H&E stained coronal sections of the mouse brain (P14), showing dilation of the lateral (LV) and third (3V) ventricles in Kif6 homozygous mutant mice (F). (G) Quantitation of ventricular area over total brain area in Kif6 homozygous mutant mice and heterozygous littermate controls (n = 7 mice per genotype; two-tailed t-test; p = 0.0173). Scale bars: 1cm in (C); 5mm in (D); and 300 μm in (F, F).

Hydrocephalus in Kif6 mouse

Intercrossing Kif6 heterozygous animals gave offspring with the expected Mendelian ratios, with typical appearance at birth. However, beginning at postnatal day (P)14-onwards, 100% (n = 7) of Kif6 homozygous mutant mice displayed classic indications of hydrocephalus including doming of the cranium (Fig 2C), a hunched appearance, and with decreased open field activity. We observed apparent megalencephaly and hemorrhaging in older (P21-P28) Kif6 mutant brains (Fig 2D), which likely results from increased intracranial pressure and swelling of the ventricles causing damage to the neural tissue against the cranium. At P14, the body weights were not significantly decreased in Kif6 mutants (5.8±1.3 (g)rams) compared with littermate controls (7.0±1.2g) (n = 5/genotype; p = 0.17). However, at P28 mutant mice showed decreased weight on average (12.67±1.53 g) compared to littermate controls (15.33±1.15g), although this trend was not statistically significant (n = 3/genotype; p = 0.07). At P28, extracted whole brain sizes appear to be larger in Kif6 mutants compared to non-mutant littermate controls (Fig 2D). Due to increased morbidity in these mutant animals no experimental observations were made past P28. To determine whether a more N-terminal truncated Kif6 mutation would result in a more severe hydrocephalus phenotype, we isolated a conditional-ready Kif6 allele, where exon 4 is flanked by LoxP sites (Kif6) (KOMP repository, see Methods and Materials). Recombination of the Kif6 allele is predicted to generate a frameshift mutation, which should generate a severely truncated, 89 amino acid, KIF6 protein (p.G83E+6fs) with a non-functional N-terminal motor domain. We generated a whole body conditional knockout by crossing the Kif6 mouse to the CMV-Cre deleter mouse [21]. We observed postnatal-onset, hydrocephalus in CMV-Cre; Kif6 conditional mutant mice (n = 12) analogous to our observations in Kif6 mutant mice (S3 Fig). Interestingly, we find no evidence of non-sense mediated decay in these mutant mice despite the generation of an early premature termination codon (Fig 2B). Because the onset and progression of hydrocephalus was equivalent comparing the whole-body conditional CMV-Cre;Kif6 and Kif6 mutant mice strains we suggest that any KIF6 protein encoded by these mutant mouse strains is likely non-functional. Given its relevance to the human mutation, the majority of experiments were all done using the p.G555fs allele. Mouse brains were analyzed histologically by hematoxylin and eosin (H&E) stained coronal sections. Our analysis of coronal sectioned brain at P14 failed to find significance when comparing the total area in section (499.2+39.9μm (Control) vs. 552.5+50.8μm (Kif6); n = 7/genotype; p = 0.42). However, lateral and third ventricles (LV and 3V respectively) were obviously enlarged in both Kif6 and CMV-Cre;Kif6 mutant mice (Fig 2F and S3 Fig). Quantitation of LV area normalized to total brain area confirmed ventricular expansion in Kif6 (n = 7/genotype; p≤0.05; Fig 2G) and in CMV-Cre;Kif6 mutant animals (n = 5/genotype; p≤0.05; S3 Fig). No obvious defects of the cortex or dysmorphology of other regions of the brain were apparent in these mice (Fig 2E and 2F and S3 Fig). Together these data suggest that Kif6 mutant mice display postnatal-onset, progressive hydrocephalus, without obvious overgrowth of neural cortex.

Kif6 is expressed specifically in the ECs of the mouse brain

To determine the endogenous expression patterns of Kif6 in the mouse, we also isolated a Kif6-LacZ reporter mouse (Kif6-LacZ) (KOMP repository, see Methods and Materials). Hemizygous Kif6-LacZ mice appeared unremarkable and exhibited no evidence of hydrocephalus. Intercrosses of Kif6-LacZ hemizygous mice failed to generate litters with Kif6-LacZ homozygous mice, suggesting that the homozygosity of the lacZ expressing allele is embryonic lethal (0/13 Kif6-LacZ homozygous mutant mice from 3 independent litters). At P10 and P21, Kif6-LacZ transgenic mice showed lacZ expression in the ECs of the ventricular system (red arrows; Fig 3A”) and the central canal (S4 Fig). However, no lacZ expression was detected in the choroid plexus or in other regions of the brain (Fig 3A and 3A’ and S4 Fig), with the exception of a small population of cells, possibly the hypothalamic nuclei, flanking the third ventricle (arrows, S4 Fig). Interestingly at P10, other multi-ciliated tissues such as the oviduct or trachea were not labeled in these transgenic mice, despite the clear presence of cilia observed by oblique lighting (red arrows Fig 3B’ and 3C’) as well as by IF using acetylated-tubulin to label axonemes in adjacent sections of these tissues (Fig 3B” and 3C”). No obvious changes to oviduct or trachea cilia were observed in Kif6 mutant mice at P21 (S5 Fig), suggesting that Kif6 expression and function are tightly restricted to the multiciliated ECs in mouse. Taken together these data suggested a cellular mechanism centered on defective ECs underlying the development of hydrocephalus in Kif6 mutant mice.
Fig 3

Kif6-LacZ expression is specific to the ependymal cells.

(A-C', B”-C”) Representative LacZ staining in a variety of multiciliated tissues from P10 and P21 (A”) Kif6-LacZ transgenic mice. (A, A') Coronal section at the 4th ventricle showing specific LacZ expression in the ependymal cell (EC) layer and stark lack of expression in the choroid plexus (CP) or surrounding neuronal tissues. (B-C’) Sectioned oviduct and trachea tissue shows no LacZ expression, despite the presence of tufts of cilia observed under oblique lighting (red arrows B’, C’). Immunofluorescence shows acetylated tubulin labeling of ciliary axonemes in adjacent sections in oviduct which has supercoiled at this time point (B”) and in trachea (C”) at P10. LacZ staining labels the EC cells projecting tufts of cilia observed by oblique lighting (A”). Scale bars: 300μm in (A-C); 20μm in (A'-C'); and 10μm in (A”-C”).

Kif6-LacZ expression is specific to the ependymal cells.

(A-C', B”-C”) Representative LacZ staining in a variety of multiciliated tissues from P10 and P21 (A”) Kif6-LacZ transgenic mice. (A, A') Coronal section at the 4th ventricle showing specific LacZ expression in the ependymal cell (EC) layer and stark lack of expression in the choroid plexus (CP) or surrounding neuronal tissues. (B-C’) Sectioned oviduct and trachea tissue shows no LacZ expression, despite the presence of tufts of cilia observed under oblique lighting (red arrows B’, C’). Immunofluorescence shows acetylated tubulin labeling of ciliary axonemes in adjacent sections in oviduct which has supercoiled at this time point (B”) and in trachea (C”) at P10. LacZ staining labels the EC cells projecting tufts of cilia observed by oblique lighting (A”). Scale bars: 300μm in (A-C); 20μm in (A'-C'); and 10μm in (A”-C”).

Loss of Cilia in Kif6 mutant mice

Defects of EC cilia are known to cause hydrocephalus in mouse [8]. To assay this we first utilized scanning electron microscopy (SEM) to directly visualize the LV en face. Heterozygous Kif6 mice displayed a high-density of regularly spaced EC multiciliated tufts along the LV surface (Fig 4A and 4A’), typical at P21 in mouse development [22]. In contrast, homozygous Kif6 mutant mice displayed a marked reduction of multiciliated tufts across the LV wall (p = 0.029; Avg. # ECs /sectionhet = 225; Avg. # ECs /sectionmutant = 129.3), coupled with a reduction in the density of ciliary axonemes within these ciliary tufts (Fig 3B and 3B’). This phenotype was even more obvious at P28 in Kif6 mutant mice (p = 0.001; Avg. # ECs /sectionhet = 146; Avg. # ECs /sectionmutant = 0) (S6 Fig). Together, these data suggested that hydrocephalus may result from either a reduction in EC differentiation and/or defects in EC cilia during postnatal development.
Fig 4

Kif6 mutant mice have defects in formation of ependymal cell cilia.

(A-B') Scanning electron microscopy of the lateral ventricular wall (en face view) in Kif6 homozygous mutant mice and heterozygous littermate controls at P21, demonstrating a reduction in the number and density of EC cilia tufts in mutant ventricles (B, B’). (C-D‴) Immunofluorescence of the wild-type (C-C”‘) and Kif6 homozygous mutant (D-D”‘) mice at P21. (C-D) Three color merge of (C', D') αS100B (ependymal cell marker; magenta) channel; (C'', D'') α–γ-tubulin (basal bodies; cyan) channel; and (C‴, D‴) αCD133 (EC axoneme marker, Prominin-1; green). (C', D') αS100B staining showing no alterations of ependymal cell specification between Kif6 homozygous mutant and WT mice. (C'', D'') α–γ-tubulin staining showing typical basal body positioning at the apical surface of ECs in both Kif6 homozygous mutant and WT mice. (C‴, D‴) αCD133 staining reveals a marked of EC cilia projecting into the ventricular lumen in Kif6 homozygous mutant mice compared to WT mice. (E) Quantitation of fluorescent intensity of the CD133 channel (EC axonemes). Scale bars: 20μM in (A, B); 2 μM in (A', B'); and 20 μM in (C-D‴).

Kif6 mutant mice have defects in formation of ependymal cell cilia.

(A-B') Scanning electron microscopy of the lateral ventricular wall (en face view) in Kif6 homozygous mutant mice and heterozygous littermate controls at P21, demonstrating a reduction in the number and density of EC cilia tufts in mutant ventricles (B, B’). (C-D‴) Immunofluorescence of the wild-type (C-C”‘) and Kif6 homozygous mutant (D-D”‘) mice at P21. (C-D) Three color merge of (C', D') αS100B (ependymal cell marker; magenta) channel; (C'', D'') α–γ-tubulin (basal bodies; cyan) channel; and (C‴, D‴) αCD133 (EC axoneme marker, Prominin-1; green). (C', D') αS100B staining showing no alterations of ependymal cell specification between Kif6 homozygous mutant and WT mice. (C'', D'') α–γ-tubulin staining showing typical basal body positioning at the apical surface of ECs in both Kif6 homozygous mutant and WT mice. (C‴, D‴) αCD133 staining reveals a marked of EC cilia projecting into the ventricular lumen in Kif6 homozygous mutant mice compared to WT mice. (E) Quantitation of fluorescent intensity of the CD133 channel (EC axonemes). Scale bars: 20μM in (A, B); 2 μM in (A', B'); and 20 μM in (C-D‴). To address the differentiation status of the ECs, we utilized IF in coronal sectioned brain tissues to image known proteins components of the EC and their cilia. At P21, we observed the expression of the ependymal cell-marker S100B [22] throughout the epithelium lining luminal surface of the ventricles, as well as, the presence of apically localized γ-tubulin-positive basal bodies within these ECs in both WT (Fig 4C and 4C'') and Kif6 mutant mice (Fig 4D and 4D''). Conversely, we observed a obvious reduction in the density of CD133-positive EC axonemes [23] extending into the ventricular lumen in Kif6 mutant mice (Fig 4C and 4C‴), compared with WT (Fig 4D and 4D‴). Quantitation of binned mean fluorescence intensity from of CD133-positive axonemes confirmed a severe reduction of EC axonemes in Kif6 mutant mice (n = 9 mice/genotype, p≤0.001) (Fig 4E). In order to address whether Kif6 is required for EC cilia formation or ciliogenesis, we performed IF at P14, the time point at which the ECs are fully ciliated across the ventricular system in mouse [22]. We observe significant alterations in the extension of EC ciliary axonemes (CD133-positive) (n = 5 mice/genotype, p≤0.01), without an alterations in the specification of ECs or their apical polarity (S7 Fig). The reduction of EC cilia was also observed at both P14 and P21 in Kif6 mutant mice using an acetylated tubulin antibody, which labels both primary and motile cilia as well as neuronal cell types in the cortex (S8 Fig). Taken together, these results suggest that the onset of hydrocephalus in Kif6 mutant mice is primarily due to a general defect of cilia formation (ciliogenesis) and not the result of defects in differentiation of the ECs or a loss of EC cilia as the result of the onset of hydrocephalus. Alterations of the motility or synchronicity of EC cilia beating are known to cause hydrocephaly in mouse [8]. In order to address if Kif6 is required for normal EC cilia beating we performed live ex vivo imaging of lateral wall explants taken from both Kif6 mutant and littermate control mice. We consistently observed multiple tufts of EC cilia in WT animals that beating in a synchronous fashion at P21, with obvious flow generation, demonstrated by the movement of fortuitous particles within the media (S1 Movie). As expected, we observed an obvious reduction in formation of EC cilia coupled with reduced particle flow in explants from Kif6 mutant mice (S2 Movie). Interestingly, on the rare occasions where we did observed EC cilia in these mutant mice, the motility of these EC cilia appeared typical. These results in conjunction with our IF and SEM analysis (Fig 4, S6–S8 Figs) suggest that the onset of progressive hydrocephaly in Kif6 mutant mice is the result of defective ciliogenesis of ECs leading to a reduction in near-wall CSF flow.

Ventricular dilation and Reduced EC cilia in kif6 mutant zebrafish

Defects in EC cilia in the central canal leads to impaired CSF flow and hydrocephalus in zebrafish embryos [24]. Our previous studies in kif6 mutant zebrafish observed late-onset scoliosis in larval zebrafish, without defects of CSF flow, EC cilia in the central canal, or hydrocephalus during early embryonic development [19]. However, in contrast to the defined period of EC development in the mouse, zebrafish demonstrate continuous differentiation of ECs within the ventricular system throughout adult development [25]. Interestingly, recent studies in a variety mutant zebrafish demonstrate that reduced CSF flow, ventricular dilation, and loss of EC cilia may underlie the onset late-onset scoliosis in larval zebrafish [26]. In order to determine if kif6 mutant zebrafish might also display changes in the ventricular system in adults, we used iodine contrast-enhanced, micro computed tomography (μCT) [27] to generate high-resolution (5 μm voxel size) images of aged matched, 3-month-old WT and kif6 homozygous mutant zebrafish (Fig 5A and 5B’). After reconstruction and alignment of 3D tomographic datasets in the coronal plane, we utilized visualization software (Avizo Lite v.9.5) for 3D-reconstruction and segmentation of a virtual endocast to represent the ventricular volume in wild-type (WT) and kif6 mutant zebrafish (Fig 5A–5D’). Analysis of the ventricles in the endocast of the adult zebrafish brain highlighted several dysmorphophic regions in kif6 mutants including dilation of the diencephalic ventricle (DiV) (Fig 5D) and dilation of regions of the central canal (red arrows; Fig 5D and 5D’). At the same time, we observe that while some ventricles patent in wild-type zebrafish, were completely obstructed or less open in kif6 mutants (asterisks; Fig 5C’ and 5D’).
Fig 5

kif6 mutant zebrafish display dilation of the ventricular system.

(A-B’) 3D-reconstruction of representative iodine-contrasted μCT dataset from WT (A-A’) and kif6 mutant zebrafish at 90dpf. (C-D’) 3D-reconstruction and segmentation of virtual endocasting of ventricular system in WT (blue; C-C’) and kif6 mutant (red; D-D’) zebrafish from datasets in A-B’ demonstrated morphological alterations of the ventricular system including dilation of the central canal (red arrows; D-D’) and stenosis of small ventricles (asterisks, D-D’). (E) Schematic of adult zebrafish brain highlighting the relative transverse optical section of the zebrafish brain in WT (F, H, J) and kif6 homozygous mutant (G, I, K) zebrafish brain at 90dpf. (F, G) The medial region of the TeO showing the medial TecV (yellow dashed line) which is dilated in kif6 mutant fish (G) compared to age-matched WT (F). (H, I) Sectioning at the region of the medulla oblongata posterior to the lobus facialis showing dysmorphogenesis and deepening of the posterior RV (yellow dashed line) in kif6 mutants (I) compared with WT (H) zebrafish. (J, K) Spinal cord sectioning showing dilation of the central canal in kif6 mutant (K) compared to WT (J) zebrafish. (L) Quantitation of the areas (yellow dashed line) of the TecV and the RV posterior to the lobus facialis (pos. RV) in WT and kif6 mutant zebrafish, highlighting a consistent dilation in kif6 mutants (n = 11 sections/genotype; two-tailed t-test; ****, p<0.0001). Scale Bars: 1mm. DiV—diencephalic ventricle; TecV-tectal ventricle TeO-tectum opticum; CCe-corpus cerebelli; RV- rhombencephalic ventricle; Vam—medial division of valvula cerebelli; and Cc-central canal.

kif6 mutant zebrafish display dilation of the ventricular system.

(A-B’) 3D-reconstruction of representative iodine-contrasted μCT dataset from WT (A-A’) and kif6 mutant zebrafish at 90dpf. (C-D’) 3D-reconstruction and segmentation of virtual endocasting of ventricular system in WT (blue; C-C’) and kif6 mutant (red; D-D’) zebrafish from datasets in A-B’ demonstrated morphological alterations of the ventricular system including dilation of the central canal (red arrows; D-D’) and stenosis of small ventricles (asterisks, D-D’). (E) Schematic of adult zebrafish brain highlighting the relative transverse optical section of the zebrafish brain in WT (F, H, J) and kif6 homozygous mutant (G, I, K) zebrafish brain at 90dpf. (F, G) The medial region of the TeO showing the medial TecV (yellow dashed line) which is dilated in kif6 mutant fish (G) compared to age-matched WT (F). (H, I) Sectioning at the region of the medulla oblongata posterior to the lobus facialis showing dysmorphogenesis and deepening of the posterior RV (yellow dashed line) in kif6 mutants (I) compared with WT (H) zebrafish. (J, K) Spinal cord sectioning showing dilation of the central canal in kif6 mutant (K) compared to WT (J) zebrafish. (L) Quantitation of the areas (yellow dashed line) of the TecV and the RV posterior to the lobus facialis (pos. RV) in WT and kif6 mutant zebrafish, highlighting a consistent dilation in kif6 mutants (n = 11 sections/genotype; two-tailed t-test; ****, p<0.0001). Scale Bars: 1mm. DiV—diencephalic ventricle; TecV-tectal ventricle TeO-tectum opticum; CCe-corpus cerebelli; RV- rhombencephalic ventricle; Vam—medial division of valvula cerebelli; and Cc-central canal. To further describe and quantify alterations of the ventricular system we utilized individual transverse optical slices from these contrast-enhanced μCT datasets, using stereotyped landmarks of the zebrafish brain and spinal cord to compare equivalent axial sections. At distinct axial levels of the brain (Fig 5E), we observed consistent dilation of the ventricular system and central canal in kif6 homozygous mutant zebrafish (yellow arrows; Fig 5G, 5I and 5K), compared to the stereotyped anatomy described for the adult zebrafish brain (Fig 5F, 5H and 5J) [28]. Multiple regions of kif6 mutant zebrafish brain were found to be structurally abnormal in kif6 mutants compared to WT zebrafish (S3, S4 Movies). We next quantified the areas of two anatomically distinctive ventricles in our tomographic datasets: (i) the medial tectal ventricle (TecV) at the medial division of valvula cerebelli (Vam) (Fig 5F and 5G) and (ii) a region of the rhombencephalic ventricle (RV) just posterior to the lobus facialis (Fig 5H and 5I) [28]. We observed a significant increase in the area (dashed yellow line, Fig 5F–5I) of the medial TecV and the posterior RV in kif6 mutant zebrafish comparing several optical sections from independent aged-matched zebrafish (n = 3 fish/genotype; p<0.0001). The central canal was also clearly dilated in kif6 mutant zebrafish (yellow arrow, Fig 5K). However, we were unable to reliably quantify this area in WT samples at the current imaging resolution. Our previous observations in kif6 mutant zebrafish embryos failed to find phenotypes that are characteristic of cilia defects, such as hydrocephalus, situs inversus, or kidney cysts [19]. Moreover, we observed normal development and function of motile EC cilia within the central canal in embryonic mutant zebrafish [19]. These data, coupled with our new observations of ventricular dilation in adult kif6 mutants (Fig 5), suggest that Kif6 is required for the post-embryonic, robust development of the EC cilia within the ventricles of the brain as was reported in other zebrafish mutants displaying similar late-onset scoliosis, as observed in kif6 mutant zebrafish [19, 26]. In order to assay whether EC cilia were affected during adult development in zebrafish, we isolated a stable transgenic allele, Tg(Foxj1a:GFP) previously reported to label multiciliated Foxj1a-positive multi-ciliated cells (MCCs), including ECs, with cytoplasmic EGFP in zebrafish [26]. Using this transgenic approach, we observed no differences in the specification of Foxj1a:GFP-positive ECs comparing adult (90dpf) heterozygous kif6 phenotypically wild-type and homozygous kif6 mutant fish (Fig 6A and 6B). Cytoplasmic GFP can freely diffuse through the transition zone of cilia and label the axoneme [29]. As such, we were also able to observe GFP-filled EC axonemes projecting into the ventricular lumen in Tg(Foxj1a:GFP); kif6 heterozygous fish (red arrowheads; Fig 6A). In contrast, these GFP-filled EC axonemes were reduced or absent in Tg[Foxj1a:GFP] ; kif6 mutant fish (Fig 6B). To further support our model that EC cilia were affected in kif6 mutant zebrafish, we generated a novel-transgenic fish line Tg(Foxj1a:Arl13b-GFP) to allow for the direct fluorescent-labeling of ciliary axonemes with mouse Arl13b-GFP specifically in fox1a-expressing lineages. Analysis of kif6; Tg(Foxj1a:Arl13b-GFP) transgenic adult mutant zebrafish (90dpf) demonstrated an obvious reduction in Arl13b-GFP labeled axonemes (Fig 6D), in comparison to robust labeling of EC cilia in heterozygous kif6;Tg(Foxj1a:Arl13b-GFP) sibling fish (Fig 6C). Furthermore, SEM imaging of the telencephalic and rhombencephalic ventricles in kif6 mutant zebrafish demonstrated: (i) ventricular dilation (dashed red line, S9 Fig) and (ii) an obvious reduction in EC cilia in adult zebrafish (p = 0.014; Avg. # ECs /sectionhet = 37.5; Avg. # ECs /sectionmutant = 1) (red arrowheads, S9 Fig). Akin to our observations in Kif6 mutant mice trachea, we did not observe defects of other multiciliated tissues in kif6 zebrafish mutants, such as the nasal cilia (S5 Fig). Together, these data suggest that Kif6 functions specifically in the formation of EC cilia, in regulation of ventricular homeostasis during adult development in zebrafish.
Fig 6

kif6 mutant zebrafish display defects in the formation of the ependymal cell cilia in the brain.

(A-D) Immunofluorescence of Tg[foxj1a::GFP] (A, B) and Tg[foxj1a::Arl13bGFP] transgenic zebrafish in both heterozygous kif6 (A, C) and homozyogus kif6 mutant (B, D) zebrafish backgrounds assayed with αGFP (green) and DAPI (nuclei, blue). The Tg[foxj1a::GFP] transgene demonstrates that GFP positive ECs are present in both genotypes. In contrast, kif6 heterozygous zebrafish display numerous apical tufts of cilia (red arrows; A) projecting into the ventricle lumen, which are markedly reduced in kif6 mutant zebrafish (B). Similar results were observed with the Tg[foxj1a::Arl13bGFP] transgene, showing a obvious reduction in Arl13b-GFP positive EC axonemes in kif6 mutant zebrafish (D), which are robustly labeled in kif6 heterozygous fish (C). Scale Bars: 20μm.

kif6 mutant zebrafish display defects in the formation of the ependymal cell cilia in the brain.

(A-D) Immunofluorescence of Tg[foxj1a::GFP] (A, B) and Tg[foxj1a::Arl13bGFP] transgenic zebrafish in both heterozygous kif6 (A, C) and homozyogus kif6 mutant (B, D) zebrafish backgrounds assayed with αGFP (green) and DAPI (nuclei, blue). The Tg[foxj1a::GFP] transgene demonstrates that GFP positive ECs are present in both genotypes. In contrast, kif6 heterozygous zebrafish display numerous apical tufts of cilia (red arrows; A) projecting into the ventricle lumen, which are markedly reduced in kif6 mutant zebrafish (B). Similar results were observed with the Tg[foxj1a::Arl13bGFP] transgene, showing a obvious reduction in Arl13b-GFP positive EC axonemes in kif6 mutant zebrafish (D), which are robustly labeled in kif6 heterozygous fish (C). Scale Bars: 20μm. Fluorescently-tagged Kif6 (Kif6-GFP) localizes to the basal body of Kuper’s vesicle motile cilia in zebrafish [30]. Indeed our own attempts to visualize Kif6-EGFP by microinjection demonstrate that Kif6-EGFP localizes to microtubule-rich spindle poles and mitotic spindle during cell divisions in the rapidly dividing blastomeres of the early embryo (S10 Fig). Our attempts to drive Kif6-EGFP within the ECs using the foxj1a promoter in transgenic zebrafish have failed for this purpose, whereas clear signal was obtained for similar foxj1a-driven GFP and Arl13bGFP transgenic constructs (Fig 6). Unfortunately, IF and Westerns using several commercially-available KIF6 antibodies were unsuccessful to report on endogenous KIF6 in both mouse and zebrafish tissues (S11 Fig). For these reasons, we turned to the muco-ciliated Xenopus laevis epidermis in order to address Kif6 localization in an analogous MCCs lineage. The Xenopus mucociliary epithelium is analogous to the airway epithelium of the mammalian trachea [31]. Importantly, this system provides a robust model system for both genetic analysis [32] and robust visualization of fluorescently-tagged proteins in MCCs in vivo [33, 34]. By microinjection of synthetic Xenopus Kif6-GFP RNA, we observed Kif6-GFP localization at the basal bodies of MCCs (Fig 7D and 7F) and co-localized with a basal body marker; Centrin-BFP [35](Fig 7E and 7F). Similarly, we observed Kif6-GFP puncta within the axoneme (co-labeled with pan-membrane bound RFP) (Fig 7A–7C). Interestingly, similar punctate localization at the basal bodies and within the axoneme has been previously been shown in Xenopus MCCs using various fluorescently-tagged IFT proteins [36]. Together these data suggest a model in which Kif6 may act as a component of IFT trafficking uniquely and specifically in EC cilia, which is dispensable for the function of other MCCs in mouse and zebrafish.
Fig 7

Kif6-GFP localizes to the basal bodies and axonemes of Xenopus multi-ciliated cells.

Confocal imaging of the mucocilated Xenopus laevis epidermis demonstrating consistent Kif6-GFP localization within the axonemes (green; A, C) and at the basal bodies (green; D, F). Expression of pan-membrane-RFP marker (magenta; B, C) to co-label the axonemes and Centrin-BFP (blue; E, F) to co-label the basal bodies. Scale Bars: 10μm.

Kif6-GFP localizes to the basal bodies and axonemes of Xenopus multi-ciliated cells.

Confocal imaging of the mucocilated Xenopus laevis epidermis demonstrating consistent Kif6-GFP localization within the axonemes (green; A, C) and at the basal bodies (green; D, F). Expression of pan-membrane-RFP marker (magenta; B, C) to co-label the axonemes and Centrin-BFP (blue; E, F) to co-label the basal bodies. Scale Bars: 10μm.

Discussion

This study demonstrates the importance of KIF6 for EC cilia formation and homeostasis of the ventricular system in vertebrates, and potentially implicates a novel locus for understanding neurological defects in humans. This is supported by several lines of evidence including the discovery of a novel nonsense-mutation of KIF6 in a child with intellectual disability and megalencephaly and underscored by functional analysis in both mouse and zebrafish Kif6 mutant models (Table 2).
Table 2

KIF6 mutations discussed in this paper.

ID/AlleleSpeciesNucleotide changeAmino acid changePhenotype reportedReference
PatientHumanc.1193delTp.L398QfsX399Delayed neurodevelopment and central hypotonia, neurological defects, and intellectual disability.this work
Kif6p.G555fsMousec.1665insp.G555+6fsSevere progressive hydrocephalus, loss of ependymal cell ciliathis work
CMV-Cre;Kif6tm1cMouseWhole-body conditional deletion of exon 4p.E83+39fsSevere progressive hydrocephalus, loss of ependymal cell ciliathis work
Kif6Δ3/Δ3Mousec.177-251_delp.Lys59Asn, Phe60_Ser84_delNone reported[37]
kif6skoZebrafishc.205C>Ap.Tyr53XLarval onset scoliosis, hydrocephalus, loss of ependymal cilia[19], this work
We identified a homozygous KIF6 c.1193delT mutation in a child with macrocephaly and cognitive impairment that segregated with this phenotype in his family, and leads to a loss of the C-terminal second and third coiled-coil regions which are important for dimerization and cargo selectivity of kinesin motors [13]. We engineered an analogous, C-terminal truncating mutation of KIF6 in mouse, which displays severe hydrocephalus and defects of EC cilia providing strong evidence for pathogenicity of the mutation in the child. Other than the case described here, no prior mutation directly attributed to human disease has been described for KIF6. Taken together, the clinical data reported here suggest that biallelic mutations in KIF6 may underlie some unexplained intellectual disability and neurological developmental defects. Future analyses of KIF6 mutations in these patient groups are warranted. In addition, our analyses of several independent loss-of-function Kif6 mutant animal models found no evidence of obvious heart abnormalities to explain the prior association of the common variant KIF6 p.W719R in some[17], but not all [18], studies of coronary heart disease in humans. Because expressed sequence tag clones of KIF6 have not been reported from cDNAs libraries derived from human heart or vascular tissues (UniGene 1956991—Hs.588202), any possible functional effects of KIF6 on heart function remains unexplained. However, detailed analysis of coronary function was not explored in our models, therefore it is possible that subtle defects may be present. Previous reports of an ENU-derived Kif6 splice acceptor site mutant mouse strain, predicted to delete the 3rd exon of KIF6 (Kif6ΔΔ), also did not show cardiac or lipid abnormalities [37]. Of note this mutant mouse was also not reported to have hydrocephalus. Our analysis shows that the loss of exon 3 in Kif6ΔΔ mutant mouse generates an inframe deletion of only 25 amino acids in the N-terminal motor domain of the KIF6 protein, otherwise generating a mostly full-length KIF6 protein (Table 2). In contrast, here we report two novel Kif6 mutant mice: (i) a C-terminal Kif6 deletion mutant, predicted to truncate 248 amino acids of the C-terminal domain, which are important for cargo binding in Kinesin motor proteins [13]; and (ii) a conditional CMV-Cre;Kif6 mutant which recombines exon 4 leading to an early frame shift mutation predicted to generate a N-terminal truncated 122 amino acid KIF6 protein (Table 2), both of which display indistinguishable progressive, hydrocephalus with EC ciliogenesis defects. The most parsimonious explanation for the difference in phenotypes in these mutant mice is that the Kif6Δ allele encodes a functional KIF6 protein. Analysis of these mutations in trans or quantitative analysis of these kinesin motor proteins in vitro is warranted to more fully address these conflicting observations. There are noticeable differences in the phenotypes among the human, mouse, and zebrafish associated with mutations in KIF6. For example, kif6 mutant zebrafish display post-natal onset scoliosis, mirroring adolescent idiopathic scoliosis (IS) in humans [38]. The formation of IS-like defects in zebrafish has been shown to be the result of a loss of CSF flow, associated with a loss of EC cilia and ventricular dilation during a defined window of larval zebrafish development [26]. Interestingly, we did not observe scoliosis in the Kif6 mutant mice (S12 Fig), despite being of an appropriate age when IS-like scoliosis can manifest in mouse [39]. Moreover, we do not observe scoliosis in the patient at the age of 10 years, though it is possible that he may yet develop scoliosis during adolescence. The mechanisms behind these differences may reflect distinctions in the functional input of the ventricular system for spine stability amongst teleosts and amniotes. Furthermore, while we observe a clear role for KIF6 in maintaining the ventricular system in mouse and zebrafish, the patient does not have obvious hydrocephalus. However, his relative macrocephaly and slightly enlarged ventricles by MRI (Fig 1B–1D) may suggest an element of what is commonly referred to as arrested hydrocephalus [40]. Moreover, the contribution of EC cilia beating to bulk CSF flow might be species dependent. For instance, the majority of CSF flow in humans is thought to occur via the generation of a source-sink gradients; partly from the secretion of the choroid plexus and exchanges of the interstitial fluids, coupled with absorption at the arachnoid villi and lymphatics [41]. In contrast, localized or near-wall CSF flow [4], generated by polarized beating of EC cilia, are clearly important for the formation of hydrocephalus in rodents [8]; however, there have been limited evidence of EC cilia defects causing hydrocephalus in humans. Regardless there is growing evidence suggesting that EC cilia dependent CSF flow is crucial for the regulation of brain function and neurogenesis [4], and for adult neural stem cell proliferation [9]. It is possible that a specific loss of EC cilia in humans may only have minor effects on CSF bulk flow and ventricular homeostasis, while causing severe defects of neurogenesis leading to intellectual disability and other neurological disease. It will be important to determine (i) if the loss of KIF6 function during adult development in mouse will lead to a reduction in EC cilia; and (ii) whether the loss of EC cilia function contributes to ventricular dilation and decline of neurological function. Finally, KIF6 now joins five other kinesin genes, KIF1C, KIF2A, KIF4A, KIF5C and KIF7 that were previously reported to be associated with neurological abnormalities in humans [42-45]. Here we suggest that KIF6 has a uniquely specific function in the EC cilia in vertebrates, resulting in both cognitive impairment and macrocephaly in a child with a homozygous one-base pair deletion. Using a cell biological and transgenic approaches in both mouse and zebrafish, we identified specific loss of EC cilia these Kif6 mutant models suggesting a strong conservation of KIF6 function in ventricular system in vertebrates. Furthermore, we utilized imaging of fluorescently-tagged Kif6 in MCCs of the Xenopus epidermis, which are anatomically and functionally analogous to ECs lining the ventricles of the brain. Using this heterologous system we demonstrated that Kif6-GFP localizes to the basal bodies and as puncta within the ciliary axonemes in these MCCs, which is reminiscent of observations of canonical IFT proteins [36, 46]. This imaging data coupled with our findings of defective ciliogenesis in ECs in both Kif6 mutant mice and zebrafish suggest a model where KIF6 is acting in concert with one or more anterograde Kinesin-II motors to promote robust ciliogenesis specifically in ECs. Indeed, tissue specific accessory IFT motors have been described in amphid sensory neurons in C. elegans [47] and zebrafish photoreceptors [48, 49]. Interestingly, a homologue of KIF6, KIF9B, has been shown to be critical for flagellar motility and for the stabilization of the paraflagellar rod structure which tightly abutted the flagella in the protist, Trypanosoma brucei [15]. It remains to be determined whether KIF6 has an analogous, structural-functional role in ECs which may provide a unique functional role in these cilia, which is not critical for other analogous MCC lineages such as the trachea or oviduct. The confinement of LacZ expression specifically with EC in the Kif6-LacZ gene trap mouse suggest a large part of this specificity of function is simply due to strict regulation of Kif6 expression to the EC lineages, which would implicate the action of a tightly regulated, EC specific-promoter driving expression of the Kif6 locus. Both models will be important to test in future studies to better understand the critical components and pathways important for EC cilia development.

Material and methods

Ethics statement

The collection and use of human DNA samples in this study was approved by the Institutional Review Board Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand (IRB 381/61). All subjects provided written informed consent prior to inclusion in the study. All animal research was conducted according to federal, state, and institutional guidelines and in accordance with protocols approved by Institutional Animal Care and Use Committees at University of Texas at Austin (AUP-2015-00185; AUP-2015-00187; and AUP-2018-00225).

Whole exome sequencing (WES)

The patient’s genomic DNA of patient was extracted from peripheral blood leukocyte using AchivePure DNA Blood Kit (5 Prime Inc., Gaithersburg, MD). The sample was sent to Macrogen, Inc. (Seoul, Korea) for whole exome sequencing. The 4 ug of DNA sample was enriched by TruSeq Exome Enrichment Kit and was sequenced onto Hiseq 2000. The raw data per exome was mapped to the human reference genome hg19 using CASAVA v1.7. Variants calling were detected with SAMtools.

Homozygosity mapping

The sample was sent to Macrogen, Inc. (Seoul, Korea) for genotyping. The DNA sample was genotyped by HumanOmni 2.5-4v1 DNA BeadChip (Illumina) which contain 2,443,177 SNPs. The experiment was performed by the array protocol. PLINK was used to analyze for the homozygous regions.

Mutation analysis

We performed resequencing of KIF6 pathogenic region in patient and patient’s family. Primers for the amplification of the candidate variant were designed using Primer 3 software (version 0.4.0). Primers KIF6-1193delT-F 5’-CAGCTTGAACATGGCTGAAA-3’ and KIF6-1193delT-R 5’-TTCTGTAAAGAGGTGGGAACAA-3’were used to amplify. The 20 ul of PCR reaction contained 50–100 ng of genomic DNA, 200 uM of each dNTP, 150 nM of each primer, 1.5 mM MgCl2 and 0.5 unit of Taq DNA polymerase (Fermentas Inc., Glen Burnie, MD). The PCR condition was started with 95 oC for 5 min for pre-denaturation following with the 35 cycles of 94 oC for 30 sec, 55 oC for 30 sec and 72 oC for 30 sec. The product size of these primers is 276 bp. For sequencing, PCR products were treated with ExoSAP-IT (USP Corporation, Cleveland, OH), and sent for direct sequencing at Macrogen Inc. (Seoul, Korea). Bi-directional sequencing was done by using KIF6-1193delT F and R primers. Analyses were performed by Sequencher 4.2 (Gene Codes Corporation, Ann Arbor, MI).

PCR-RFLP

One hundred chromosomes and patient’s trio were genotyped by PCR-RFLP. Primer KIF6 MfeI F 5’-TGGCTTCACTATAAATTTCACTTTGTCAATG-3’ and mutagenic primer KIF6 mutagenic MfeI R 5’-TCCTGGTCTTCCAAAAAGGATGCAAT-3’were used to amplify KIF6 T-deletion. The 20 ul of PCR reaction contained 50–100 ng of genomic DNA, 200 uM of each dNTP, 150 nM of each primer, 1.5 mM MgCl2 and 0.5 unit of Taq DNA polymerase (Fermentas Inc., Glen Burnie, MD). The PCR condition was started with 95 C for 5 min for pre-denaturation following with the 35 cycles of 94 C for 30 sec, 60 C for 30 sec and 72 C for 30 sec. The product size of these primers is around 223 bp. The PCR product was incubated with 10U of Mfe-HF (New England Biolabs, Ipswich, MA) at 37 C overnight. Three percent of agarose gel electrophoresis was used to detect the different cut sizes of PCR product. A 196 bp and 26 bp bands were present in one base deletion sample.

Mice

All mouse studies and procedures were approved by the Animal Studies Committee at the University of Texas at Austin (AUP-2015-00185). The Kif6 mutant mouse were developed using CRISPR-Cas9-mediated genome editing. Using the CHOP-CHOP online tool [50], we identified a suitable 20-nucleotide site (GGAGATGTCACTGGGACGCC) targeting exon 14 of mouse Kif6 (ENSMUST00000162854.1) in order to generate a C-terminal truncation allele. The gene specific and universal tracrRNA oligonucleotides (S3 Table) were annealed, filled in with CloneAmp HiFi PCR premix, column purified, and directly used for in vitro transcription of single-guide RNAs (sgRNAs) with a T7 Polymerase mix (M0255A NEB). All sgRNA reactions were treated with RNAse free-DNAse. We utilized a ssDNA oligo (S3 Table) to insert a frameshift mutation in all three reading frames, along with 8-cutter restriction sites for genotyping (3-stop donor) [51] (S2 Fig). The Kif6 ex14 3-stop donor and mKif6-R2-ex14-T7 sgRNA were submitted for pronuclear injection at the University of Texas at Austin Mouse Genetic Engineering Facility (UT-MGEF) using standard protocols (https://www.biomedsupport.utexas.edu/transgenics). We confirmed segregation of the Kif6 allele using several methods including increased mobility on a high percentage electrophoresis gel, donor-specific primer PCR, or PmeI (NEB) digestion of the Kif6 exon14 amplicon (S2 Fig and S3 Table). PCR products in isolated alleles were cloned to pCRII TOPO (ThermoFisher) to identify scarless integration of the 3-stop donor at the Kif6 locus using gene specific flanking primers (S3 Table). Kif6-LacZ mice were generated by injection of embryonic stem cell clones obtained from the Knockout Mouse Project (KOMP) Repository. Three Kif6 embryonic stem (ES) cell clones (KOMP: EPD0736_3_G01; EPD0736_3_H02; and EPD0736_3_A03) all targeting exon 4 of the Kif6 gene with a promoter-driven targeting cassette for the generation of a 'Knockout-first allele' [52]. Pronuclear injections of all clones were done using standard procedures established by the UT MGEF. After screening for germline transmission, we isolated and confirmed a single heterozygous founder male (Kif6) carrier derived from the G01 clone. We confirmed the locus by long-range PCR, several confirmation PCR strategies targeting specific transgene sequences, and Sanger sequencing of the predicted breakpoints (S3 Table). After several backcrosses to the WT C57BL/6J substrain (JAX), we crossed a hemizygous Kif6 mutant male to a homozyogus CMV-Cre female (B6.C-Tg(CMV-cre)1Cgn/J) (JAX, 006054) to convert the Kif6 allele to a stable LacZ expressing Kif6 allele (Kif6-LacZ). Mutant F1 offspring from this cross were backcrossed to WT C57BL6/J mice and the F2 progeny were genotyped to confirm the Kif6-LacZ allele and the presence/absence of the CMV-Cre transgene. A single founder Kif6-LacZ with the desired genotype (Kif6-LacZ hemizygous, Cre transgene absent) was used to expand a colony for spatial expression analysis. Kif6 conditional ready mice were generated by outcross of the Kif6 allele described above to a ubiquitously expressed Flippase strain (129S4/SvJaeSor-Gt(ROSA)26Sor/J) (JAX, 003946). F1 offspring were genotyped and sequenced at several breakpoints to ensure proper flip recombination and a single F1 founder was used to backcross to C57B6/J for propagation of the Kif6 strain. Analysis of recombination of the floxed Kif6 was performed by crossing homozygous Kif6 to a compound heterozygous CMV-Cre; Kif6 mouse. Recombination of the exon 4 of Kif6 was confirmed by PCR-gel electrophoresis analysis (S3 Table).

LacZ staining protocol

Mice were perfused with LacZ fixative and post fixed for 2 hours at RT. Whole brains were then stained in X-gal solution overnight at 37°C followed by post-fixation in 4% PFA overnight at 4°C. The samples were then prepped for cryosectioning in 30% sucrose/OCT and sectioned. Sections were counter stained in Nuclear Fast Red stain (Sigma).

X-ray analyses of mice

Radiographs of the mouse skeleton were generated using a Kubtec DIGIMUS X-ray system (Kubtec, T0081B) with auto exposure under 25 kV.

Zebrafish manipulations and transgenesis

All zebrafish studies and procedures were approved by the Animal Studies Committee at the University of Texas at Austin (AUP-2015-00187). Adult zebrafish of the AB were maintained and bred as previously described [53]. Individual fish were used for analysis and compared to siblings and experimental control fish of similar size and age. Independent experiments were repeated using separate clutches of animals. Strains generated for this study: Tg(Foxj1a:GFP)dp1 and Tg(foxj1a::Arl13b-GFP)dp15. Transgenic lines were generated using a Gateway-compatible middle entry cloning containing mouse Arl13b open reading frame[54]was modified to include a C-terminal GFP by megaprimer PCR to generate pME-Arl13b GFP. This clone was recombined with p5E-foxj1aP [26], p3E-polyA[55] and pDEST pDestTol2pACryGFP to generate a final transgenesis vector. Embryos were injected at the one-cell stage with 25 pg of assembled transgene and 25 pg Tol2 mRNA. Embryos were sorted at 48 hpf for reporter expression (GFP+ eyes) and were subsequently grown to adulthood. Individuals were bred to TU wild-type zebrafish to generate a stable F1 line, and subsequently bred into a kif6 mutant background. pDestTol2pACryGFP was a gift from Joachim Berger & Peter Currie (Addgene plasmid # 64022). Previously published strains: kif6 [19].

Xenopus manipulation and analysis

Xenopus embryo manipulations were carried out using standard protocols [56]. Full length of Xenopus Kif6 cDNA sequence was provided from Xenbase (www.xenbase.org) and amplified from Xenopus cDNA library by PCR and inserted in-frame into pCS10R-eGFP. 5’-capped Kif6-GFP RNA was synthesized using mMESSAGE mMACHINE SP6 transcription kit (Invitrogen Ambion). Synthetic 5’-capped RNAs: Kif6-GFP, membrane RFP and Centrin4-BFP [35] were injected into two ventral blastomeres at the 4-cell stage with ~ 40 pg/RNA/injection. Live images were captured with a Zeiss LSM700 laser scanning confocal microscope using a plan-APOCHROMAT 63X 1.4 NA oil objective lens (Zeiss).

Mouse and zebrafish perfusions and embedding of brain tissues

Mice were humanely euthanized by extended CO2 exposure and transferred to chemical hood where the mouse was perfused with buffered saline followed by 4% PFA. Whole brains were placed in 4% PFA 4 hours at RT, then at 4° C overnight. Zebrafish were euthanized by exposure to lethal, extended dose of Tricane (8%) followed by decapitation. Zebrafish brains were extracted and fixed in 4% PFA at 4° C overnight. For paraffin embedding, the fixed brains were embedded and cut using standard paraffin embedding and sectioning protocols. Paraffin sections were stained with standard hematoxylin-eosin solution. For frozen sections both mouse or zebrafish brains were fixed as above and then equilibrated to 30% or 35% sucrose, respectively at 4° C overnight. Whole brains were then placed in O.C.T. Compound (Tissue-Tek) and flash in cold ethanol bath. All blocks were stored at -80° Celsius until sectioning on a cryostat (Leica). All sections were dried at RT for ~2hrs. and stored at -80°C until use.

Immunofluorescence protocol for frozen brain sections

Sectioned tissues were warmed at room temperature for ~1 hour, then washed thrice in 1xPBS + 0.1% Tween (PBST). Antigen retrieval was hot citrate buffer (pH6.8). Blocking was done in 10% Normal goat serum (Sigma) in 1xPBST. Primary antibodies (S100B at 1:1,000, ab52642, Abcam; CD133(Prominin-1), 134A, 1/500; Gamma Tubulin, sc-17787, Santa Cruz (C-11), 1/500; Anti-GFP, SC9996, Santa Cruz, 1:1,000) were diluted in 10% NGSS, 1xPBST and allowed to bind overnight at 4°C in a humidified chamber. Secondary fluorophores (Alexa Fluor 488(A-11034); 568(A10042); and 647(A32728), 1:1,000, ThermoFisher) were diluted in 10% NGS; 1xPBST were allowed to bind at RT for ~1hr. We used Prolong gold with DAPI (Cell Signaling Technologies, 8961) to seal coverslips prior to imaging.

Iodine-contrast μCT

Zebrafish specimens were fixed overnight in 10% buffered formalin, washed thrice in diH2O and stained ~48 hours in 25% Lugol’s solution/75% distilled water. Specimens were scanned by the High-resolution X-ray CT Facility (http://www.ctlab.geo.utexas.edu/) on an Xradia at 100kV, 10W, 3.5s acquisition time, detector 11.5 mm, source -37 mm, XYZ [816, 10425, –841], camera bin 2, angles ±180, 1261 views, no filter, dithering, no sample drift correction. Reconstructed with center shift 5.5, beam hardening 0.15, theta -7, byte scaling [–150, 2200], binning 1, recon filter smooth (kernel size = 0.5).

Ex-Vivo ventricle imaging

Brains were isolated from freshly euthanized mice and were dissected in cold DMEM/F12 media. The brain was cut into thin coronal slices, promptly placed onto cover slip with PBS, and imaged using oblique lighting with a Keyence BZ-X800 microscope.

Statistical analysis and image measures

GraphPad Prism version 7.0c for Mac (GraphPad Software) was used to analyze and plot data. Images for measurement were opened in FIJI (Image J) [57], and measures were taken using the freehand tool to draw outlines on ventricular area or whole brain area. Statistically significant differences between any two groups were examined using a two-tailed Student’s t-test, given equal variance. P values were considered significant at or below 0.05.

Clustal Alignment of CPE (p.V79M) variant.

Hs, Homo sapiens; Pt, Pan troglodytes; Mc, Macaca mulatta; Mu, Mus musculus; Rn, Rattus norvegicus; Bt, Bos Taurus; Cl, Canis lupus familiaris; Oc, Oryctolagus cuniculus; Gg, Gallus gallus; Dr, Danio rerio; Tn, Tetraodon nigroviridis; Xt, Xenopus (Silurana) tropicalis; Tc, Tribolium castaneum; Ce, Caenorhabditis elegans; Sk, Saccoglossus kowalevskii. (TIF) Click here for additional data file.

Kif6 generation and genotyping.

(A) Schematic of target cut site and insertion cassette into exon 14 of Kif6 locus. Insertion cassette contains three stop codons, one in each reading frame, and two 8 basepair restriction enzyme cut sites for easy genotyping. (B-C) Agarose gels of PCR products confirming germline transmission of donor cassette in F1 generation from CRISPR injected chimeras. (B) RE digest of PCR product from exon 14 flanking target site, shows cutting (asterisks) in heterozygous F1 mice. Wildtype band (arrow) appears in lane one and all the subsequent lanes. (C) PCR product from donor specific primer and Kif6 exon 14 reverse primer confirming donor insertion and germline transmission. (D) Table describing CRISPR injected mice, number with detectable indels, total with integration of donor oligo, and total displaying hydrocephaly of chimeric injected CRISPR mice. (E) Germline transmission of donor cassette from chimeric CRISPR F0 mice to F1 generation. (TIF) Click here for additional data file.

Cre-CMV; Kif6 mice display hydrocephaly at P14.

(A-B) Dilation of the LV and 3V evident in P14 mice through coronal sections of H&E stained mouse brains from heterozygous and Cre-CMV; Kif6 mice. (C) Quantification of LV area over the total brain area shows significant increase in ventricular area in Cre-CMV;Kif6 mice. (TIF) Click here for additional data file.

LacZ expression in different ages of Kif6-LacZ transgenic mouse brain.

(A-A”) Coronal sections of P21 mouse brains showing LacZ staining restricted to the EP cell layer in the 4th ventricle. Zoom in shows LacZ positive cells have cilia projecting into the lumen (arrows). (B-B’) Coronal sections of P21 mouse brains showing LacZ staining of ventral portion of 3rd ventricle. (B’) Some sporadic staining appearing in the nuclei of the hypothalamus (arrows). (C-C’) LacZ staining in the fourth ventricle at P10 showing staining specific to ependymal cell layer. (TIF) Click here for additional data file.

Immunofluorescence (IF) of Kif6 mutant multiciliated tissues in mouse and zebrafish.

(A-B) Immunofluorescence of trachea sections in Kif6 and Kif6 mice showing no apparent cilia defects present in trachea of Kif6 mutant mice. Acetylated tubulin (green) marking cilia, DAPI-stained nuclei (magenta) (C-D) Representative IF of zebrafish nasal pit cilia shows typical cilia in kif6 mutant zebrafish to wildtype counterparts. Acetylated tubulin (magenta) marking cilia, gamma-tubulin marking basal bodies (green). Scale bars are 20μM. (TIF) Click here for additional data file.

SEM of lateral ventricle in Kif6 mutant and control at P28.

SEM of Kif6 wildtype vs. Kif6 mutants shows Kif6 mutants show a complete loss of ependymal cell cilia on the lateral wall by P28. Scale bar 10μM. (TIF) Click here for additional data file.

Immunofluorescence shows defects in differentiation of EC cilia.

(A-B) P14 mouse brains were sectioned and stained in wildtype and Kif6 mutant tissues to reveal EC cilia never fully differentiate. S100B (magenta) denotes proper specification of ECs in wildtype and mutant tissue, gamma-tubulin (cyan) shows basal bodies docking on the apical surface of ECs in both wildtype and Kif6 mutants, and finally CD133 (green) shows greatly diminished axonemes in Kif6 mutants compared to wildtype controls. (C) Quantitation of maximum intensity projection of fluorescence of the CD133 channel (EC axonemes). Scale bar 20uM. (TIF) Click here for additional data file.

Kif6 mutant mice have defects in differentiation of EC cilia.

(A-D) P14 and P21 Kif6 mutants show reduction in acetylated tubulin in ciliary axonemes. (A and C) P14 and P21 heterozygous littermates show normal EC specification, S100B (magenta), and extension of ciliary axonemes into the lumen of the ventricle, acetylated tubulin (green). (B and D) Kif6p.G555fs mutant mice however show a severe reduction in acetylated tubulin in EC ciliary axonemes at both P14 and P21. Scale bar 20uM. (TIF) Click here for additional data file.

SEM of ventricle in kif6 mutant zebrafish display dilation of the ventricular system and loss of ependymal cell cilia.

Scanning Electron Microscopy of zebrafish brain shows dilation of rhombencephalic (blue box) and telencephalic (green box) ventricles (red dotted line) indicative of hydrocephaly. Higher magnification images reveal loss of ependymal cell cilia tufts (red arrowheads) in kif6 zebrafish mutants when compared with heterozygous counterparts (red arrowheads). Scale bars 20μM and 200μM. (CCe: Cerebellum) (TIF) Click here for additional data file.

Kif6-EGFP can localizes to mitotic spindle poles.

A time course of images showing microinjected Kif6-EGFP localizes to microtubule-rich spindle poles and mitotic spindle during cell divisions in the rapidly dividing blastomeres of the early embryo. (TIF) Click here for additional data file.

Western blot for KIF6 antibodies using mouse lysates from wildtype, Kif6, and Cre-CMV;Kif6.

Representative testing of two different KIF6 antibodies in mouse ventricular lysates failed to show a banding at reported size, or banding patterns at a size different to that of what is reported. Vinculin antibody used as a loading control. (TIF) Click here for additional data file.

X-rays of Kif6 mutant mice.

Representative X-rays of wildtype and Kif6 and wildtype mutant mice shows no scoliosis at P28. Kif6 mice do however display skull expansion caused by progressive hydrocephalus (Animal #1 and #2). (TIF) Click here for additional data file.

Eighty-three homozygous variants from WES.

(DOCX) Click here for additional data file.

Sixty-three homozygous regions from homozygosity mapping.

(DOCX) Click here for additional data file.

Mouse specific oligos and primers.

(DOCX) Click here for additional data file.

Numerical data and summary statistics.

(XLSX) Click here for additional data file.

Ex vivo oblique bright field imaging of Kif6 heterozygous mouse ventricle.

(MP4) Click here for additional data file.

Ex vivo oblique bright field imaging of Kif6 mutant mouse ventricle.

(MP4) Click here for additional data file.

Representative WT_Danio_Iodine-contrasted microCT transverse slices.

(AVI) Click here for additional data file.

Representative kif6_Danio_Iodine-contrasted microCT transverse slices.

(AVI) Click here for additional data file.
  55 in total

Review 1.  Intraflagellar transport.

Authors:  Joel L Rosenbaum; George B Witman
Journal:  Nat Rev Mol Cell Biol       Date:  2002-11       Impact factor: 94.444

Review 2.  Kinesin superfamily motor proteins and intracellular transport.

Authors:  Nobutaka Hirokawa; Yasuko Noda; Yosuke Tanaka; Shinsuke Niwa
Journal:  Nat Rev Mol Cell Biol       Date:  2009-10       Impact factor: 94.444

Review 3.  Relationship of senescence of cerebrospinal fluid circulatory system to dementias of the aged.

Authors:  E Rubenstein
Journal:  Lancet       Date:  1998-01-24       Impact factor: 79.321

4.  SMART, a simple modular architecture research tool: identification of signaling domains.

Authors:  J Schultz; F Milpetz; P Bork; C P Ponting
Journal:  Proc Natl Acad Sci U S A       Date:  1998-05-26       Impact factor: 11.205

5.  KIF19A is a microtubule-depolymerizing kinesin for ciliary length control.

Authors:  Shinsuke Niwa; Kazuo Nakajima; Harukata Miki; Yusuke Minato; Doudou Wang; Nobutaka Hirokawa
Journal:  Dev Cell       Date:  2012-11-15       Impact factor: 12.270

6.  A conditional knockout resource for the genome-wide study of mouse gene function.

Authors:  William C Skarnes; Barry Rosen; Anthony P West; Manousos Koutsourakis; Wendy Bushell; Vivek Iyer; Alejandro O Mujica; Mark Thomas; Jennifer Harrow; Tony Cox; David Jackson; Jessica Severin; Patrick Biggs; Jun Fu; Michael Nefedov; Pieter J de Jong; A Francis Stewart; Allan Bradley
Journal:  Nature       Date:  2011-06-15       Impact factor: 49.962

Review 7.  IFT-Cargo Interactions and Protein Transport in Cilia.

Authors:  Karl F Lechtreck
Journal:  Trends Biochem Sci       Date:  2015-10-21       Impact factor: 13.807

8.  A size-exclusion permeability barrier and nucleoporins characterize a ciliary pore complex that regulates transport into cilia.

Authors:  Hooi Lynn Kee; John F Dishinger; T Lynne Blasius; Chia-Jen Liu; Ben Margolis; Kristen J Verhey
Journal:  Nat Cell Biol       Date:  2012-03-04       Impact factor: 28.824

9.  Systematic discovery of novel ciliary genes through functional genomics in the zebrafish.

Authors:  Semil P Choksi; Deepak Babu; Doreen Lau; Xianwen Yu; Sudipto Roy
Journal:  Development       Date:  2014-09       Impact factor: 6.868

10.  The planar cell polarity effector Fuz is essential for targeted membrane trafficking, ciliogenesis and mouse embryonic development.

Authors:  Ryan S Gray; Philip B Abitua; Bogdan J Wlodarczyk; Heather L Szabo-Rogers; Otis Blanchard; Insuk Lee; Greg S Weiss; Karen J Liu; Edward M Marcotte; John B Wallingford; Richard H Finnell
Journal:  Nat Cell Biol       Date:  2009-09-20       Impact factor: 28.824

View more
  20 in total

1.  Identification of Functional Genetic Variants Associated With Alcohol Dependence and Related Phenotypes Using a High-Throughput Assay.

Authors:  Kriti S Thapa; Andy B Chen; Dongbing Lai; Xiaoling Xuei; Leah Wetherill; Jay A Tischfield; Yunlong Liu; Howard J Edenberg
Journal:  Alcohol Clin Exp Res       Date:  2020-11-17       Impact factor: 3.455

Review 2.  Development of a straight vertebrate body axis.

Authors:  Michel Bagnat; Ryan S Gray
Journal:  Development       Date:  2020-10-06       Impact factor: 6.868

3.  The role of motile cilia in the development and physiology of the nervous system.

Authors:  Christa Ringers; Emilie W Olstad; Nathalie Jurisch-Yaksi
Journal:  Philos Trans R Soc Lond B Biol Sci       Date:  2019-12-30       Impact factor: 6.237

4.  The axonemal dynein heavy chain 10 gene is essential for monocilia motility and spine alignment in zebrafish.

Authors:  Yunjia Wang; Benjamin R Troutwine; Hongqi Zhang; Ryan S Gray
Journal:  Dev Biol       Date:  2021-12-13       Impact factor: 3.582

Review 5.  Motor Proteins and Spermatogenesis.

Authors:  Siwen Wu; Huitao Li; Lingling Wang; Nathan Mak; Xiaolong Wu; Renshan Ge; Fei Sun; C Yan Cheng
Journal:  Adv Exp Med Biol       Date:  2021       Impact factor: 2.622

Review 6.  Genetic animal modeling for idiopathic scoliosis research: history and considerations.

Authors:  Elizabeth A Terhune; Anna M Monley; Melissa T Cuevas; Cambria I Wethey; Ryan S Gray; Nancy Hadley-Miller
Journal:  Spine Deform       Date:  2022-04-16

7.  The Reissner Fiber Is Highly Dynamic In Vivo and Controls Morphogenesis of the Spine.

Authors:  Benjamin R Troutwine; Paul Gontarz; Mia J Konjikusic; Ryoko Minowa; Adrian Monstad-Rios; Diane S Sepich; Ronald Y Kwon; Lilianna Solnica-Krezel; Ryan S Gray
Journal:  Curr Biol       Date:  2020-05-07       Impact factor: 10.834

Review 8.  Zebrafish: An Emerging Model for Orthopedic Research.

Authors:  Björn Busse; Jenna L Galloway; Ryan S Gray; Matthew P Harris; Ronald Y Kwon
Journal:  J Orthop Res       Date:  2019-12-12       Impact factor: 3.102

9.  Mutations in KIF7 implicated in idiopathic scoliosis in humans and axial curvatures in zebrafish.

Authors:  Elizabeth A Terhune; Melissa T Cuevas; Anna M Monley; Cambria I Wethey; Xiaomi Chen; Maria V Cattell; Melisa N Bayrak; Morgan R Bland; Brittan Sutphin; George Devon Trahan; Matthew R G Taylor; Lee A Niswander; Kenneth L Jones; Erin E Baschal; Lilian Antunes; Matthew Dobbs; Christina Gurnett; Bruce Appel; Ryan Gray; Nancy Hadley Miller
Journal:  Hum Mutat       Date:  2021-02-07       Impact factor: 4.878

10.  Low tolerance for transcriptional variation at cohesin genes is accompanied by functional links to disease-relevant pathways.

Authors:  William Schierding; Julia A Horsfield; Justin M O'Sullivan
Journal:  J Med Genet       Date:  2020-09-11       Impact factor: 6.318

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.