PEDF protects human retinal pigment epithelial cells against oxidative stress via upregulation of UCP2 expression.

To investigate the protective function of pigment epithelium‑derived factor (PEDF) against oxidative stress (OS) in ARPE‑19 cells, ARPE‑19 cells were divided into different OS groups and treated with various concentrations of H2O2 (0, 75, 150 and 200 µmol/l) for 24 h. To establish the protective group, 200 ng/ml of PEDF was administered to ARPE‑19 cells. Cell Counting Kit‑8 assays and cell growth curve experiments were performed to determine levels of cell viability; lactate dehydrogenase and propidium iodide (PI) staining assays were also performed. The expression levels of genes associated with apoptosis as well as uncoupling protein 2 (UCP2) were detected by reverse transcription‑quantitative, or semi‑quantitative polymerase chain reaction. Furthermore, an OS injury animal model was established in both C57BL/6 and BALB/c mice via injection of 5 µg of PEDF in the vitreous cavity and subsequent injection of 150 µM H2O2 following a 24 h time interval. Hematoxylin and eosin (H&E) staining, as well as UCP2 immunofluorescent labeling were also performed. One‑way analysis of variance was used to determine statistically significant differences, followed by multiple comparison analysis using the Newman Keuls method. The results of cell viability assays demonstrated that the numbers of apoptotic cells were increased following treatment with H2O2 in a dose‑dependent manner; however, this effect was reversed following treatment with PEDF. The expression levels of caspase 3 and B cell lymphoma (Bcl2) associated X genes associated with apoptosis were inhibited, whereas levels of the anti‑apoptotic gene Bcl2 were enhanced following treatment with PEDF in different passages of ARPE‑19 cells. Significant differences were demonstrated in the levels of UCP2 gene expression between the PEDF+ H2O2 treated group and cells treated with H2O2 alone. Labeling of the UCP2 detector in the confocal images demonstrated decreased UCP2 protein staining in the retinal pigment epithelium (RPE) cells and RPE layers following H2O2 injury; however, this effect was inhibited following treatment with PEDF. H&E staining was performed to investigate the thickness of the RPE layers, and the results revealed that thicknesses were significantly increased in sections treated with PEDF during OS, due to increased numbers of RPE cells. Furthermore, PEDF was demonstrated to increase UCP2 gene expression in ARPE‑19 cells and animal RPE layers under OS, which suggested that PEDF may protect RPE cells and tissues during oxidative injury.

Introduction

In recent years, it has been well established that age-associated macular degeneration (AMD) represents a leading cause of blindness in the elderly population (1). Numerous clinical and experimental studies investigating the treatment of AMD have been performed, including the administration of drugs, surgery and laser treatment (2). Furthermore, it has been suggested that the retinal pigment epithelium (RPE) layer may be the initial tissue type to be affected during AMD. A previous study demonstrated that the accumulation of oxidative damage may result in decreased function of RPE cells in patients with AMD (3). An increasing number of studies have supported the important role of oxidative stress (OS) during the development of age-associated cell dysfunction (4), leading to the development of AMD (5). Cellular or molecular damage caused by reactive oxygen species (ROS) has been suggested to represent the causative factors of OS (6) by inducing RPE cell death, subsequent atrophy of the photoreceptors and loss of vision (7). Therefore, a novel therapeutic strategy resulting in the rescue of RPE cells may prevent the occurrence or progression of AMD.

Increasing evidence has supported the hypothesis that OS-induced mitochondrial damage can lead to the disruption of mitochondrial energy metabolism, and promote the occurrence and development of AMD (8,9). Mitochondrial enzymes are the predominant source of ROS-producing enzymes in cells (10,11). As inner mitochondrial membrane proteins, mitochondrial uncoupling proteins (UCPs) regulate ROS (12–16). It has been well established that UCPs are the major antioxidants associated with the reduction of OS and the prevention of oxidative damage via regulation of ROS homeostasis (17). A number of studies have demonstrated that among the family of UCPs, UCP2 is an important factor associated with the prevention of OS (18–20). UCP2 has also been revealed to suppress the generation of ROS due to its function as a cationic carrier protein on the mitochondrial intima (20).

Furthermore, numerous studies have demonstrated that decreased levels of pigment epithelium-derived factor (PEDF) are associated with AMD (21–23). PEDF is a 50 kDa glycoprotein belonging to the serine protease inhibitor superfamily, that is secreted by RPE cells and was first identified in cultured fetal human RPE cells (24). RPE is an ocular tissue that expresses high levels of PEDF and breaks down the protein product into photoreceptor matrices (25–27). In addition, PEDF may enhance the survival of photoreceptors and retinal neurons (27,28). Our previous study demonstrated that PEDF protects RPE cells against OS-induced aging (29). Therefore, we hypothesized that PEDF may protect RPE cells and tissues via regulation of UCP2 expression during H2O2 injury.

The aim of the present study was to investigate the effects of PEDF on cell viability, UCP2 gene expression and RPE tissues during OS in vitro and in vivo, as well as to determine the potential role of PEDF in this protective mechanism.

Materials and methods

Materials

Human ARPE-19 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). Dulbecco's modified essential medium (DMEM) and fetal bovine serum (FBS) were obtained from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Trypsin digestion solution (0.25% trypsin and 0.02% ethylenediaminetetraacetic acid), 30% H2O2, 100X penicillin (100 u/ml)/streptomycin (0.1 mg/ml), PBS, Cell Counting Kit-8 (CCK-8), lactate dehydrogenase (LDH) kit, propidium iodide (PI) were all purchased from (Thermo Fisher Scientific, Inc.), and UCP2 antibodies (cat. no. ab77363; 100 µg) were all purchased from Abcam (Cambridge, UK). PEDF (purity >98%) was purchased from PeproTech, Inc. (Rocky Hill, NJ, USA). PEDF was dissolved in 1X PBS supplement to a fixed concentration of 20 µg/ml and subsequently diluted to a concentration of 200 ng/ml in culture media prior to use.

Animals

Male C57BL/6 mice and BALB/c mice (1-week-old; ~30 g) were purchased from Xi'an Jiao Tong University Medicine Laboratory Animal Center (Xi'an, China). The total number of each type of mice used was 40. The temperature was at 20–25°C. The relative humidity, air velocity and air pressure were 40–70, 0.1–0.2 m/sec and (20–50)2 Pa. The light/dark cycle of housing conditions was 12-h. Animals were fed ad libitum with standard laboratory food and water, and permitted to acclimatize for ≥1 week prior to further experimentation. Mice were randomly separated into a control group and various treatment groups. The number of mice in each treatment group and control group was 10. All animal experiments were approved by the Xi'an Jiao Tong University Animal Research Committee (Xi'an, China).

Cell culture

ARPE-19 cell passages used in the present study ranged from 5–30 generations. Cells were inoculated into 25-cm2 plastic culture flasks at a density of 1.0–3.0×105/cm2, subsequently cultured at 37°C in DMEM supplemented with FBS (100 ml/l) and penicillin/streptomycin (100 U/ml), and then incubated in a humidified atmosphere of 5% CO2 at 37°C for 48–72 h. Cells were observed under a phase contrast microscope at 10X and 40X for three days. Following this, oxidative damage models using ARPE-19 cells were established in vitro according to a previously published protocol (29–31).

Cell viability assay

ARPE-19 cells were seeded in E plate (5×103/well) and placed in an xCell-igence RTCA DP instrument (ACEA Biosciences, Inc., San Diego, CA, USA) in order to determine cell growth curves. Once the cell index reached 4–5, oxidative groups were treated with H2O2 (0, 75, 150, and 200 µM) for 24 h. In addition, the protected cell group, cells were treated with 200 ng/ml of PEDF or H2O2 (0, 75, 150, and 200 µM) for 24 h in humidified atmosphere of 5% CO2 at 37°C. The cells of the H2O2-only and PEDF-treated groups were then removed from the instrument and the cell growth curves were analyzed.

CCK-8 assay

ARPE-19 cell suspension (100 µl) was seeded in 96-well plates and then incubated in humidified atmosphere of 5% CO2 at 37°C for 24 h. Different concentrations of H2O2 (0, 75, 150, and 200 µM) were added to the wells, as well as PEDF (200 ng/ml) for the PEDF-treated group. Plates were then incubated for 24 h. CCK-8 solution (10 µl) was then added to each well and the absorbance at 450 nm was measured at 0.5, 1, 2, 3 and 4 h time intervals using a microplate reader. The following equation was used to determine cell viability: Cell proliferation (%)=[(dosing)-(blank)]/[(0 dosing)-(blank)] ×100.

LDH assay

LDH reaction mixture in the LDH Assay kit was incubated with ARPE-19 cells in 96-well plates in humidified atmosphere of 5% CO2 at 37°C for 30 min. The suspension cell density applied was 4×104/ml. Following this, the reaction was terminated and the absorbance was measured at 490 nm using a Benchmark microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Cell mortality rates were then determined for the different cell groups.

PI staining

The cells were centrifuged (300 × g, at room temperature for 5 min) and collected, the supernatant was discarded, and the cells were washed twice with pre-cooled PBS. 70% ethanol was added and cells were fixed at 4°C overnight. The cells were centrifuged (300 × g, at room temperature for 5 min), washed once with 1 ml of PBS and incubated with 4 µg/ml of PI solution to stain the nuclei of dead cells for 30 min at 4°C in the dark. Numbers of stained cells were estimated via fluorescence microscopy (DM2000LED/DF450C; Leica, Microsystems GmbH, Wetzlar, Germany) at ×4 magnification (n=6).

RNA extraction and reverse transcription-semi-quantitative polymerase chain reaction (RT-PCR)

Total RNA was isolated from the cells using TRIzol reagent (Thermo Fisher Scientific, Inc.) in ARPE-19 cells. RNA yield was determined spectrophotometrically (A260/A280). A First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) was used to perform RT, and 2 µg of RNA was incubated with 1 µl of oligo (dT) primer, 7 µl of RNase-free dH2O, 4 µl of 5X reaction buffer, 1 µl of RiboLock Rnase inhibitor, 2 µl of 10 mM dNTP mix, 1 µl RevertAid RT and RNase-free dH2O, the final volume of which was 20 µl. The reaction mixture was incubated at 70°C for 5 min, followed by incubation at 37°C for 5 min and then 42°C for 60 min. The reaction was terminated by incubation at 70°C for 10 min. RT-PCR (Applied Biosystems; Thermo Fisher Scientific, Inc.) was performed using 2 µl of cDNA, 12.5 µl of TaqPCR Master Mix (Thermo Fisher Scientific, Inc.), 1 µl of forward primers and 1 µl of reverse primers (Table I). dH2O was then added to produce a final volume of 25 µl according to the manufacturer's protocol for 35 cycles. The thermocycling conditions used for RT-PCR were as follows: 35 cycles of 30 sec at 94°C, 30 sec at 60°C and 30 sec at 72°C (31). The 2% agarose (2 g agarose to 100 ml TAE buffer solution) was prepared and heated in a microwave in order to dissolve in TAE buffer. Then cooled it to 50°C and added 4 µl ethidium bromide (0.1–0.2 pg/ml, Thermo Fisher Scientific, Inc.). The final RT-PCR products samples were performed for electrophoresis (100 mV 30 min, Bio-Rad Bole Level 15×10 cm Sub-Cell GT Electrophoresis Cell 1704481). Finally, gel was imaged and analyzed (Image Lab 5.1; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Table I.

Primer sequences of genes investigated by reverse transcription-semi-quantitative polymerase chain reaction and reverse transcription-quantitative polymerase chain reaction.

Gene name	Forward 5′-3′	Reverse 5′-3′
UCP2	CTACAAGACCATTGCACGAGAGG	AGCTGCTCATAGGTGACAAACAT
Caspase3	TGGAACAAATGGACCTGTTGACC	AGGACTCAAATTCTGTTGCCACC
Bax	CCTTTTCTACTTTGCCAGCAAAC	GAGGCCGTCCCAACCAC
Bcl2	ATGTGTGTGGAGAGCGTCAACC	TGAGCAGAGTCTTCAGAGACAGCC
GAPDH	CAAGGTCATCCATGACAACTTTG	GTCCACCACCCTGTTGCTGTAG

Bcl2, B cell lymphoma 2; Bax, Bcl2 associated X; UCP2, uncoupling protein 2.

Quantitative PCR (qPCR)

The RNA was isolated from ARPE-19 cells using the TRIzol reagent (Thermo Fisher Scientific, Inc.). In order to perform qPCR, a three-step amplifying protocol using SYBR Green Real-time PCR Master Mixes (cDNA Synthesis kit; Thermo Fisher Scientific, Inc.), as well as 1,000 ng template cDNA, 12.5 µl SYBR Green Real-time PCR Master Mixes, and 0.5 µl forward primers and 0.5 µl reverse primers, which were diluted in a 25 µl reaction volume. A StepOnePlus Real-Time PCR system was employed (Applied Biosystems; Thermo Fisher Scientific, Inc.). UCP2 and GAPDH primers were used in this experiment (Table I). The thermocycling conditions were as follows: 95°C for 10 min; followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, 72°C for 32 sec; followed by 95°C for 15 sec, 60°C for 60 sec and 95°C for 15 sec. Each sample was run and analyzed in triplicate. Expression levels were quantified using the 2−ΔΔCq method (29,32).

Preparation of retinal tissues

The 40 one-week-old male C57BL/6 mice and 40 BALB/c mice weighing ~30 g were used. Mice models were established using pre-protection with 5 µg of PEDF injected into the vitreous cavity for 24 h, followed by injection with 150 µM of H2O2 to induce animal injury (33,34). Mice were euthanized by dislocating their cervical spine. Following this, the eyes were enucleated, fixed in 4% paraformaldehyde at 4°C for 24 h, washed with PBS and then embedded in paraffin. Sections were subsequently subjected to hematoxylin and eosin (H&E) staining and immunocytochemistry.

H&E staining

H&E staining was performed according to standard protocol (34). Briefly, following deparaffinization and rehydration, longitudinal sections (5 µm) were stained with hematoxylin solution at 37°C for 5 min, immersed five times in a solution of 1% HCl and 70% ethanol and subsequently rinsed with distilled water. Sections were then stained with eosin solution at 37°C for 3 min, dehydrated with alcohol and immersed in xylene. The slides were then examined and images were captured using a fluorescence microscope at ×10 magnification (Thermo Fisher Scientific, Inc). The distance from the RPE layer to optic nerve head was measured, and the number of RPE cells was analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA).

Immunofluorescence staining of cells and tissues

Cells were fixed with 3.7% formaldehyde in PBS at 4°C for 30 min, rinsed in PBS three times and subsequently incubated at 37°C for 1 h with PBS containing 0.02% saponin and the following primary antibodies: UCP2 (1:500; cat. no. ab77363; Abcam) and GFAP (1:500; cat. no. BA0056; Boster Biological Technology, Pleasanton, CA, USA). Following this, the cells were rinsed with PBS and incubated at 37°C for 1 h with fluorescence-labeled secondary antibodies (1:300; cat. no. CA21202S; Invitrogen; Thermo Fisher Scientific, Inc.). Cells were subsequently incubated with β-actin solution (100 ng/ml; Abcam) at 37°C for 10 min to stain the cytoskeleton. Following this, the slides were rinsed with distilled water and subsequently covered with Fluoromount-G and a cover glass. The cells were then examined using a fluorescence microscope at ×40 magnification.

The fresh tissues were fixed in 4% paraformaldehyde at 4°C for 48 h. Paraffin-embedded eyeballs were removed and hydrated. The sections were microwaved in 0.01 mol/l of sodium citrate buffer, cooled for 30 min, washed in PBS and then blocked with 5% bovine serum albumin (cat. no. BA0056; Boster Biological Technology) at room temperature for 20 min. Sections were then incubated overnight at 48°C with an antibody against UCP2 (1:100; cat. no. AP52232-100 µg; Abgent, Inc., San Diego, CA, USA). Following rinsing with PBS, sections were then incubated with fluorescein isothiocyanate mice anti-human antibodies (1:200; cat. no. CA21202S; Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 1 h in the dark. Following rinsing with PBS, sections were incubated with 4′,6-diamidino-2-phenylindole (1 mg/ml) at 37°C for 10 min, rinsed in PBS then and analyzed using a fluorescence microscope at ×10 magnification.

Statistical analysis

All experiments were performed in triplicate. All data were analyzed using SPSS 18.0 software (SPSS, Inc., Chicago, IL, USA) and are presented as the mean ± standard error of the mean. Differences between groups were analyzed via one-way analysis with post hoc contrasts by Student-Newman-Keuls test. P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of H2O2 ARPE-19 cell growth

Administration of H2O2 is a well-established model for the study of the OS mechanism in RPE cells (30,35–38). H2O2 was applied to RPE cells to perform a cell growth curve experiment in order to determine the working concentrations resulting in consistent, high levels of cytotoxicity, which were defined as the level of H2O2 responsible for killing 50% of the RPE cells following a 24 h incubation time period (30).

Cytotoxic effects of H2O2 on ARPE-19 cells were detected using various concentrations of H2O2 (0, 50, 75, 150, 200, 300 and 500 µM). As presented in Fig. 1, the activity of the cells treated under 75, 150, 200, 300 and 500 µM H2O2 were significantly different from 0 µM H2O2 treated group. The number of viable cells was significantly decreased in a concentration-dependent manner. When the concentrations were 200, 300 and 500 µM, the number of dead cells was so large that subsequent experiments could not be performed. So the 0, 75, 150 and 200 µM working treatment concentrations of H2O2 were selected for inclusion in subsequent experiments. The cells appeared notably smaller with increasing concentrations of H2O2, and the number of dead cells following additional treatment with PEDF was decreased compared with cells treated with H2O2 alone (Fig. 2).

Figure 1.

Determination of H2O2 working concentrations for the treatment of retinal pigment epithelium cells. ARPE-19 cell growth curves were plotted using an xCell-igence RTCA DP instrument and treated with different concentrations of H2O2 (0, 50, 75, 150, 200, 300 and 500 µM) for 24 h. As concentrations of H2O2 increased, the number of viable cells decreased (n=6). There were significant differences between the viability of cells treated group with 75, 150, 200, 300, 500 µM H2O2 comparing with 0 µM H2O2 (n=6, *P<0.05 vs. 0 µM H2O2 group). However, when the concentrations were 200, 300 and 500 µM, the number of dead cells was so large that subsequent experiments could not be performed. So H2O2 working concentrations of 0, 75, 150 and 200 µM were selected for further experimentation (#H2O2 working concentrations).

Figure 2.

Phase-contrast micrographs of ARPE-19 cells following treatment with various concentrations of H2O2. With the increased concentration of H2O2 increased, the number of cells in the H group decreased. The morphology of cells became irregular and shrunken, with increased dead cells. Cells in the P+H group were simultaneously treated with PEDF and various concentrations of H2O2, and the number of shrunken and apoptotic cells were decreased following treatment with PEDF. PEDF, pigment epithelium-derived factor; H, H2O2 group; P+H, PEDF + H2O2 group. All large images, magnification ×10 and the smaller square was ×20.

PEDF protects cells against apoptosis during H2O2 injury

The cell growth curve results indicated that the viability of RPE cells was significantly decreased following treatment with H2O2 in a dose-dependent manner (Fig. 1). When cells were treated with 0 µM H2O2, no change in cell viability was observed (data not shown). The activity of PEDF-treated cells was increased compared with cells treated with H2O2 alone; 25±4.5 and 75±5.2% increase in cell number associated with PEDF-mediated protection following treatment with 75 and 150 µM H2O2, respectively (P<0.05; Fig. 3A and B), whereas cells treated with 200 µM H2O2 + PEDF did not exhibit a marked change in activity compared with cells treated with 200 µM alone (Fig. 3C). Cell proliferation was also investigated via CCK-8 assays (Fig. 3D). The results indicated that treatment with PEDF (75 and 150 µM) significantly protected cells from H2O2-induced injury; there was no difference between different concentrations in the H2O2-treated groups (75–200 µM; P>0.05; Fig. 3D).

Figure 3.

PEDF protects ARPE-19 cells from H2O2-induced cell death. Cells were divided into an oxidative group (H2O2 treatment only) and a protective group (treatment with PEDF+H2O2). Following treatment for 24 h, cell growth curves for both groups were analyzed. The results suggested that cell activity gradually decreased with the increasing concentrations of H2O2. (A and B) Cell viability following treatment with H2O2 + PEDF was determined using an xCell-igence RTCA DP instrument, and the results were then quantitatively analyzed. When cells were treated with 75 and 150 µM of H2O2, cell indexes exhibited by the PEDF + H2O2 group were increased compared with the group treated with H2O2 alone. Treatment with PEDF significantly increased the cell index value during oxidative stress injury (P<0.05; n=6). (C) When cells were treated with 200 µM of H2O2, no significant difference between the cell indexes exhibited by the two groups was observed (P>0.05; n=6). (D) ARPE-19 cell viability was further investigated using a CCK-8 assay. Cell proliferation gradually decreased as the concentration of H2O2 increased, while the viability of the PEDF treated group cells increased compared with cells treated with H2O2 alone (P<0.05; n=6). *P<0.05 vs. H2O2 group. CCK-8, Cell Counting Kit-8; PEDF, pigment epithelium-derived factor.

The sensitivity of RPE cells to H2O2 toxicity was more severe with increasing donor cell passages (29). In addition, PEDF treatment was revealed to significantly suppress cytotoxicity, as determined via LDH release (Fig. 4A) and PI staining (Fig. 4B) assays. The results of LDH release assays demonstrated that OS alone increased cytotoxicity by ~55±9.6%, whereas treatment with PEDF lowered OS-associated cell death by ~40±6.4%, compared with the H2O2-treated group (P<0.05). The result was further supported by PI staining, which indicated the number of dead cells (Fig. 4); however, differences between the PEDF+H2O2 and H2O2 alone groups were additionally demonstrated to be significant (P<0.05).

Figure 4.

PEDF protects cells against apoptosis during H2O2 injury. (A) LDH assays demonstrated an increase in LDH release following treatment with 150 µM H2O2; however, this effect was significantly attenuated following treatment with PEDF. (B) PI staining also revealed the extent of H2O2 toxicity, and that cell death induced by oxidative stress was attenuated by PEDF (n=6). *P<0.05 vs. H2O2 group. PI, propidium iodide; LDH, lactate dehydrogenase; PEDF, pigment epithelium-derived factor.

PEDF regulates the expression of genes associated with apoptosis

OS-induced apoptosis was also investigated via detection of apoptotic gene expression. The expression levels of caspase 3 and Bax, both of which are associated with apoptosis, were significantly enhanced following administration of H2O2, exhibiting 1.2±0.4- and 1.46±0.5-fold changes compared with the untreated group, respectively; however, the expression levels of the anti-apoptotic gene Bcl2 were suppressed following administration of H2O2 by 1.25±0.2-fold change (Fig. 5). PEDF reversed these effects, and induced a decrease in caspase 3 and Bax levels by 1.0±0.4-fold and 0.9±0.3-fold, respectively; an increase in Bcl2 expression levels by 1.5±0.2-fold was observed (P<0.05; Fig. 5). No marked differences were observed between the PEDF and control groups (P>0.05; Fig. 5).

Figure 5.

PEDF regulates the expression of genes associated with apoptosis. (A and B) The results of reverse transcription-semi-quantitative polymerase chain reaction analyses demonstrated that PEDF attenuated the effects of oxidative stress on caspase 3, Bax and Bcl2 gene expression levels (n=6). *P<0.05 vs. H2O2 group. PEDF, pigment epithelium-derived factor; Bcl2, B cell lymphoma 2; Bax, Bcl2 associated X.

UCP2 mRNA levels in ARPE-19 cells during OS in the presence or absence of PEDF treatment

UCP2 mRNA expression in cells treated with H2O2 in the presence or absence of PEDF was investigated by RT-sqPCR. The results demonstrated no significant differences in UCP2 mRNA expression levels between different H2O2 treatment groups (P>0.05; Fig. 6). However, treatment with PEDF significantly increased the mRNA UCP2 levels by 33±3.2 and 45±4.6% in cells treated with 75 and 150 µM H2O2, respectively (P=0.001; Fig. 6).

Figure 6.

Determination of UCP2 mRNA levels by (A) reverse transcription semi-quantitative polymerase chain reaction after treatment with 200 ng PEDF+H2O2 for 24 h, or H2O2 alone for 24 h, followed by (B) densitometry analysis of PCR for UCP2. GAPDH served as the loading control. The results demonstrated that UCP2 gene expression in cells treated with PEDF was increased compared with the H2O2 group (n=6). In addition, there were no significant differences in UCP2 expression levels exhibited by cells treated with various concentrations of H2O2. *P<0.05 vs. H2O2 group. UCP2, uncoupling protein 2; PEDF, pigment epithelium-derived factor.

We also confirmed this result using qPCR. The results demonstrated that levels of UCP2 in PEDF+ H2O2 groups were significantly increased by 52±2.7 and 45±3.5% compared with groups treated with 75 and 150 µM H2O2, respectively (P<0.05; Fig. 7), while no statistical differences were revealed between different H2O2-treated cell groups.

Figure 7.

Expression levels of UCP2 mRNA were determined via quantitative polymerase chain reaction. The results demonstrated that PEDF attenuated the effects of oxidative stress by increasing UCP2 expression. Expression levels of UCP2 in the PEDF protective group and the oxidative group were significantly different (n=6). *P<0.05. UCP2, uncoupling protein 2; PEDF, pigment epithelium-derived factor.

PEDF protects RPE cells and tissues from OS-induced damage

OS-induced regulation of UCP2 expression levels was investigated using a UCP2 antibody, which revealed increased UCP2 expression in RPE cells following treatment with PEDF (Fig. 8A and B). Furthermore, the results demonstrated that PEDF increased the expression of UCP2 in the RPE layer compared with the untreated H2O2-alone treatment groups (Fig. 9).

Figure 8.

PEDF protects retinal pigment epithelium cells and tissues from OS-induced damage. (A and B) Immunofluorescence labeling assay results revealed that UCP2 expression was decreased during H2O2-induced cell injury in a concentration-dependent manner; however, treatment with PEDF attenuated this effect. Scale bar=30 µm. PEDF, pigment epithelium-derived factor; UCP2, uncoupling protein 2.

Figure 9.

Combined UCP2 (green fluorescence) and DAPI (blue fluorescence) labeling of retinal tissues post-treatment. The fluorescence intensity of UCP2 in the retinal pigment epithelium layer following pre-treatment with 200 ng of PEDF + 150 µm of H2O2 was enhanced compared with cells treated with H2O2. Red arrows represent the retinal pigment epithelium layer (scale bar=50 µm). UCP2, uncoupling protein 2; DAPI, 4′,6-diamidino-2-phenylindole; PEDF, pigment epithelium-derived factor.

Injury to the RPE layers during OS was reduced by treatment with PEDF. According to the H&E staining results, the thickness of RPE layer in the H2O2-injured group was markedly decreased compared with the negative group (no treatment), whereas treatment with PEDF treatment markedly attenuated this effect (Fig. 10A and B). The thickness of RPE layers in the C57BL/6 mice was measured at different distances from the optic disk, and the results demonstrated that the thicknesses were significantly increased in layers treated with PEDF during OS (Fig. 10C). This was also demonstrated in Fig. 10D, which revealed that the number of RPE cells increased by 2.25±0.3-fold following treatment with PEDF compared with cells treated with H2O2 alone (P<0.05). These results suggest PEDF alone group may have no marked protection in the control group cell. The BALB/c mice were used only to verify the results and confirm the same results with C57BL/6 mice. Therefore only the results of C57BL/6 mice were analyzed.

Figure 10.

Representative microstructure and histological images obtained following H&E staining demonstrated the morphological effects of various treatments on RPE layers in animal models. C57BL/6 mice and BALB/c mice were treated with or without 5 µg of PEDF and 150 µM of H2O2. The histological images of H&E staining revealed that the thickness of RPE layers obtained from (A) C57BL/6 mice and (B) BALB/c mice treated with H2O2 alone were thinner compared with other treatment groups; however, this was markedly attenuated following treatment with PEDF during oxidative stress. (C and D) Quantitative analysis of C57BL/6 mice to make the comparison of PEDF+H2O2 group vs. the H2O2 group (n=6; P<0.05 vs. the H2O2 group). H&E, hematoxylin and eosin; PEDF, pigment epithelium-derived factor. RPE, retinal pigment epithelium; OS, outer segment; IS, inner segment; ONL, outer nuclear layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.

Discussion

In the present study, PEDF was revealed to effectively protect RPE cells and tissues from OS injury. Increasing evidence from basic and clinical studies (39,40) has indicated that oxidative damage severely affects the pathogenesis of AMD (41). Cumulative oxidative damage represents the underlying mechanism of aging, as well as various diseases, including Alzheimer's disease (42,43), Parkinson's disease and age-related macular degeneration (44). We have previously reported that human RPE cells are increasingly sensitive to OS in an age-dependent manner, and mitochondrial dysfunction induces cell vulnerability to stress (45,46). In a previous study, UCP2 expression in arcuate neurons induces mitochondrial alterations, and enhanced UCP2 activity decreases the production and availability of oxygen free radicals (47). As a sensor of mitochondrial OS, UCP2 is an important factor of local feedback mechanisms that regulate mitochondrial ROS production (20). Furthermore, previous data has revealed that PEDF decreases age-induced sensitivity of RPE cells to H2O2 toxicity and maintains mitochondrial function in RPE cells during OS (36). PEDF has been demonstrated to be an important protein for retinal survival and function (48–50). Considering that PEDF is expressed and secreted by RPE cells, it may undertake an autocrine protective mechanism that protects cells from OS-induced damage (51).

Culturing of RPE cells with H2O2 has been well established to represent an effective model for the study of OS and the effects of anti-apoptotic effectors (29,52,53). Following the treatment of cells with H2O2 (0, 75, 150 and 200 µM), the results of the present study demonstrated that PEDF had a protective effect against OS following treatment with 75 and 150 µM H2O2; however, PEDF did not exhibit a significant protective effect following treatment with 200 µM H2O2. In the present study, cell viability and proliferation were investigated by performing cell growth curve experiments, and CCK-8, LDH and PI staining assays, and the results revealed that PEDF protected cells from H2O2-induced cell death and PEDF increased cell viability following H2O2 treatment. The expression levels of apoptosis-associated caspase 3 and Bax genes were suppressed following treatment with PEDF, and the expression of the anti-apoptotic gene Bcl2 was increased, which suggested that the PEDF pathway is associated with cell survival during OS. In the present study, it was also revealed that treatment with PEDF significantly affected UCP2 mRNA and protein expression levels. In the animal model, the thickness of the RPE layer was increased post-treatment with PEDF compared with the H2O2 group, which supports our hypothesis that PEDF protects RPE tissue via upregulation of the mitochondrial inner membrane protein, UCP2. Previously, it has been reported that PEDF attenuated dendrite extension defective protein-induced apoptosis in pre-MC3T3-E1 osteoblasts (54). This study has also reported that PEDF attenuates endothelial injury by inhibiting Wnt/β-catenin pathways, which subsequently suppresses the OS response (55). Considering the published study report that (47) UCP2 regulates mitochondrial ROS production and suppresses ATP generation, it was hypothesized that PEDF protects RPE cells during OS, partly by increasing the expression levels of UCP2.

In conclusion, the present study demonstrated that PEDF may protect human ARPE-19 cells against H2O2-induced OS both in vitro and in vivo. Therefore, PEDF may represent a potential therapeutic agent for the prevention of AMD-associated visual damage.