The complete mitochondrial genome of Orancistrocerusaterrimusaterrimus and comparative analysis in the family Vespidae (Hymenoptera, Vespidae, Eumeninae).

To date, only one mitochondrial genome (mitogenome) in the Eumeninae has been reported in the world and this is the first report in China. The mitogenome of O.a.aterrimus is 17 972 bp long, and contains 38 genes, including 13 protein coding genes (PCGs), 23 tRNA genes, two rRNA genes, a long non-coding region (NCR), and a control region (CR). The mitogenome has 79.43% A + T content, its 13 PCGs use ATN as the initiation codon except for cox1 using TTG, and nine genes used complete translation termination TAA and four genes have incomplete stop codon T (cox2, cox3, nad4, and cytb). Twenty-two of 23 tRNAs can form the typical cloverleaf secondary structure except for trnS1. The CR is 1 078 bp long with 84.69% A+T content, comprising 28 bp tandem repeat sequences and 13 bp T-strech. There are two gene rearrangements which are an extra trnM2 located between trnQ and nad2 and the trnL2 in the upstream of nad1. Within all rearrangements of these mitogenomes reported in the family Vespidae, the translocation between trnS1 and trnE genes only appears in Vespinae, and the translocation of trnY in Polistinae and Vespinae. The absent codons of 13 PCGs in Polistinae are more than those both in Vespinae and Eumeninae in the family Vespidae. The study reports the complete mitogenome of O.a.aterrimus, compares the characteristics and construct phylogenetic relationships of the mitogenomes in the family Vespidae.

Introduction

Animal mitochondrial genomes (mitogenomes) have been widely used in studies of molecular evolution, population genetic structure, and phylogeny because of their stable gene content, rapid evolutionary rate, relatively conserved gene arrangement, maternal inheritance, and infrequent recombination (Wolstenholme 1992; Saccone et al. 1999; Oliveira et al. 2008; Li et al. 2017). The family has more than 5000 known species worldwide, which are divided into six subfamilies, , , , , , and (Carpenter 1993), but their phylogenetics have not been settled. There have been ten mitogenomes sequences reported in the (seven in the subfamily , three in , and one in ) (Table 1). Among these six subfamilies, there are more than 3600 species in the subfamily worldwide, more than half of the known species of . The species in , also known as potter wasps, are solitary, and mostly catch caterpillars as food for their next generation in the environment of farmlands, forests, and orchards, which can directly control caterpillar pests. To date, there is only one species () with its mitogenome published (Cameron et al. 2008). , the species under study in this work, belongs to the , and is widely distributed in China (Jiangsu, Anhui, Fujian, Jiangxi, Hunan, Guangxi, Chongqing, Sichuan, Yunnan provinces), and Laos, Vietnam (Li 1985; Selis 2018).

Table 1.

The information of mitogenomes used in the phylogenetic analysis in the present study.

Subfamily	Species	Migenome size (bp)	Gene number	GenBank Accession	Reference
Ingroup (Vespidae)
Eumeninae	Orancistrocerus aterrimus aterrimus	17972	38	KY941926	This study
Eumeninae	Abispa ephippium	16953	41	EU302588	Cameron et al. (2008)
Polistinae	Polistes jokahamae	16616	34	KR052468	Song et al. (2016)
Polistinae	Polistes humilis synoecus	14741	34	EU024653	Cameron et al. (2008)
Polistinae	Parapolybia crocea	16619	37	KY679828	Peng et al. (2017)
Vespinae	Vespula germanica	16342	33	KR703583	Zhou et al. (2016)
Vespinae	Vespa ducalis	15779	37	KX950825	Kim et al. (2017a)
Vespinae	Vespa mandarinia	15902	37	KR059904	Chen et al. (2015)
Vespinae	Vespa bicolor	16937	35	KJ735511	Wei et al. (2014)
Vespinae	Vespa velutina nigrithorax	16475	37	KY091645	Kim et al. (2017b)
Vespinae	Vespa orientalis	16101	37	KY563657	Nizar et al (2017)
Vespinae	Dolichovespula panda	17137	37	KY293679	Fan et al (2017)
Outgroup (Formicidae)
Formicinae	Formica selysi	16752	37	KP670862	Yang et al. (2015)

In the present study, the complete mitogenome of was sequenced using Illumina sequencing technique, and its characteristics analyzed, including gene rearrangements, nucleotide composition, codon usage, etc. More importantly, the phylogenetic relationships of 12 species of mitogenomes in are constructed and discussed based on nucleotide sequences of 13 PCGs using both Maximum Likelihood (ML) and Bayesian Inference (BI) methods. The study updates phylogenetic research based on the mitogenomes, and provides basic information framework of mitogenomes in for further research on the phylogenetic relationships of both genera and subfamilies in this family.

Materials and methods

Sample collection and DNA preparation

The specimens of were collected from Yangshuo county of Guangxi province, preserved in the 100% ethanol, and stored at -20 °C. Total DNA of a single adult specimen was extracted from the muscle tissues using the DNeasy DNA Extraction Kit (QIAGEN) in accordance with the manufacturer’s instructions. The concentration of genomic DNA in extraction product was assayed on a Qubit fluorometer using a dsDNA High-sensitivity Kit (Invitrogen).

Mitogenomes sequencing and assembling

The Illumina TruSeq library was constructed from the gDNA with the average length of the inserted fragment of 480 bp. The library was sequenced on a full run of Illumina Hiseq 2500 with 500 cycles and paired-end sequencing (250 bp reads). High-quality reads were used in de novo assembly with IDBA-UD after removing adapters, unpaired, short and low quality reads (Peng et al. 2012). With IDBA-UD, these parameters have a similarity threshold of 98% and minimum and maximum k values of 80 and 240 bp, respectively. To identify the mitogenome assemblies from the pooled sequencing files, two different fragments of mtDNA (cox1 and rrnS) were amplified as bait sequences by standard PCR reactions using primers designed with reference of Simon et al. (2006). Using BLASTN search against the reference of bait sequences, matching rate of 100% was confirmed as the mitogenome of . The identical or near-identical overlapping terminal regions of mitogenome sequences were examined and circularized by Geneious (http://www.geneious.com/).

Sequence annotations and analysis

PCGs and rRNA genes were aligned with other published insect mitogenomes by Clustal X (Thompson et al. 1997). The majority of the tRNA gene locations and secondary structures were identified by tRNAscan-SE Search Server v.1.21 (Lowe and Eddy 1997), and the remaining tRNA were identified in comparison with other known species of tRNAs in (Cameron et al. 2008; Song et al. 2016). The CRPageBreakand the tandem repeat sequence were analyzed with Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.html) (Benson 1999). Base composition and codon usage in all 12 mitogenomes of were calculated by MEGA v 6. 0 (Tamura et al. 2013). In addition, the AT skew = [A - T] / [A + T] and GC skew = [G - C] / [G + C] were computed (Perna and Kocher 1995).

Phylogenetic analysis

Eleven known mitogenome sequences in the family and the mitogenome sequence of (KP670862) in the family were downloaded from GeneBank, and that of was produced in the present study (Table 1). The phylogenetic tree of 12 mitogenomes sequences in the family was constructed using ML and BI methods with MEGA 6.0 (Tamura et al. 2013) and MrBayes 3.1.1 (Huelsenbeck and Ronquist 2001), and the (KP670862) was used as outgroup. The nucleotide sequences of 13 PCGs were applied in the phylogenetic inference, and the best fitting substitution model was detected using Mrmodeltest 2.3 (Nylander 2004). The bootstrap values were calculated based on 1000 replications, and the confidence values of the topology is high.

Results and discussion

Genomic organization

The complete mitogenome of is a double-strand of circular molecular DNA and 17,972 bp. It contains 38 genes: 13 PCGs, 23 tRNAs, two rRNAs, a control region (CR), and a long non-coding region (NCR) (Figure 1), of which 24 genes are situated in the majority strand (J-strand) and the other 14 genes are located in the minority strand (N-strand) (Table 2). An extra trnM2 and a long NCR were found in the mitogenome. The gene trnM2 is 67 bp and located in 2 142-2 208 between trnQ and nad2. The NCR is 1 946 bp long, located in 128-2 073 between trnM1 and trnQ. With the exception of the NCR (1 946 bp), 14 intergenic spacers exist and sum to 174 bp, of which the longest spacer is 48 bp long, located between nad4l and trnT. In addition, a total of 24 bp overlaps was identified in 12 genes, with the overlap length of each gene ranging from 1 to 8 bp.

Figure 1.

The mitochondrial genome of . Arrows indicate the direction of genes. Abbreviations of the gene name are as follows: nad1-4 and nad4L act as nicotinamide adenine dinucleotide hydrogen dehydrogenase subunits 1-6 and 4L; cox1, cox2, and cox3 act as the cytochrome C oxidase subunits; cytb act as cytochrome b; atp8 and atp6 act as adenosine triphosphate synthase subunits 6 and 8; rrnL and rrnS act as large and small rRNA subunits; In addition, indicates control region and NCR indicates non-coding region.

Table 2.

Mitochondrial genome annotation of .

Gene	Direction	Location	Size (bp)	Anticodon	Codon		Intergenic nucleotides
					Start	Stop
trnI	F	1–63	63	30–32 GAT
trnM1	F	63–127	65	93–95 CAT			-1
non-coding region							1946
trnQ	R	2074–2138	65	2108–2110 TTG			0
trnM2	F	2142–2208	67	2173–2175 CAT			3
nad2	F	2209–3234	1026		ATC	TAA	0
trnW	F	3249–3315	67	3280–3282 TCA			14
trnC	R	3308–3374	67	3342–3344 GCA			-8
trnY	R	3383–3447	65	3416–3418 GTA			8
cox1	F	3446–4981	1536		TTG	TAA	-2
trn L1	F	5006–5073	68	5035–5037 TAA			24
cox2	F	5074–5752	679		ATC	T-	0
trnK	F	5753–5824	72	5785–5787 CTT			0
trnD	F	5824–5893	70	5858–5860 GTC			-1
atp8	F	5894–6049	156		ATC	TAA	0
atp6	F	6049–6720	672		ATG	TAA	-1
cox3	F	6742–7525	784		ATG	T-	21
trnG	F	7526–7593	68	7556–7558 TCC			0
nad3	F	7594–7947	354		ATT	TAA	0
trnA	F	7947–8011	65	7977–7979 TGC			-1
trnR	F	8011–8074	64	8038–8040 TCG			-1
trnN	F	8078–8147	70	8108–8110 GTT			3
trn S1	F	8147–8206	60	8168–8170TCT			-1
trnE	F	8214–8277	64	8244–8246 TTC			7
trnF	R	8277–8342	66	8307–8309 GAA			-1
nad5	R	8344–10032	1689		ATT	TAA	1
trnH	R	10033–10096	64	10065–10067 GTG			0
nad4	R	10097–11402	1306		ATA	T-	0
nad4l	R	11399–11677	279		ATT	TAA	-4
trnT	F	11726–11789	64	11756–11758 TGT			48
trnP	R	11789–11858	70	11823–11825 TGG			-1
nad6	F	11860–12399	540		ATG	TAA	1
cytb	F	12403–13534	1132		ATG	T-	3
trnS2	F	13544–13612	69	13572–13574 TGA			9
trnL2	R	13640–13707	68	13676–13678 TAG			27
nad1	R	13708–14676	969		ATA	TAA	0
rrnL	R	14682–16044	1363				5
trnV	R	16043–16106	64	16074–16076 TAC			-2
rrnS	R	16107–16894	788				0
Control region		16895–17972	1078				0

Gene rearrangements

The gene order of 13 PCGs and two rRNAs in mitogenome is consistent with the putative hymenopteran ancestor: the sawfly (: : :) (Castro and Dowton 2005). However, there are two rearrangePageBreakments of tRNAs in the mitogenome (Figure 2), namely, an extra trnM2 and trnL2 in the upstream of nad1, contributing to the novel gene order: trnL2 - nad1 - rrnL - trnV - rrnS - (Figure 2). In the mitogenome of , another species in the subfamily , the gene order of rearrangements is trnL2 - trnM1 - trnQ - trnM2 - trnI, trnL1 - trnL1 - trnL1 - trnL1 and trnS2 - nad1 (Figure 2) (Cameron et al. 2008). In the subfamily , the translocation between nad1 and trnL1 is present in three reported species. In addition, the translocation of trnY in occurs, trnQ, trnM and trnY genes are lost in mitogenome, and in mitogenome, not only trnD is in the upstream of trnK but also trnI, trnQ and trnY are missing (Figure 2) (Cameron et al. 2008; Song et al. 2016; Peng et al. 2017). In the subfamily , except for the incomplete mitogenomes of and , there is the PageBreaksame rearrangements in other four reported species, such as the translocation of trnY, the translocation between trnQ and trnM genes, between trnS1 and trnE genes, and between nad1 and trnL2 genes, respectively and is different from other four species: the translocation between trnS1 and trnE genes in exchange PageBreakfor shuffling of trnN and trnE (Figure 2) (Chen et al. 2016; Fan et al. 2017; Kim et al. 2017a; Kim et al. 2017b; Nizar et al. 2017). In general, the rearrangement frequency in is lower than those of both and . The rearrangement of tRNAs is a typical event in the mitogenomes of (Dowton and Austin 1999; Dowton et al. 2009; Chen et al. 2016).

Figure 2.

Mitochondrial gene arrangement of 12 species of . The red fonts indicate the rearrangement of the genes.

Nucleotide composition

To date, the nucleotide compositions of ten complete mitogenomes have been reported in the family . In the subfamily , the overall A + T content of and mitogenomes is 79.43% and 80.61%, respectively (Table 3). Among all mitogenomes, there are no significant differences of the A + T content of , i.e., being 84.73%, 83.41%, and 82.94%, respectively. In the subfamily , there are a little differences of the A + T content from 79.39% to being 84.61%. Generally speaking, the A + T content of is lower than those of both and . According to these different regions of mitogenome, the A + T content of 13 PCGs is 78.27% near to (78.67%). In tRNAs, rRNAs, and CR, the A + T content is 83.41%, 84.29% and 84.69%, respectively. From the A + T content of all known complete mitogenomes (Table 3), a universal feature is presumed that A + T content of tRNAs and rRNAs higher than that of PCGs.

Table 3.

Nucleotide composition of different regions in all complete mitogenomes.

Species	Regions	Size(bp)	A%	T%	G%	C%	(A+T)%	AT-skew	GC-skew
Orancistrocerus aterrimus aterrimus	Whole genome	17972	39.53	39.9	8.06	12.51	79.43	-0.005	-0.216
	Protein coding genes	11122	33.15	45.12	10.02	11.72	78.27	-0.153	-0.078
	tRNA genes	1525	42.69	40.72	9.25	7.34	83.41	0.024	0.115
	rRNA genes	2151	41.89	42.4	10.79	4.93	84.29	-0.006	0.373
	Control region	1078	39.8	44.9	6.49	8.81	84.69	-0.06	-0.152
Abispa ephippium	Whole genome	16953	39.55	41.05	6.02	13.38	80.61	-0.019	-0.38
	Protein coding genes	11305	35.2	43.48	10.12	11.21	78.67	-0.105	-0.051
	tRNA genes	1787	44.66	38.84	8.95	7.55	83.49	0.07	0.085
	rRNA genes	2180	43.62	38.35	5.14	12.89	81.97	0.064	0.43
	Control region	308	43.83	46.1	1.3	8.77	89.94	-0.025	-0.742
Polistes jokahamae	Whole genome	16616	41.97	41.45	5.8	10.79	83.41	0.006	-0.301
	Protein coding genes	10852	36.77	46.61	8.11	8.51	83.38	-0.118	-0.024
	tRNA genes	1318	44.76	42.64	6.98	5.61	87.4	0.024	0.108
	rRNA genes	2257	43.95	41.25	4.3	10.5	85.2	0.032	0.419
	Control region	1096	39.05	46.53	6.84	7.57	85.58	-0.087	-0.051
Polistes humilis	Whole genome	14741	43.09	41.65	5.32	9.95	84.73	0.017	-0.303
	Protein coding genes	10852	36.77	46.61	8.11	8.51	83.38	-0.118	-0.024
	tRNA genes	1258	47.22	41.02	6.52	5.25	88.24	0.07	0.108
	rRNA genes	1932	43.27	43.22	9.16	4.35	86.49	0.001	0.356
	Control region	*	*	*	*	*	*	*	*
Parapolybia crocea	Whole genome	16619	43.39	39.55	5.91	11.15	82.94	0.046	-0.307
	Protein coding genes	11022	35.48	45.16	9.54	9.82	80.65	-0.12	-0.015
	tRNA genes	1486	44.01	42.13	7.67	6.19	86.14	0.022	0.107
	rRNA genes	2176	40.3	45.96	9.38	4.37	86.26	-0.066	0.365
	Control region	1316	42.25	46.05	5.17	6.53	88.3	-0.043	-0.117
Vespa ducalis	Whole genome	15779	40.32	39.8	5.8	14.08	80.12	0.006	-0.417
	Protein coding genes	11159	34.32	43.46	10.36	11.86	77.78	-0.118	-0.067
	tRNA genes	1487	45.46	40.15	8.14	6.25	85.61	0.062	0.131
	rRNA genes	2299	44.58	39.58	11.44	4.39	84.17	0.059	0.445
	Control region	166	46.99	45.78	0	7.23	92.77	0.013	-1
Vespa mandarinia	Whole genome	15902	38.88	40.51	6.07	14.53	79.39	-0.021	-0.41
	Protein coding genes	11119	33.73	43.37	10.56	12.35	77.09	-0.125	-0.078
	tRNA genes	1505	45.12	40.47	8.37	6.05	85.58	0.054	0.161
	rRNA genes	1569	43.91	39.64	12.11	4.33	83.56	0.051	0.473
	Control region	200	49	39.5	0.5	11	88.5	0.107	-0.913
Vespa velutina nigrithorax	Whole genome	16475	40.3	41.44	5.43	12.83	81.74	-0.014	-0.406
	Protein coding genes	11197	34.99	44.75	9.42	10.83	79.74	-0.122	-0.07
	tRNA genes	1514	44.58	41.35	8.12	5.94	85.93	0.038	0.155
	rRNA genes	2319	45.11	40.06	10.52	4.31	85.17	0.059	0.419
	Control region	132	50.76	41.67	0	7.58	92.42	0.098	-1
Vespa orientalis	Whole genome	16101	40.65	40.3	5.86	13.19	80.95	0.004	-0.384
	Protein coding genes	10653	34.5	44.08	9.74	11.68	78.58	-0.122	-0.09
	tRNA genes	1481	45.51	40.51	7.97	6.01	86.02	0.058	0.14
	rRNA genes	2079	43.67	39.15	11.5	5.68	82.83	0.055	0.339
	Control region	60	48.33	41.67	8.33	1.67	90	0.074	0.667
Dolichovespula panda	Whole genome	17136	42.8	41.81	5.39	10	84.61	0.012	-0.3
	Protein coding genes	11276	35.82	46.78	8.78	8.62	82.6	-0.133	0.009
	tRNA genes	1506	45.88	40.44	7.9	5.78	86.32	0.063	0.155
	rRNA genes	2126	43.7	40.87	10.68	4.75	84.57	0.033	0.384
	Control region	586	67.24	32.42	0	0.34	99.66	0.349	-1

* (EU024653), not sequenced for the control region

Two other parameters, AT-skew and GC-skew, have been widely used to measure the nucleotide compositional behaviors of mitogenome in addition to the A + T content (Enrico et al. 2011). The AT skew of mitogenome is -0.005 near to 0, and the GC skew (-0.216) is negative. The base composition bias plays an important role in researching the mechanism of replication and transcription of mitogenomes (Wei et al. 2010).

Among the PCGs of 12 species (containing two incomplete mitogenomes), the A + T content of cox1 is the lowest in 13 PCGs, ranging from 70.18% () to 75.29% () (Figure 3). The A + T content of atp8, nad2, and nad4L is highest (Figure 3). This result ascertains cox1 is conserved relatively again, which is the reason for former abundant phylogenetic analysis in other insects (Rivera and Currie 2009; Santos et al. 2015). In addition, it is a common phenomenon that T content is more than A, and C content is slightly more than G (Figure 3).

Figure 3.

Nucleotide composition of all 13 PCGs of eleven species of .

Protein coding genes

In the 13 PCGs of the mitogenome, nine PCGs are encoded in the J-strand, and the other four PCGs are located in the N-strand. The total length of PCGs is 11 122 bp. All PCGs use the conventional start codons ATN except for cox1 using TTG which was also employed as the initiation codon in other insects (Sheffield et al. 2008; Li et al. 2012a). The termination codons of nine PCGs in mitogenome use complete TAA (nad2, cox1, atp8, atp6, nad3, nad5, nad4l, nad6 and nad1), and other four genes have incomplete stop codons T (cox2, cox3, nad4 and cytb). In general, the termination codons of insect mitogenomes PCGs were the TAA or incomplete T (Ojala et al. 1981; Li et al. 2012a).

There is a total of 3697 codons in mitogenome, excluding termination codons, which is within the range of the common insect mitogenomes codon number (3585-3746) (Cha et al. 2007). According to the relative synonymous codon usage (RSCU), all of these 12 species frequently used UUU, UUA, AUU and AUA (Figure 4), leading to the high A + T content in the PCGs of the family mitogenomes. CUG is absent in mitogenome and CGC and AGC are absent in . Some codons are also lacking in other species of . For example, CGC and AGC in , CUG, GCG, CGC in and CCG, ACC, ACG, GCG, UGC, and CGC in are absent, respectively. There are several codons missing in , namely, CUG, GUC, ACG, GCG, CGC, CGG, AGC; and CUG, GUC, GCG, CGC, and GGC are also lacked in (Figure 4). Thus, the amount of absent codons in and is more than in .

Figure 4.

Relative synonymous codon usage (RSCU) in . Codon families are displayed along the x-axis.

Transfer RNA and ribosomal RNA genes

There are 23 tRNAs found in mitogenome and their lengths range from 60 bp (trnS1) to 72 bp (trnK) including an extra trnM2, whereas usually there PageBreakPageBreakPageBreakare 22 tRNAs in other insects (Boore 1999; Chen et al. 2015). Among 23 anticodons of these tRNAs, 21 are coincident with the majority of insects mitogenomes (Lee et al. 2008; Hua et al. 2016), but trnI and trnS1 change from CCT to GAT, and GCT to TCT, respectively. Except for trnS1, the other 22 tRNAs have the capability of folding into typical clover-leaf secondary structures. The secondary structure of trnS1 lacks the dihydrouridine DHU arm and reduces its shape to a simple loop (Figure 5), which is a common phenomenon in metazoan mitogenomes (Wolstenholme 1992; Li et al. 2012b). There are 20 mismatches in 13 tRNAs, including 18 unmatched GU base pairs, an unmatched AG, and an unmatched UU (Figure 5).

Figure 5.

Secondary structures of 23 tRNAs of mitochondrial genome. Watson-Crick bonds are showed by dashes, GU pairs by filled dots, and AG and UU by open dots.

The length of rrnL is 1 363 bp long, located between nad1 and trnV, and rrnS 788 bp long in minority strand between trnV and CR. The A + T content of two genes is 84.29% (rrnL and rrnS) (Table 3).

A control region and a non-coding region

The CR plays an important role in regulating of replication and transcription of mitogenomes (Taanman 1999; Saito et al. 2005). The CR of mitogenome is 1078 bp long, located between rrnS and trnI. The A + T content of this region (84.69%) is higher than other region of the mitogenome. There is a tandem repeat model of 28 bp (TATTCCATTTAAGTTCGTAAAAACTAAT) which occurs more than eight times in the mitogenome. Tandem repeat structures in the CR are different in different species (Peng et al. 2017). There is also a poly-T stretch of 13 bp, which may be as recognition site for the initiation of replication in the mitogenomes (Andrews et al. 1999). In the mitogenome, a NCR is situated in position 128 - 2 073 (1 946 bp) between trnM1 and trnQ, which is reported in most insect mitogenomes (Saito et al. 2005; Cameron et al. 2008; Jiang et al. 2016). The A + T content of NCR is 73.69%, among which there is 97 bp (close to trnQ gene) with obviously high A + T content 90.72%. In addition, two tandem repetitive sequences are found in the NCR, which repeated 17 and 18 times, respectively.

Phylogenetic relationships

The best fitting model GTR + G + I was selected for ML analysis. The phylogeny of mitogenomes in was constructed based on the nucleotide sequences of 13 PCGs of 13 species using ML and BI methods (Figure 6). The phylogenetic relationships between 12 species in the family are ((((( + ) + ) + ( + )) + + ) + (+ ( + ))) + ( + ) (Figure 6). and belong to the subfamily , which is concordant with morphological classification. In the present PageBreakstudy, is the sister group with ( + ), which is different from morphological classification “( + (Stenogastriinae + ( + ))) ” (Carpenter 1982, 2003). So far, there is no reported mitogenome in the subfamily Stenogastriinae, so the relationships among the four subfamilies PageBreak, Stenogastriinae, and based on mitogenomes need to be further explored in our follow-up studies.

Figure 6.

The phylogenetic relationships were established by the 13 PCGs using ML (A) and BI (B) methods. Numbers abutting branches were bootstrap percentages with 1000 replicates (A) and Bayesian posterior probabilities (B). Red pentagram refers to the mitogenome sequences of .

Conclusions

According to nine complete mitogenomes reported in the family , gene numbers of two species (38 and 41 genes) of the subfamily are more than those of the other seven species (34 - 37 genes) of both and . The rearrangements of tRNAs are common in , but rearrangement rules are different in different subfamilies. The translocation between trnS1 and trnE only happens in the subfamily , and there are the same rearrangements in these four complete mitogenomes of , , , and . The translocation of trnY occurs in both and , whereas trnY location in is consistent with that of the sawfly . The number of absent codons in is less than and . The phylogenic results of mitogenomes show that and belong to and ( + ) and constitute a sister group. Lastly, these results of this study might suggest that derived earlier than both and , which is consistent with reported research based on morphology.