Literature DB >> 30419739

Complete Mitochondrial Genome of the Chagas Disease Vector, Triatoma rubrofasciata.

Li Dong1, Xiaoling Ma1, Mengfei Wang1, Dan Zhu2, Yuebiao Feng1, Yi Zhang2, Jingwen Wang1.   

Abstract

Triatoma rubrofasciata is a wide-spread vector of Chagas disease in Americas. In this study, we completed the mitochondrial genome sequencing of T. rubrofasciata. The total length of T. rubrofasciata mitochondrial genome was 17,150 bp with the base composition of 40.4% A, 11.6% G, 29.4% T and 18.6% C. It included 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and one control region. We constructed a phylogenetic tree on the 13 protein-coding genes of T. rubrofasciata and other 13 closely related species to show their phylogenic relationship. The determination of T. rubrofasciata mitogenome would play an important role in understanding the genetic diversity and evolution of triatomine bugs.

Entities:  

Keywords:  Triatoma rubrofasciata; mitochondrial genome; phylogeny; protein-coding gene

Mesh:

Substances:

Year:  2018        PMID: 30419739      PMCID: PMC6243191          DOI: 10.3347/kjp.2018.56.5.515

Source DB:  PubMed          Journal:  Korean J Parasitol        ISSN: 0023-4001            Impact factor:   1.341


Chagas disease, also known as American trypanosomiasis, caused by the protozoan parasite, Trypanosoma cruzi, infects 8 million people worldwide, mostly in Latin America. In the past decades, it had been increasingly detected in the United States of America, Canada, and many European and some Western Pacific countries. This is mainly due to population mobility between Latin America and the rest of the world [1]. This disease is transmitted mainly through the biting of triatomine (reduviid) bugs, also called as ‘kissing bug’. The subfamily Triatominae is divided into 149 species, that composed of 5 tribes: Alberproseniini, Bolboderini, Cavernicolini, Rhodniini and Triatomini, which is distributed from the southern USA to Patagonia, and a few species of Triatomini are in India and Australia [2]. So far, information of only 2 mitochondrial (mt) genomes of triatomine bugs has been published. One is Triatoma dimidiata, mainly distributed from Mexico to Northern South America [3], the other is Triatoma infestans, the main vector of Chagas disease in South America [4]. In China, information of triatomine bugs was far from complete. Only a few reports show that T. rubrofasciata and Triatoma sinica are the 2 main native triatomine bugs [5]. It was used to distribute in Fujian, Guangxi, Hainan and Taiwan province in l980s [6,7]. In 2017, T. rubrofasciata from Guangdong province had been characterized by 16S rRNA sequence [5]. However, complete information of its mt genome is still unknown. For better understanding the biology of this species, the complete mt genome of T. rubrofasciata was determined and analyzed in this study. Furthermore, we constructed a phylogenetic tree on the 13 protein-coding genes of T. rubrofasciata and other 13 closely related species that show Triatoma species cluster together as a sister clade of Stenopodainae. Our findings will shed light on molecular taxonomy and population genetic studies of this important disease transmitting vector. A single female adult of T. rubrofasciata collected from the rural area of Baoting County (18°39′N 109°41′E) Hainan Province was used. The sample was stored in 100% ethanol at −20°C. The total DNA was extracted using the Holmes-Bonner buffer [8] and stored at −20°C until use. The complete mt genome sequence of T. rubrofasciata was amplified in 5 overlapping fragments, using 5 pairs of oligonucleotide primers designed based on the conserved regions from published complete mt genome of T. dimidiata (NC_002609.1) (Table 1). All PCR amplification reactions were carried out in a final volume of 25 μl, which included 9.5 μl of H2O, 12.5 μl of 1–5TM 2X High-Fidelity Master Mix (Molecular Cloning Laboratones MCLAB, South San Francisco, California, USA), 1 μl of each primer (10 μM), and 1 μl of DNA extract. Thermocycler conditions were as follows: 98°C for 2 min; 25 to 35 cycles of 98°C for 10 sec, 45–68°C for 15 sec, 72°C for 30–90 sec depending on fragment lengths, followed by 5–15 s/kb, then a final extension at 72°C for 5 min. These amplicons were sequenced by Shanghai Tsingke (Shanghai, China) using primer walking in both directions.
Table 1

Primer sequences used to amplify PCR fragments of Triatoma rubrofasciata

Primer nameSequences (5′-3′)Size (kb)
Tr-1ACCGCCTATTAATTCAGCCACTTGCGTGTTCTTAGTCGAAGACTTGTT~7k
Tr-2ACACCCGCAGTAACCAAAGTAGAAGAGGATGTAAGGTTCTTCAGCAGGAC~4k
Tr-3ACCATCTCGTCCGTTATCTTCTTCTGCGGTTATACAATAGGAGCGAGTGA~4k
Tr-4AAACGAGAGTGACGGGCGATATGGTTCATCCTGTTCCTGCTCCTCTT~4k
Tr-5TGGAAATGATGTCTTGGTTGCTATCAGAAAGACCTATGTACCTAAGAA~2k
The annotation of mt genome for T. rubrofasciata was preformed using web-based services MITOS (http://mitos.bioinf.uni-leipzig.de/help.py) [9]. Protein-coding genes were annotated by checking manually for consistent start/stop codons, open reading frames. Then, tRNAs were identified by the proposed clover-leaf secondary structure and predicted using web-based tRNA-scan SE 1.21 program (http://lowelab.ucsc.edu/tRNAscan-SE/) [10] with default search mode. The rRNA genes were annotated by extending until adjacent tRNAs [11]. Comparing with other mt genomes, the 5′ end of the srRNA gene was confined. Moreover, the base composition and codon usage were assessed using MEGA version 6.0 [12]. Finally, the graphical map of mt genome was drawn using web-based OrganellarGenomeDRAW (http://ogdraw.mpimp-golm.mpg.de/) [13] (Fig. 1).
Fig. 1

Graphical map of the complete mitochondrial genome of Triatoma rubrofasciata. Genes encoded by the heavy strand were shown outside the circle, and genes encoded by the light strand were shown inside the circle, respectively. The GC content of the genome were shown in the inner circle.

Previously published mt genome under other Reduvidae species were obtained from GenBank, including Brontostoma colossus (KM044501), Oncocephalus breviscutum (KC887527), Peirates arcuatus (KF752445), Peirates atromaculatus (KF913538), Peirates fulvescens (KF913537), Peirates lepturoides (KF913541), Peirates turpis (KF913540), Sirthenea flavipes (HQ645959), T. dimidiata (AF301594), T. infestans (KY640305), and Valentia hoffmanni (FJ456952). Furthermore, the mt genome from Apolygus lucorum (HQ902161) and Corythucha ciliate (KC756280) were used as outgroup. Then, protein-coding genes were aligned using ClustalW in MEGA 6.0 [12] with default settings. Thus, the sequences from the 13 protein-coding genes alignments were concatenated to single multiple sequence alignment for phylogenetic analysis. The phylogenetic relationships were constructed using maximum-likelihood method in MEGA 6.0, with node support was assessed with 1,000 bootstrap replicates (Fig. 2).
Fig. 2

Phylogenetic tree based on Maximum likelihood analysis of 13 protein-coding genes. Sequence from the present study was indicated with a blue font. Apolygus lucorum and Corythucha ciliate were used as outgroup. Bootstrap support values were displayed at each node.

The complete mt genome of T. rubrofasciata was a typically circular molecule with 17,150 bp in length (GenBank accession no. MH934953). The size of T. rubrofasciata mt genome was smaller than T. infestans (17,301 bp) [4], whereas was larger than T. dimidiata (17,019 bp) [3]. The slight difference in length is mainly due to the repeat region. The mt genome of T. rubrofasciata consisted of 13 protein-coding genes, 22 transfer RNAs, 2 ribosomal RNAs and a control region (Table 2). The genome organization was consistent with T. infestans, T. dimidiata and other reduviid genomes, such as Sirthenea flavipes [14] and Oncocephalus breviscutum [15]. However, there was 23 tRNA instead of 22 in Brontostoma Colossus [16]. Moreover, heavy strand (H strand) encoded 23 genes, whereas light strand (L strand) encoded the remaining 14 genes, and the overlap sequences were found at 16 locations. Most overlap sequence was only 1 bp and the longest overlap was 15 bp between ND1 and tRNA-Leu. In T. rubrofasciata, several intergenic sequences were observed, however the intergenic spacer function was still unknown. The most longest intergenic spacer located between tRNA-Ser and ND1 was similar to the intergenic spacer of Apis mellifera that thought to be another origin of replication [3]. There was a bias toward A and T nucleotides in mt genome nucleotide composition. The overall nucleotide composition of H-strand was 34.9% A, 34% T, 12.9% G, and 18.2% C, thus biased toward A+T (68.9%).
Table 2

Annotation of the complete mitochondrial genome of Triatoma rubrofasciata. tRNA abbreviations follow the IUPAC-IUB three letter code. For other abbreviation see legend for Fig. 1.

GeneStandNucleotide numberAnticodonStart codonStop codon
tRNA-IleH1-6733-35 GAT--
tRNA-GlnL65-133101-103 TTG--
tRNA-MetH133-200163-165 CAT--
ND2H219-1199-ATTTAG
tRNA-TrpH1206-12711236-1238 TCA--
tRNA-CysL1264-13251293-1295 GCA--
tRNA-TyrL1327-13921358-1360 GTA--
COIH1394-2922-ATGT(aa)
tRNA-LeuH2928-29962961-2963 TAA--
COIIH2997-3672-ATTT(aa)
tRNA-LysH3676-37453706-3708 CTT--
tRNA-AspH3745-38083775-3777 GTC--
ATP8H3809-3967-ATCTAA
ATP6H3961-4644-ATGTAA
COIIIH4631-5416-ATGTA(a)
tRNA-GlyH5416-54785446-5448 TCC--
ND3H5476-5832-ATATAA
tRNA-AlaH5833-58945862-5864 TGC--
tRNA-ArgH5898-59615927-5929 TCG--
tRNA-AsnH5973-60366003-6005 GTT--
tRNA-Ser(AGN)H6036-61086060-6062 GCT--
tRNA-GluH6108-61686137-6139 TTC--
tRNA-PheL6171-62346201-6203 GAA--
ND5L6234-7946-ATTTAA
tRNA-HisL7944-80097975-7977 GTG--
ND4L8012-9340-ATGTAA
ND4LL9334-9627-ATGTAA
tRNA-ThrH9630-96929660-9662 TGT--
tRNA-ProL9693-97579626-9628 TGG--
ND6H9761-10261-ATGTAA
CytBH10261-11391-ATGTAG
tRNA-Ser(UCN)H11393-1145911422-11424 TGA--
ND1L11641-12573-ATTTAA
tRNA-LeuL12559-1262412593-12595 TAG--
lrRNAL12625-13890---
tRNA-ValL13879-1394913915-13917 TAC--
srRNAL13952-14722---
Control region14723-17150---
The canonical start codons of protein-coding genes were ATN, GTG and TTG in invertebrate [17]. In T. rubrofasciata, the start codon of 13 protein-coding genes was ATN, instead of GTG and TTG. The start codons for most of the coding sequences was ATT (ND2, COII, ND5, ND1) and ATG (COI, ATP6, COIII, ND4, ND4L, ND6, CytB), except that ATC for ATP8 and ATA for ND3. Almost all start codons of protein-coding genes were consist with T. infestans and T. dimidiata. However, in T. rubrofasciata, ND5 start codons was ATT instead of GTG that was found in T. infestans and T. dimidiata. Most coding sequences was terminated with TAA (ATP8, ATP6, ND3, ND5, ND4, ND4L, ND6, ND1). The stop codons of ND2 and CytB were TAG. The COI and COII were stopped with incomplete T (aa) stop codons, and COIII stop codon was TA (a). The incomplete TA (a) and T (aa) stop codons were the deletion version of canonical TAA stop codon. It was common in metazoan mt genomes [11]. The 22 tRNA genes typically found in metazoan mt genomes were also identified in T. rubrofasciata ranging in length from 61 bp to 73 bp (Table 2). Most tRNA genes had the typical secondary structures except tRNA-Ser (AGN). It may be due to the formation of the dihydrouridine arm. The large rRNA subunit gene (lrRNA) was 1,266 bp long and the A+T content was 75.2%. The small rRNA subunit gene (srRNA) was 771 bp long and the A+T content was 70.8%. The control region in T. rubrofasciata was 2,428 bp in length. It was smaller than T. infestans (2,653 bp), whereas was larger than T. dimidiata (2,166 bp). The control region was the most variable region between Reduviidae species [16]. This region in T. rubrofasciata was divided into 4 different parts. The first part was 467 bp in length and located downstream of srRNA gene and ended with 11 guanines. The second region (436 bp) was located next to first region, heavily biased toward A+T (78.4%). The third region was the longest region (1,357 bp) and composed of 2 different tandem repeat units. One was 760 bp in length with 5 consecutive 152 bp repetitions. The other had 2 consecutive 198 bp repetitions. The fourth part of the control region was 168 bp, ended at the beginning of the tRNA-Ile, which had the potential to form stem-and-loop structure. We constructed a phylogenetic tree based on the analysis of 13 protein-coding genes (Fig. 2). As expected, T. rubrofasciata was clustered together with T. dimidiata and T. infestans that grouped in a highly supported clade. Triatoma species and Oncocephalus breviscutum (Stenopodainae) also grouped together in an extremely close clade. The close relationship between both subfamilies had been confirmed using morphological characteristics and phylogenetic analyses of the mitochondria 16S and nuclear 18S and 28S ribosomal DNA gene sequences [18,19]. In conclusion, our study details the complete sequencing and annotating of the mt genome of T. rubrofasciata. The complete mt genome contains 37 genes, including 13 protein-coding genes, 2 ribosomal RNA genes and 22 transfer RNA genes. Phylogenetic analyses using the amino acid sequences of the 13 protein-coding genes showed that the Triatoma species cluster together as a sister clade of Stenopodainae. This mt genome provides a unique genetic marker for studying the molecular biology, genetics and systematics of T. rubrofasciata.
  16 in total

1.  Complete nucleotide sequence and organization of the mitochondrial genome of Sirtheneaflavipes (Hemiptera: Reduviidae: Peiratinae) and comparison with other assassin bugs.

Authors:  Jianyu Gao; Hu Li; Xuan Lam Truong; Xun Dai; Jian Chang; Wanzhi Cai
Journal:  Zootaxa       Date:  2013       Impact factor: 1.091

Review 2.  Classification, evolution, and species groups within the Triatominae.

Authors:  C J Schofield; Cleber Galvão
Journal:  Acta Trop       Date:  2009 May-Jun       Impact factor: 3.112

3.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

4.  tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence.

Authors:  T M Lowe; S R Eddy
Journal:  Nucleic Acids Res       Date:  1997-03-01       Impact factor: 16.971

5.  Complete mitochondrial genome of Triatoma infestans (Hemiptera, Reduviidae, Triatominae), main vector of Chagas disease.

Authors:  Sebastián Pita; Francisco Panzera; Jesús Vela; Pablo Mora; Teresa Palomeque; Pedro Lorite
Journal:  Infect Genet Evol       Date:  2017-07-03       Impact factor: 3.342

6.  Studies on trypanosomes in the Taiwan monkey.

Authors:  J H Cross; M Y Hsu; C K Hung
Journal:  Southeast Asian J Trop Med Public Health       Date:  1983-12       Impact factor: 0.267

7.  MITOS: improved de novo metazoan mitochondrial genome annotation.

Authors:  Matthias Bernt; Alexander Donath; Frank Jühling; Fabian Externbrink; Catherine Florentz; Guido Fritzsch; Joern Pütz; Martin Middendorf; Peter F Stadler
Journal:  Mol Phylogenet Evol       Date:  2012-09-07       Impact factor: 4.286

8.  Complete mitochondrial genome of the assassin bug Oncocephalus breviscutum (Hemiptera: Reduviidae).

Authors:  Hu Li; Jianyu Gao; Wanzhi Cai
Journal:  Mitochondrial DNA       Date:  2013-10-09

9.  Shotgun assembly of the assassin bug Brontostoma colossus mitochondrial genome (Heteroptera, Reduviidae).

Authors:  Arthur Kocher; Maria Kamilari; Emeline Lhuillier; Eric Coissac; Julie Péneau; Jérôme Chave; Jerôme Murienne
Journal:  Gene       Date:  2014-09-18       Impact factor: 3.688

10.  First records of Triatoma rubrofasciata (De Geer, 1773) (Hemiptera, Reduviidae) in Foshan, Guangdong Province, Southern China.

Authors:  Qin Liu; Yun-Hai Guo; Yi Zhang; Zheng-Bin Zhou; Liang-Liang Zhang; Dan Zhu; Xiao-Nong Zhou
Journal:  Infect Dis Poverty       Date:  2017-08-15       Impact factor: 4.520

View more
  2 in total

1.  Biological attributes of the kissing bug Triatoma rubrofasciata from Vietnam.

Authors:  Ho Viet Hieu; Le Thanh Do; Sebastián Pita; Hoang Ha; Pham Thi Khoa; Pham Anh Tuan; Ta Phuong Mai; Ngo Giang Lien; Francisco Panzera
Journal:  Parasit Vectors       Date:  2019-12-16       Impact factor: 3.876

2.  Modelling the climatic suitability of Chagas disease vectors on a global scale.

Authors:  Fanny E Eberhard; Sarah Cunze; Judith Kochmann; Sven Klimpel
Journal:  Elife       Date:  2020-05-06       Impact factor: 8.140

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.