Literature DB >> 30402719

Zirconia Nanoparticles-Induced Toxic Effects in Osteoblast-Like 3T3-E1 Cells.

Mingfu Ye1,2, Bin Shi3,4.   

Abstract

Zirconia (ZrO2) is one of the widely used metal oxides for potential bio-applications such as biosensors, cancer therapy, implants, and dentistry due to its high mechanical strength and less toxicity. Because of their widespread applications, the potential exposure to these nanoparticles (NPs) has increased, which has attracted extensive attention. Thus, it is urgent to investigate the toxicological profile of ZrO2 NPs. Titanium dioxide (TiO2) is another extensively used nanomaterials which are known to be weakly toxic. In this study, TiO2 NPs were served as control to evaluate the biocompatibility of ZrO2 NPs. We detected the cytotoxicity of TiO2 and ZrO2 NPs in osteoblast-like 3T3-E1 cells and found that reactive oxygen species (ROS) played a crucial role in the TiO2 and ZrO2 NP-induced cytotoxicity with concentration-dependent manner. We also showed TiO2 and ZrO2 NPs could induce apoptosis and morphology changes after culturing with 3T3-E1 cells at high concentrations. Moreover, TiO2 and ZrO2 NPs at high concentrations could inhibit cell osteogenic differentiation, compared to those at low concentrations. In conclusion, TiO2 and ZrO2 NPs could induce cytotoxic responses in vitro in a concentration-dependent manner, which may also affect osteogenesis; ZrO2 NPs showed more potent toxic effects than TiO2 NPs.

Entities:  

Keywords:  3T3-E1 cells; Cytotoxicity; Nanoparticles; Osteogenesis; Titanium dioxide; Zirconia

Year:  2018        PMID: 30402719      PMCID: PMC6219995          DOI: 10.1186/s11671-018-2747-3

Source DB:  PubMed          Journal:  Nanoscale Res Lett        ISSN: 1556-276X            Impact factor:   4.703


Introduction

During the past few decades, the application of engineered nanoparticles (NPs) has expanded in various fields, such as electronics, biomedical applications, and pharmaceuticals. Zirconia (ZrO2) NPs are one of the major nanomaterials used for synthesizing refractories, foundry sands, and ceramics. Due to the preferable mechanical strength, this material is also used in biomedical field, including biosensors, cancer therapy, implants, joint endoprostheses, and dentistry [1, 2]. However, the wide application of particles has raised concern on their potential risks to health and environment, of which ensuring occupational and consumer safety is an essential concern. So far, toxicological studies on ZrO2 NPs are limited, and the results were controversial. Some studies have reported that ZrO2 NPs showed better biocompatibility when compared with other nanomaterials, including ferric oxide, titanium dioxide (TiO2), and zinc oxide (ZnO) [3-6]. In agreement with these results, others have reported ZrO2 NP could induce mild [3, 7] or no cytotoxic effects [8-10], and only few studies indicated a mild cytotoxic potential. However, Stoccoro et al. [11] developed the toxic effects of ZrO2 NPs and TiO2 NPs coated or not, they found that all kinds of NPs showed toxic effects to different degrees. Moreover, cell morphology changes, and cracks on the cell surface were observed in another study after ZrO2 NP treatment at concentrations up to 1 mg/mL in the red blood cells [12]. Hence, in this study, we evaluated the cytotoxic effects of ZrO2 NPs, providing useful insight for their future application in vivo. Meanwhile, we treated the cells with TiO2 NPs as the control group, which toxicological profile has been well developed [13]. Previous studies showed that NPs have been widely used as tissue-engineered materials and have the ability to improve the osteogenic differentiation of osteoblast [14-17]. One report indicated that silica (Si) NPs could reverse age-associated bone loss in mice, probably due to the Si NP-induced bone formation [16]. Liu et al. [14] found that silver (Ag) NPs/poly (DL-lactic-co-glycolic acid)-coated stainless steel alloy has strong antibacterial ability and could promote MC3T3-E1 cells osteoblastic proliferation and maturation in vitro. Moreover, carbon nanotubes were reported to induce bone calcification, most likely result from their nanosized structures which are similar to the size of intracellular organelles [18]. ZrO2 NPs have been applied as the main component of bioceramic implants, owing to its biocompatibility and resistance to bio-corrosion [19]. Although majority of studies have focused on the advantageous properties of ZrO2 NPs, the adverse biological effects are impossible to be neglected. Therefore, in this study, we used TiO2, as a control group, which is a traditional nanomaterial that showed similar physicochemical properties. We aimed to investigate the effects of TiO2 and ZrO2 NPs on cell viability, oxidative stress, cell morphology, and osteogenic responses of MC3T3-E1 osteoblasts after co-culture and thus to reveal the osteoinductivity of TiO2 and ZrO2 NP treatment.

Materials and Methods

Materials Preparation and Characterization

TiO2 NPs (CAS Number 637262) and ZrO2 NPs (CAS Number 544760) were purchased from Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO, USA) and characterized by transmission electron microscope (TEM, MFP-3D-S, Asylum Research, Santa Barbara, CA, USA), Zeta potential, and dynamic light scattering (DLS) particle size analysis measurements (Zetasizer Nano ZS, Malvern, UK). The NPs were dispersed in alcohol for TEM detection, which could show the morphology and particulate size of NPs more clearly. In addition, the aggregated size of the particles was detected via DLS, where complete culture medium was used to bring into correspondence with particle characters applied in cell culture. Before cell treatment, the stock solution was dispersed by Ultrasonic Cell Disruption System (Ningbo Xinzhi Biotechnology, China) for 30 min accompanied with ice cooling and diluted to different concentrations with complete culture medium prior to cell experiments.

3T3-E1 Cell Culture

3T3-E1 cell line (the Cell Bank of the Shanghai Infrastructure for Public Research and Development of the Chinese Academy of Medical Sciences, Shanghai, China) was cultured in minimum essential medium-alpha (α-MEM, Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum (FBS, Thermo Fisher Scientific, USA) and 1% antibiotic/antimycotic (Thermo Fisher Scientific, USA). Cells were incubated at 37 °C with 5% CO2 in a 95% humidified atmosphere, and the culture medium was replaced every other day.

Cell Proliferation Assay

Cellular viability was detected using the CCK-8 assay (Dojindo Molecular Technologies, Kumamoto city, Japan). Cells were seeded in 96-well plates at 5000 cells per well. TiO2 NPs and ZrO2 NPs were then added to the 96-well plates at serial concentrations of 0, 10, 20, 40, 60, 80, 100, and 150 μg/mL followed by incubation for 24 and 48 h at 37 °C with 5% CO2, accompanied with N-acetyl-l-cysteine (NAC) or not, which were used to inhibit ROS production. The control group was left untreated. Then, the CCK-8 test was conducted by adding 110 μL detection reagents to each well, and the 96-well plates were then incubated for an additional 2 h at 37 °C. To prevent NPs from interfering in this analytical assay, the reagents to be tested in the 96-well plates were transferred to a new 96-well plate after 2 h reaction time; the deposited NPs and cells were left in the primary plate. The optical density (OD) of each well was measured at a single wavelength of 450 nm with the microplate reader (SpectraMax M5, Molecular Devices, Sunnyvale, CA, USA). Each treatment was done in six replicates.

Annexin V Apoptosis Analysis by Flow Cytometry

Cells were cultured in a 12-well plate at a density of 30,000 cells/well for confluency. After TiO2 NP and ZrO2 NP treatment for 48 h, cells were washed with PBS and collected using EDTA free-trypsin buffer. Cells were resuspended with PBS buffer at a concentration of 25,000 cells/mL and centrifuged at 1000×g. Then, cells were stained with FITC Annexin V and PI (Invitrogen™, USA) at room temperature without light exposure. Finally, cells were mixed with 400 μL of binding buffer and analyzed immediately by flow cytometry (BD FACSAria III, BD, Franklin Lakes, NJ, USA).

ROS Generation Analysis

The formation of intracellular ROS was determined using the Reactive Oxygen Species Assay Kit (Beyotime, Shanghai, China). Briefly, after washing with PBS, cells were seeded in a 6-well plate at 20,000 cells/well in 2 mL culture medium and treated with TiO2 NPs and ZrO2 NPs at a concentration of 0, 10, 50, and 100 μg/mL for 48 h, accompanied with NAC or not. After treatment with TiO2 NPs and ZrO2 NPs, cells were collected and incubated with 10 μM DCFH-DA for 30 min at 37 °C and 5% CO2. Fluorescent intensities were analyzed on a BD FACSAria III (BD, Franklin Lakes, NJ, USA).

Confocal Microscopy

Due to a large proportion of cells have turned into apoptosis status, we chose 24 h as the time point to observe the cells’ cytoskeleton structure changes in our study. 3T3-E1 cells were seeded on glass coverslips and cultured in the presence of TiO2 NPs and ZrO2 NPs for 24 h. Cells were washed immediately after the treatment with PBS buffer for three times and fixed with 4% paraformaldehyde, permeabilizated with 0.1% Triton X-100, and blocked with PBS containing 5% BSA. Then, cells were incubated for α-tubulin (Sigma-Aldrich, St. Louis, MO, USA, 1:4000) at 4 °C overnight and loaded with the FITC-bound secondary antibody at 37 °C for 1 h next day after washing with PBS for three times. Consequently, cytoskeleton was stained by rhodamine-phalloidin (Invitrogen, Carlsbad, CA, USA, 1:1000) for 1 h in dark, and the nuclei were stained with Hoechst 33342 (Invitrogen, Carlsbad, CA, USA) for 20 min. Coverslips were examined using a FV10i confocal microscope (Olympus, Tokyo, Japan).

Mineralization Induction Detection

3T3-E1 cells were seeded in a 6-well plate at a density of 15,000 cells/well. The cells were treated with TiO2 NPs and ZrO2 NPs at concentrations of 10 and 100 μg/mL, and the culture medium containing the nanomaterials was replaced every other day; the cells were washed gently via PBS to remove the residual nanomaterials before every culture medium changes. After culturing for 7, 14, and 21 days in the presence of TiO2 NPs and ZrO2 NPs, the cells were stained by alizarin red S. Briefly, cells were fixed with 4% paraformaldehyde at 4 °C for 30 min and stained with alizarin red S solution (40 mM, pH 4.1) at ambient temperature for another 20 min. After washing with distilled water three times, mineralized nodules were observed with a light microscope (Olympus, Japan).

RNA Extraction and RT-PCR

Total RNA was extracted via TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Then, RNA concentration was evaluated using an ultraviolet spectrophotometer. The isolated RNA was reverse transcribed to cDNA using a RT reagent kit (TaKaRa Bio, Dalian, China). Real-time PCR was carried out using SYBR green reagent (TaKaRa Bio, Dalian, China). Osteogenesis-related genes were detected, including runt-related transcription factor 2 (RUNX2), collagen 1α1 (Col1α1), alkaline phosphatase (ALP), osteopontin (OPN), osteocalcin (OC), and bone sialoprotein (BSP). The data were analyzed using the 2−ΔΔCT method. The primers used were listed in Table 1.
Table 1

The primers list for RT-PCR

GeneForward primersReverse primers
β-actin TACAGCTTCACCACCACAGCTCTCCAGGGAGGAAGAGGAT
Runx2 ACAGTCCCAACTTCCTGTGCACGGTAACCACAGTCCCATC
Col1α1 ACGTCCTGGTGAAGTTGGTCTCCAGCAATACCCTGAGGTC
ALP ACAACCTGACTGACCCTTCGTCATGATGTCCGTGGTCAAT
OPN CACCATTCGGATGAGTCTGACCTCAGTCCATAAGCCAAGC
OC GAGGACCCTCTCTCTGCTCAACCTTATTGCCCTCCTGCTT
BSP TGTCCTTCTGAACGGGTTTCTCGTTGCCTGTTTGTTCGTA
The primers list for RT-PCR

Statistical Analysis

The results were represented as the means ± SEM. All data were statistically analyzed by ANOVA test. The homogeneity of variance test was performed, and Bonferroni and Dunnett’s T3 tests were used when the equal variance was assumed and when there was no homogeneity, respectively. p value less than 0.05 was considered statistically significant.

Results

Characterization of the TiO2 and ZrO2 NPs

We first characterized the TiO2 NP and ZrO2 NP powders via transmission electron microscopy (TEM) and dynamic light scattering (DLS) (Fig. 1a, b, Table 2). The TEM and SEM images revealed the particle shapes and sizes. The TiO2 NPs were small rod-shaped spheres with an average size of 25.4 ± 2.8 nm. The ZrO2 NPs were small rod-shaped spheres with an average size of 31.9 ± 1.9 nm. To measure the size of TiO2 NPs and ZrO2 NPs in solution, DLS was used and the particles of TiO2 NPs and ZrO2 NPs expanded to 81.2 nm and 93.1 nm, respectively, which indicated an agglomeration effect. The zeta potentials of TiO2 NPs and ZrO2 NPs were 32.9 ± 5.4 mV and 42.4 ± 7.4 mV, respectively.
Fig. 1

Characterizations of the TiO2 and ZrO2 NPs. TiO2 (a) and ZrO2 (b) NP morphology and size were detected using TEM. (c) The co-culture situation of 3T3 cells and nanomaterials was observed after TiO2 and ZrO2 NP treatment concentrations of 10, 50, and 100 μg/mL. (d) The TEM results were obtained after TiO2 and ZrO2 NP treatment for 1 h

Table 2

Characterization of the TiO2 andZrO2 NPs

NanoparticlesAverage size (nm)DLS (nm)Zeta potential (mV)
TiO225.4 ± 2.881.232.9 ± 5.4
ZrO231.9 ± 1.993.142.4 ± 7.4
Characterizations of the TiO2 and ZrO2 NPs. TiO2 (a) and ZrO2 (b) NP morphology and size were detected using TEM. (c) The co-culture situation of 3T3 cells and nanomaterials was observed after TiO2 and ZrO2 NP treatment concentrations of 10, 50, and 100 μg/mL. (d) The TEM results were obtained after TiO2 and ZrO2 NP treatment for 1 h Characterization of the TiO2 andZrO2 NPs Then, we observed the photograph of 3T3 cells after TiO2 NP and ZrO2 NP exposure at various concentrations. We found that the NPs distributed evenly on the cells or spread around. The NPs showed potent aggregation ability at high concentrations due to a small fraction of NPs with microscale observed, while a great mass of NPs was small with nanoscale and probably translocates into cells which was hard to see (Fig. 1c). Furthermore, TEM results of cells after TiO2 and ZrO2 NP treatment for 1 h have been obtained; our data showed that NPs could be translocated into cellular vesicles. Meanwhile, some organelle damages are also observed, for example, mitochondrial swell and vacuole occurred.

TiO2 and ZrO2 NP-Induced Toxic Effects in 3T3-E1 Cell

We assessed cell viability after TiO2 NP and ZrO2 NP treatment in series concentrations (10, 20, 40, 60, 80, 100, 150 μg/mL). For TiO2 NPs (Fig. 2a), after 24 h of incubation, we found that TiO2 NPs were non-toxic at lower doses (≤ 20 μg/mL), whereas an obvious decrease in cell viability was observed at higher concentrations (> 20 μg/mL) (p < 0.001). More dramatic decrease of cell viability in the 20 μg/mL treatment group was observed after 48 h of incubation; TiO2 NPs at the concentration of 20 μg/mL induced cell viability decrease (p < 0.01). In addition, higher doses of TiO2 NPs (> 20 μg/mL) showed significant decrease of cell viability at 48 h (p < 0.001). However, cell viability remained stable when treated with 10 μg/mL of TiO2 NPs for 48 h. Moreover, for ZrO2 NPs (Fig. 2b), similar results were observed when compared with TiO2 NPs; higher toxic effects were observed at the concentration of 150 μg/mL for 48 h, where cell viability decrease below 50%. These results indicated that TiO2 and ZrO2 NPs were biocompatible at lower doses. However, these two nanomaterials showed slight cytotoxicity at high toxic concentrations.
Fig. 2

TiO2 and ZrO2 NP-induced cell viability decrease in 3T3-E1 cells. 3T3-E1 cells were treated with TiO2 (a) and ZrO2 (b) NPs at concentrations of 0, 10, 20, 40, 60, 80, 100, and 150 μg/mL for 24 and 48 h, and then the cell viability was detected via the CCK-8 assay. Meanwhile, the cell viability changes were detected after NAC treatment, which could eliminate intracellular ROS. The results represent the means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

TiO2 and ZrO2 NP-induced cell viability decrease in 3T3-E1 cells. 3T3-E1 cells were treated with TiO2 (a) and ZrO2 (b) NPs at concentrations of 0, 10, 20, 40, 60, 80, 100, and 150 μg/mL for 24 and 48 h, and then the cell viability was detected via the CCK-8 assay. Meanwhile, the cell viability changes were detected after NAC treatment, which could eliminate intracellular ROS. The results represent the means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

NAC Inhibition Effects on the TiO2 and ZrO2 NPs-Induced Cytotoxicity

We then detected the inhibition effects of NAC which is an ROS scavenging agent. The results showed that NAC potentially inhibited TiO2 (Fig. 2a), and ZrO2 NPs (Fig. 2b) induced cell viability after 24 h and 48 h treatment. After NAC inhibition, cell viability was maintained for 24 h at all concentrations of TiO2 and ZrO2 NP treatment except the highest concentration (150 μg/mL). Although the inhibition effect was slightly decreased in cells treated with high concentrations of TiO2 (100 and 150 μg/mL) and ZrO2 NPs (80, 100 and 150 μg/mL) at 48 h time point, no potent cell viability changes were observed for concentrations below 80 μg/mL, where cell viability was significantly higher than those without NAC.

TiO2 and ZrO2 NPs-Induced ROS Generation in 3T3-E1 Cell

We further detected the ROS generation after TiO2 and ZrO2 NPs exposure in 3T3-E1 cells (Fig. 3). Our results showed that TiO2 and ZrO2 NPs induced ROS generation after 24 h, which was the most significant at the concentration of 100 μg/mL. There was no significant ROS generation for TiO2 NPs at a concentration of 10 μg/mL, while ZrO2 NPs induced potent ROS generation at the same concentration. Meanwhile, NAC could significantly inhibit TiO2 and ZrO2 NP-induced ROS generation in 3T3-E1 cell at all concentrations.
Fig. 3

TiO2 and ZrO2 NP-induced ROS generation in 3T3-E1 cells. 3T3-E1 cells were treated with TiO2 and ZrO2 NPs at various concentrations for 48 h, and NAC (10 mM) was incubated simultaneously, and then the ROS levels in the 3T3-E1 cells were detected. The results represent the means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

TiO2 and ZrO2 NP-induced ROS generation in 3T3-E1 cells. 3T3-E1 cells were treated with TiO2 and ZrO2 NPs at various concentrations for 48 h, and NAC (10 mM) was incubated simultaneously, and then the ROS levels in the 3T3-E1 cells were detected. The results represent the means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

TiO2 and ZrO2 NPs-Induced Apoptosis and Necrosis in 3T3-E1 Cell

Cell apoptosis and necrosis were detected after various concentrations of TiO2 and ZrO2 NP exposure at 48 h (Fig. 4). The red dots located in the third quadrant represented normal cells, while the red dots located in the first quadrant and fourth quadrant represented the early apoptotic cells and late apoptotic or necrotic cells, respectively. Interestingly, our results indicated that TiO2 and ZrO2 NPs could induce apoptosis in concentration- and time-dependent manners. Following the TiO2 NP exposure for 48 h, no significant cell apoptosis was detected at concentrations of 10 μg/mL; however, at concentrations of 50 and 100 μg/mL, the percentage of late apoptotic or necrotic cells reached to high levels. Following the ZrO2 NP exposure for 48 h, we did not find cell apoptosis at the concentration of 10 μg/mL too, but the percentage of late apoptotic or necrotic cells was 43.7% at 50 μg/mL group. Most interestingly, significant early apoptosis was observed (34.1%) at the concentration of 100 μg/mL after 48 h treatment. We found that the early apoptosis levels of TiO2 NPs were significantly higher than ZrO2 NPs; however, the late apoptotic or necrotic levels were in verse.
Fig. 4

TiO2 and ZrO2 NP-induced apoptosis in 3T3-E1 cells. a After the 3T3-E1 cells were treated with the TiO2 and ZrO2 NPs at various concentrations for 48 h, the levels of cell apoptosis were detected. b The apoptotic levels including early apoptosis and late apoptosis levels were calculated, and then the data carried out the statistics. The results represent the means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

TiO2 and ZrO2 NP-induced apoptosis in 3T3-E1 cells. a After the 3T3-E1 cells were treated with the TiO2 and ZrO2 NPs at various concentrations for 48 h, the levels of cell apoptosis were detected. b The apoptotic levels including early apoptosis and late apoptosis levels were calculated, and then the data carried out the statistics. The results represent the means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

TiO2 and ZrO2 NP-Induced Morphological Changes in 3T3-E1 Cells

To study the morphological changes of 3T3-E1 cells after exposure to TiO2 and ZrO2 NPs, we performed fluorescence staining followed by confocal microscopy (Figs. 5 and 6). Compared with untreated control cells, there was no morphological change after 10 μg/mL of TiO2 and ZrO2 NP treatment at 24 h, while cells turned to become round and smaller after 100 μg/mL of TiO2 and ZrO2 NP treatment. Most interestingly, slight cell area decrease was observed after 50 μg/mL of TiO2 and ZrO2 NP treatment, where TiO2 showed more potent cell area decrease. Consistently, quantitative results confirmed a significant decrease in cell area after 100 μg/mL of TiO2 and ZrO2 NP treatment (Fig. 5).
Fig. 5

TiO2 and ZrO2 NP-induced cell area changes in 3T3-E1 cells. After the 3T3-E1 cells were treated with the TiO2 (a) and ZrO2 (b) NPs at concentrations of 10 and 100 μg/mL for 24 h, the cells were loaded with tubulin (green), actin (red), and Hoechst 33342 (blue). The cell morphology was observed based on the alterations of the actin (red) and tubulin systems (green), and the cell area distribution changes were calculated

Fig. 6

TiO2 and ZrO2 NP-induced cytoskeleton changes in 3T3 cells. After the 3T3-E1 cells were treated with the TiO2 (a) and ZrO2 (b) NPs at concentrations of 10 and 100 μg/mL for 24 h, the cytoskeleton changes were assessed based on the alterations of the actin (red) and tubulin systems (green)

TiO2 and ZrO2 NP-induced cell area changes in 3T3-E1 cells. After the 3T3-E1 cells were treated with the TiO2 (a) and ZrO2 (b) NPs at concentrations of 10 and 100 μg/mL for 24 h, the cells were loaded with tubulin (green), actin (red), and Hoechst 33342 (blue). The cell morphology was observed based on the alterations of the actin (red) and tubulin systems (green), and the cell area distribution changes were calculated TiO2 and ZrO2 NP-induced cytoskeleton changes in 3T3 cells. After the 3T3-E1 cells were treated with the TiO2 (a) and ZrO2 (b) NPs at concentrations of 10 and 100 μg/mL for 24 h, the cytoskeleton changes were assessed based on the alterations of the actin (red) and tubulin systems (green) We further studied the cytoskeleton changes in both actin filaments and microtubule levels (Fig. 6). Similarly, no significant difference was shown between control group and 10 μg/mL of TiO2 and ZrO2 NP treatment, and cells in both groups revealed explicit structures of actin filaments and microtubule system. In contrast, 100 μg/mL of ZrO2 NP treatment induced a shrinkage of 3T3-E1 cells, along with a pyknosis-like nuclei and condensed unclear actin filaments and microtubule structures. For TiO2 NPs, so many actin dots were observed, and the actin filaments located at the cell membrane were misty and rough. For ZrO2 NPs, more potent cytoskeleton disruption was detected, and actin and microtubule structure were rough and defective.

TiO2 and ZrO2 NP-Induced Mineralization in 3T3 Cells

Next, we detected the mineralization status of 3T3 cells by alizarin red staining and observed the formation of mineralized nodules under light microscopy (Fig. 7). Cells were stained after osteogenic induction for 7, 14, and 21 days in the presence of various concentrations of TiO2 and ZrO2 NPs. We found that mineralized nodules became visible after 14 and 21 days induction. There was no significant difference on mineralization after 14 and 21 days induction between the control group and TiO2 and ZrO2 NP treatment at 10 μg/mL. However, decrease of mineralization probably was observed after TiO2 and ZrO2 NP treatment at 100 μg/mL, due to the mineralized nodule that got smaller and blurry.
Fig. 7

TiO2 and ZrO2 NP-induced mineralization effects in 3T3 cells. After the 3T3-E1 cells were differentiated using mineralized solution for 7 d, 14 d and 21 d, accompanied with TiO2 (a) and ZrO2 NPs (b) at various concentrations. The alizarin red staining was used to detect the mineralized nodule (black arrow)

TiO2 and ZrO2 NP-induced mineralization effects in 3T3 cells. After the 3T3-E1 cells were differentiated using mineralized solution for 7 d, 14 d and 21 d, accompanied with TiO2 (a) and ZrO2 NPs (b) at various concentrations. The alizarin red staining was used to detect the mineralized nodule (black arrow)

TiO2 and ZrO2 NP-Induced Expression of Osteogenesis-Related Genes in 3T3 Cells

In order to investigate the mechanism of TiO2 and ZrO2 NP-induced osteogenesis in 3T3 cells, we detected the levels of osteogenesis-related genes in 3T3 cells after TiO2 and ZrO2 NP treatment, including genes that preferentially upregulated during the early (Runx2, Col1α1, and Alp) and late (Opn, Ocn, and Bsp) phases of osteogenesis (Fig. 8). We found that 10 μg/mL of TiO2 and ZrO2 NPs induced the highest expression level of Runx2 after 3 days of treatment, while at day 7, Runx decreased to the lowest level after ZrO2 NP treatment at 100 μg/mL. Col1α1 increased after 10 μg/mL of TiO2 and ZrO2 NP treatment both at days 3 and 7, while for cells treated with 100 μg/mL of TiO2 and ZrO2 NPs, Col1α1 first significantly upregulated at day 3 but decreased dramatically after 7 days. We also detected significant decrease of Alp expression after TiO2 and ZrO2 NP treatment at 100 μg/mL for 3 days.
Fig. 8

TiO2 and ZrO2 NP-induced osteogenesis-related genes changes in 3T3 cells. After the 3T3-E1 cells were differentiated using mineralized solution for 3, 7, 14, and 21 d, accompanied with TiO2 and ZrO2 NPs at various concentrations. The osteogenesis-related gene changes were detected using RT-PCR. The results represent the means ± SEM of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control

TiO2 and ZrO2 NP-induced osteogenesis-related genes changes in 3T3 cells. After the 3T3-E1 cells were differentiated using mineralized solution for 3, 7, 14, and 21 d, accompanied with TiO2 and ZrO2 NPs at various concentrations. The osteogenesis-related gene changes were detected using RT-PCR. The results represent the means ± SEM of three independent experiments. *p < 0.05; **p < 0.01; ***p < 0.001, compared with the control For genes upregulated in the late phase of osteogenic induction, the expression levels of Opn, Ocn, and Bsp increased significantly after 10 μg/mL of TiO2 and ZrO2 NP treatment for 14 days, and Opn continuously upregulated to a higher level at day 21. These results suggested that compared with Ocn and Bsp, Opn was a later stage marker of TiO2 and ZrO2 NP-induced osteogenesis. Interestingly, 100 μg/mL of TiO2 and ZrO2 NPs failed to enhance the expression of Opn, Ocn, or Bsp at day 14; moreover, these genes showed significant downregulation at day 21.

Discussion

ZrO2 NPs were important components in refractories, ceramics, and biomedical appliances, including implants, joint endoprostheses, and dental materials. Until now, TiO2 NPs as one of the other NPs with similar physicochemical properties, many studies have focused on its toxicological data. They found that TiO2 NPs could translocate into cells and showed potential cell damage due to different physicochemical characteristics [20, 21]. Meanwhile, the toxicological data for ZrO2 NPs was lacking. In our study, we regarded TiO2 NPs as the control group and explored the toxicological effects of TiO2 and ZrO2 NPs on 3T3-E1 cells. Physicochemical properties of NPs, especially size and morphology, have been known to effectively impact biosafety. Some studies have shown that nanoscaled particles were significantly more toxic than microscaled particles [22, 23]. In most cases, particle morphology was also reported to affect the toxicity [24-26]. In our study, we showed that TiO2 and ZrO2 NPs were rod-shaped spheres. Compared with previous reports [5, 27, 28], our TiO2 and ZrO2 NPs had a relatively weaker agglomeration effect in water where the particles enlarged to 81.2 and 93.1 nm in size, while we also could observe some microscale materials in culture medium after NP exposure with concentration-dependent manner, which confirm the agglomeration effect in this study even after using ultrasonic dispersion technology. However, the agglomeration effect could not inhibit the NP translocation into the cytoplasm, due to potent NPs were detected in intracellular vesicles. Organelles, like mitochondria, probably was one main target. We have detected the viability of 3T3-E1 cells at various concentrations of TiO2 and ZrO2 NP treatment. Our results showed that 10 μg/mL of TiO2 and ZrO2 NPs is a biosafety concentration for 3T3-E1 cells. The cell viability decreased in time- and concentration-dependent manner, which implied that TiO2 and ZrO2 NPs were potentially cytotoxic after longer exposure of higher doses compared with other oxide metal nanoparticles, such as silicon dioxide and ZnO [4, 28, 29]. Moreover, ZrO2 NPs showed more potent toxic effects than TiO2 NPs in our study at high toxic concentrations. Oxidative stress, a byproduct of outpaced ROS generation and decreased antioxidant factors, is known as one crucial factor in nanomaterial-induced cytotoxicity, and it is reported to trigger cell apoptosis through distinct mechanism [30, 31]. Furthermore, Kozelskaya et al. [12] observed that ZrO2 NPs induced the increase of membrane microviscosity, cell morphology changes, and surface cracks on the red blood cells due to the oxidative stress. In agreement with these studies, we detected the ROS levels in 3T3-E1 cells after TiO2 and ZrO2 NP treatment and found that TiO2 and ZrO2 NPs could induce significant ROS generation in concentration-dependent manners, and ZrO2 NPs induced more potent oxidative stress effects. Moreover, the elevated ROS levels could be eliminated by NAC which is a ROS scavenger. These results suggested the important role of ROS in TiO2 and ZrO2 NP-induced cell cytotoxicity. Apoptosis is a type of cell death which clears the senescent and abnormal cells, so as to sustain the cell biological functions [32]. Some studies have reported that apoptosis was one of the main toxic responses after treating with oxide metal nanomaterials, such as TiO2, ZnO, Si, and Ag [33-36]. In our study, we found that TiO2 and ZrO2 NPs could induce apoptotic/necrotic body formation in 3T3-E1 cells in time/concentration-dependent manners, which was correlated with the decreased cell viability shown previously. Moreover, we found that when large parts of late apoptotic or necrotic cells were observed after ZrO2 NP treatment, the cell status for TiO2 NPs largely was early apoptosis. These phenomena applied that ZrO2 NPs induced more rapid and potent apoptosis effects. Similarly, other studies also showed that ZrO2 NPs induced significant apoptotic and necrotic processes in MSTO cells [4, 11]. The cytoskeleton metabolism is a dynamic biological process involving polymerization and depolymerization, which could sustain cell morphology and promote cell function. Some studies have shown that nanomaterials could affect the cell morphology and cytoskeleton system [37-39]. We found 3T3-E1 cells became smaller and rounded in the high-dose group of TiO2 and ZrO2 NPs (100 μg/mL), along with decreased cell area due to cytoskeleton disruptions. These findings were also supported by previous reports that ZrO2 NP treatment could induce cell morphology changes in MSTO cells at higher concentration [4]. Another study showed the disrupted blood cell morphology after ZrO2 NP treatment [12]. Alizarin red staining is a key indicator of osteogenic responses. In our study, no impact on osteogenic induction has been shown by TiO2 and ZrO2 NP treatment (10 μg/mL), except that cells treated with a cytotoxic dose of TiO2 and ZrO2 NPs (100 μg/mL) had a significant decrease of mineralized nodules due to the potential inhibition of osteoinductive properties. In addition, the expression level of osteogenesis-related genes was important biomarkers. Our results showed that lower concentration (10 μg/mL) of TiO2 and ZrO2 NPs promoted the expression of osteogenesis-related genes; however, TiO2 and ZrO2 NPs at high concentrations (100 μg/mL) could significantly inhibit gene expression for both early- and late phases of mineralization, indicating that TiO2 and ZrO2 NPs at high concentrations indeed inhibited osteoinductive properties. Other studies also obtained similar results; they claimed that TiO2 NPs inhibited the osteogenesis of osteoblasts in a size-dependent manner while potentially promoted osteoclastogenic process [33]. Sengstock et al. [40] found that sub-toxic concentrations of Ag NPs and Ag ions could significantly impair the osteogenic differentiation of human mesenchymal stem cells. More ongoing or newly initiated researches are focused on developing nanoparticles with acceptable biosafety and osteogenic potential to promote osseointegration for in vivo application [18, 41].

Conclusion

In conclusion, our data indicated that ZrO2 NPs were nanoparticles with good biocompatibility, just like TiO2 NPs, while they could induce toxic effects at high toxic concentrations on 3T3-E1 cells. ROS played a key role on TiO2 and ZrO2 NP-induced cytotoxicity, including cell viability, apoptosis and necrosis, and changes in cell morphology. Moreover, TiO2 and ZrO2 NPs at high concentrations showed inhibitory effects on osteogenic differentiation of 3T3-E1 cells. Our findings could provide deep insights into the biocompatibility and potential application of ZrO2 NPs.
  40 in total

Review 1.  Manufactured nanoparticles: an overview of their chemistry, interactions and potential environmental implications.

Authors:  Yon Ju-Nam; Jamie R Lead
Journal:  Sci Total Environ       Date:  2008-08-19       Impact factor: 7.963

2.  Short-term evaluation of hepatic toxicity of titanium dioxide nanofiber (TDNF).

Authors:  Leah K Bartel; Daniel A Hunter; Kayla B Anderson; W Yau; Ji Wu; Worlanyo E Gato
Journal:  Drug Chem Toxicol       Date:  2018-04-23       Impact factor: 3.356

3.  Bioactive silica-based nanoparticles stimulate bone-forming osteoblasts, suppress bone-resorbing osteoclasts, and enhance bone mineral density in vivo.

Authors:  George R Beck; Shin-Woo Ha; Corinne E Camalier; Masayoshi Yamaguchi; Yan Li; Jin-Kyu Lee; M Neale Weitzmann
Journal:  Nanomedicine       Date:  2011-11-16       Impact factor: 5.307

Review 4.  Titanium dioxide nanoparticles: a review of current toxicological data.

Authors:  Hongbo Shi; Ruth Magaye; Vincent Castranova; Jinshun Zhao
Journal:  Part Fibre Toxicol       Date:  2013-04-15       Impact factor: 9.400

5.  Engineered nanomaterials cause cytotoxicity and activation on mouse antigen presenting cells.

Authors:  J Palomäki; P Karisola; L Pylkkänen; K Savolainen; H Alenius
Journal:  Toxicology       Date:  2009-11-06       Impact factor: 4.221

6.  Differential toxicity of rod and spherical zinc oxide nanoparticles on human peripheral blood mononuclear cells.

Authors:  Debalina Bhattacharya; Chitta Ranjan Santra; Amar N Ghosh; Parimal Karmakar
Journal:  J Biomed Nanotechnol       Date:  2014-04       Impact factor: 4.099

7.  Screening of in vitro cytotoxicity, antioxidant potential and bioactivity of nano- and micro-ZrO2 and -TiO2 particles.

Authors:  Gopalu Karunakaran; Rangaraj Suriyaprabha; Palanisamy Manivasakan; Rathinam Yuvakkumar; Venkatachalam Rajendran; Narayanasamy Kannan
Journal:  Ecotoxicol Environ Saf       Date:  2013-05-07       Impact factor: 6.291

8.  High-throughput screening platform for engineered nanoparticle-mediated genotoxicity using CometChip technology.

Authors:  Christa Watson; Jing Ge; Joel Cohen; Georgios Pyrgiotakis; Bevin P Engelward; Philip Demokritou
Journal:  ACS Nano       Date:  2014-03-11       Impact factor: 15.881

9.  Comparative toxicity of 24 manufactured nanoparticles in human alveolar epithelial and macrophage cell lines.

Authors:  Sophie Lanone; Françoise Rogerieux; Jorina Geys; Aurélie Dupont; Emmanuelle Maillot-Marechal; Jorge Boczkowski; Ghislaine Lacroix; Peter Hoet
Journal:  Part Fibre Toxicol       Date:  2009-04-30       Impact factor: 9.400

10.  Predictive value of in vitro assays depends on the mechanism of toxicity of metal oxide nanoparticles.

Authors:  Wan-Seob Cho; Rodger Duffin; Mark Bradley; Ian L Megson; William MacNee; Jong Kwon Lee; Jayoung Jeong; Ken Donaldson
Journal:  Part Fibre Toxicol       Date:  2013-10-25       Impact factor: 9.400

View more
  7 in total

1.  Effect of Zirconium oxide nanoparticle on serum level of testosterone and spermatogenesis in the rat: An experimental study.

Authors:  Hengameh Mehdikhani; Heydar Aqababa; Ladan Sadeghi
Journal:  Int J Reprod Biomed       Date:  2020-09-20

2.  Inflammatory responses to metal oxide ceramic nanopowders.

Authors:  Shannon Jamieson; Amy Mawdesley; David Deehan; John Kirby; James Holland; Alison Tyson-Capper
Journal:  Sci Rep       Date:  2021-05-18       Impact factor: 4.379

3.  Potential role of the IL17RC gene in the thoracic ossification of the posterior longitudinal ligament.

Authors:  Peng Wang; Xiaoguang Liu; Chao Kong; Xiao Liu; Ze Teng; Yunlong Ma; Lei Yong; Chen Liang; Guanping He; Shibao Lu
Journal:  Int J Mol Med       Date:  2019-03-12       Impact factor: 4.101

Review 4.  Advancing dental implants: Bioactive and therapeutic modifications of zirconia.

Authors:  Divya Chopra; Anjana Jayasree; Tianqi Guo; Karan Gulati; Sašo Ivanovski
Journal:  Bioact Mater       Date:  2021-11-05

Review 5.  Review on synthesis, properties and multifarious therapeutic applications of nanostructured zirconia in dentistry.

Authors:  Ranjeet A Bapat; Ho Jan Yang; Tanay V Chaubal; Suyog Dharmadhikari; Anshad Mohamed Abdulla; Suraj Arora; Swati Rawal; Prashant Kesharwani
Journal:  RSC Adv       Date:  2022-04-27       Impact factor: 4.036

6.  Zirconium Oxide Thin Films Obtained by Atomic Layer Deposition Technology Abolish the Anti-Osteogenic Effect Resulting from miR-21 Inhibition in the Pre-Osteoblastic MC3T3 Cell Line.

Authors:  Aleksandra Seweryn; Ariadna Pielok; Krystyna Lawniczak-Jablonska; Rafal Pietruszka; Klaudia Marcinkowska; Mateusz Sikora; Bartlomiej S Witkowski; Marek Godlewski; Krzysztof Marycz; Agnieszka Smieszek
Journal:  Int J Nanomedicine       Date:  2020-03-09

7.  Metabolomic profiling of ZrO2 nanoparticles in MC3T3-E1 cells.

Authors:  Mingfu Ye; Linhu Wang; Zhang Wu; Wenjun Liu
Journal:  IET Nanobiotechnol       Date:  2021-08-28       Impact factor: 1.847

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.