Literature DB >> 30349384

Severe toxicity to capecitabine due to a new variant at a donor splicing site in the dihydropyrimidine dehydrogenase (DPYD) gene.

Xandra García-González1, Sara López-Tarruella2, María Isabel García1, Eva González-Haba1, Carolina Blanco1, Sara Salvador-Martin1, Yolanda Jerez2, Fabienne Thomas3, María Jarama1, María Sanjurjo Sáez1, Miguel Martín2, Luis Andrés López-Fernández1.   

Abstract

Severe, life-threatening adverse reactions to capecitabine sometimes occur in the treatment of solid tumors. Screening for dihydropyrimidine dehydrogenase (DPYD) deficiency is encouraged before start of treatment, but the genetic variants that are commonly analyzed often fail to explain toxicities seen in clinical practice. Here we describe the case of a 79-year-old Caucasian female with breast cancer who presented with life-threatening, rapidly increasing toxicity after 1 week of treatment with capecitabine and for whom routine genetic DPYD test resulted negative. DPYD exon sequencing found variant c.2242+1G>T at the donor splicing site of exon 19. This variant is responsible for skipping of exon 19 and subsequent generation of a non-functional DPYD enzyme. This variant has not been described previously but was found in three other members of the patient's family. With this case, we show that exon sequencing of DPYD in patients who experience marked toxicity to fluoropyrimidines and test negative for commonly evaluated variants can prove extremely useful for identifying new genetic variants and better explain adverse reactions causality.

Entities:  

Keywords:  adverse drug reaction; breast cancer; fluoropyrimidine; pharmacogenetics

Year:  2018        PMID: 30349384      PMCID: PMC6190816          DOI: 10.2147/CMAR.S174470

Source DB:  PubMed          Journal:  Cancer Manag Res        ISSN: 1179-1322            Impact factor:   3.989


Introduction

Capecitabine is an oral prodrug of 5-fluorouracil (5-FU) that is rapidly and extensively absorbed in the intestine before conversion to 5-FU.1 Severe, life-threatening, and even fatal toxicity has been associated with deficient dihydropyrimidine dehydrogenase (DPYD) activity in patients receiving fluoropyrimidine-based chemotherapy at standard doses.2 Capecitabine-induced adverse reactions include severe hand-foot syndrome, gastrointestinal toxicity, hematological toxicity, and cardiotoxicity.3,4 Low DPYD activity is partly explained by genetic variability in the DPYD gene, which is highly polymorphic.5,6 However, only a few variants (ie, rs3918290 [DPYD*2A], rs55886062 [DPYD*13], and rs67376798) have been clearly associated with severe toxicity to fluoropyrimidines. In our hospital, genotyping of these three variants is available on request for patients starting fluoropyrimidine therapy and has proved to be cost-effective.7 Nonetheless, this test enables us to avoid only 10%–15% of capecitabine-related severe adverse reactions, thus strongly suggesting that other genetic variants in DPYD or in other genes might also be implicated.8 DPYD phenotyping based on the measurement of the enzyme activity in peripheral blood mononuclear cells is another proposed approach to minimize life-threatening toxicity.9 It is yet to be discerned which of these approaches offers the better predictive value and is the most cost-effective to implement or whether a combination of both would be the preferred choice.

Case report

A 79-year-old Caucasian woman was diagnosed with poorly differentiated carcinoma that appeared to have originated in breast tissue. She underwent a second-line chemotherapy based on capecitabine (2 weeks on and 1 week off, total dose of 2,600 mg/day in days 1–14). After 8 days of treatment, she visited the emergency room with progressive asthenia, grade 1 diarrhea, and grade 1 mucositis and was discharged after parenteral fluid support and intensive treatment with loperamide. Capecitabine was discontinued after 48 hours (cumulative dose 26 g) owing to rapidly increasing toxicity despite oral rehydration and a standard dose of loperamide. The main symptoms were diarrhea (grade 2), nausea (grade 2), odynophagia (grade 2), severe solid dysphagia, painful mucositis (grade 3), and progressive asthenia (grade 2) associated with low-grade fever. She was admitted to hospital immediately for close monitoring with intensive fluid and nutritional support, broad-spectrum antibiotics (piperacillintazobactam, vancomycin, and fluconazole), and pain relievers. Both hematological toxicity (grade 4 neutropenia and grade 2 thrombocytopenia) and non-hematological toxicity (grade 1 palmar-plantar erythrodysesthesia, grade 2 diarrhea, and grade 3 mucositis) worsened rapidly. Her white blood cell count dropped, reaching a zero nadir at day +16 and remaining unchanged for over 6 days despite treatment with granulocyte colony-stimulating factor. The patient also developed anemia requiring erythrocyte and platelet transfusions. Her platelet nadir started to recover slowly at day +17. Besides support with blood derivatives, she required third-step analgesia with strong opioids (morphine infusion pump) and intensive nutritional support with parenteral nutrition. The consequences of the severe mucositis and diarrhea resulted in low blood levels of potassium, calcium, phosphate, magnesium, and protein, with significant weight loss (up to 5 kg). In addition, the international normalized ratio was increased, with normal liver transaminases. Hand-foot syndrome progressed more slowly during hospitalization, with progressive, painful swelling and numbness on the palms and soles (up to grade 2), together with progressive alopecia that started 20 days after the withdrawal of capecitabine and lasted for more than 3 months. After 23 days in hospital, the patient was discharged with oral nutritional supplements that were necessary for over 2 months until she could tolerate a normal diet. DPYD deficiency was suspected as a potential explanation for the life-threatening toxicity that developed after such a short interval of exposure to fluoropyrimidine, in the absence of liver or renal dysfunction and other potential drug interactions. The patient did not receive treatment with fluoropyrimidines again. After two further chemotherapy lines, first cyclophosphamide+ zolendronic acid and later vinorrelbine, the patient died due to disease progression. A routine genetic DPYD test was carried out in our hospital because of the strong suspicion of DPYD deficiency. The three DPYD single-nucleotide polymorphisms (SNPs) were genotyped according to the recommendations of the Clinical Pharmacogenetics Implementation Consortium at the time.10 The SNPs were genotyped using real-time PCR and TaqMan probes. None of the three variants were detected. However, the presence of a DPYD deficit continued to be suspected. Therefore, after receiving written informed consent, we performed complete sequencing of the 23 DPYD exons. A total of 23 pairs of oligonucleotides (Table 1) were used to amplify and sequence DPYD exons. We identified two variants in DPYD exons, c.1601G>A (rs1801158, p.Ser534Asn, DPYD*4) and a previously unreported splice site mutation at position 2242+1G>T, after the end of exon 19 (Figure 1). This variant was most probably affecting splicing as confirmed using Human Splicing Finder v3.1.11
Table 1

List of primers used for DPYD exon sequencing

Exon numberForwardReverseFragment size
EXON 1ACTTGGCTCTCTGGCTGGAGCTTAAACTTTCCCGCGTCTCTCACTC234
EXON 2TTAGCCAGGTGTGGTAGCGTACTGCCTTACAATGTGTGGAGTG410
EXON 3TGAGACTTCTGTGACAGCTGTACCTCAAGGGAAGTCTCTCCAC442
EXON 4GGAGTGCCAAAGATGAAACACATGGATTTGCTAAGACAAGCTG362
EXON 5TCCTATGTGTCAAATACTCTGCTTGGGTATCAACAGAGCACCA444
EXON 6AGGAGGCATGACTCTAGAAAGGCCATTAAAAGAAATATTCACAGGGCT719
EXON 7AGAATGTAGATGTCCTCATGCATGCATGACATTTGCTGTTAATC331
EXON 8AGCCCTTAATAGAACATGTTCCTTGAAGGCAGTCATTCTTCTGG374
EXON 9TGCTTACAGATGTTTTCCTCTACAATGTGCTGCTGAGCTTG324
EXON 10TGGAAAACTGCAAGATGCAAAGCCCTTGAGTATTGACAAAG312
EXON 11TGGTGAAAGAAAAAGCTGCATGTTCTTTTCAATACTTGCCACT548
EXON 12TGTGTTGTTAACTCCAATATTTCGTTCAAGCATCCTCCCGCTT621
EXON 13TTCGGATGCTGTGTTGAAGTAATGTGTAATGATAGGTCTTGTCAAA443
EXON 14GCTTTTCTTTGTCAAAAGGAGACAGCTTCACATTGTGTGGGTT409
EXON 15TAATTCCAAAGCCCCAAATGTTTCTCATGGCAGCTCTTTATTT346
EXON 16TCAACGGTGAAAGCCTATTGAGCTTCCCTCATTTTCCACT318
EXON 17TTTGTCTTGCACGTCTCCAGAGGATCTTGTGTTTCCAGATCA437
EXON 18TGAGAAAGTAAAGTTGTGGTAATTGGGATCATAAAGGGCACAAA423
EXON 19TCCAGTGACGCTGTCATCAACAGGACAGGAAATAAACCTCA434
EXON 20AGACGGCTACTGATCCATCATCTGAAATAGAAACCAAGGCTGA375
EXON 21CCCATTTTTCTCTTCTCTGAGCATGCATGCTTGCCAGTGT423
EXON 22TCTTTCAGAAGACAAACATCTAAGCCAGAAAATGCTTTCTGCCGTA402
EXON 23ACGCTAAAATGGGGACATTGACATAAGACAACTGGCAGTG517
EXON SKIPPINGTTAAAATCTGATGGCACACCTTGTGCTTTTCAGATAAAGCAGGGCT
Figure 1

Sequence electropherogram of the 2242+1G>T variant. Blue, dCTP; green, dATP; black, dGTP; red, dTTP.

Abbreviations: dATP, deoxyadenosine triphosphate; dCTP, deoxycytidine triphosphate; dGTP, deoxyguanosine triphosphate; DPYD, dihydropyrimidine dehydrogenase; dTTP, deoxythymidine triphosphate.

The effect of this second SNP on the donor splicing site was analyzed. RNA was isolated from peripheral blood mononuclear cells and processed to cDNA. A cDNA fragment from exon 18–20 was amplified using specific primers (forward [5′-TTAAAATCTGATGGCACACCTTG] and reverse [5′-TGCTTTTCAGATAAAGCAGGGCT]). PCR product sizes were estimated using electrophoresis. Sequencing of PCR products revealed skipping of exon 19 of DPYD in the patient’s mRNA (Figure 2). DPYD generated a truncated protein of 795 amino acids lacking the correct sequence from 767 to the end (1025) (Figure 3). This region is considered essential for the functionality of the protein because it is part of the pyrimidine-binding domain (from 525 to 847).12
Figure 2

Exon skipping sequence.

Notes: Left: Electrophoresis of amplified cDNA from peripheral blood mononuclear cells of a patient carrying the 2242+1G>T variant. Right, upper: Graphic representation of skipping of exon 19. Right, lower: Sequence electropherogram using the primer Ex18F. A double sequence is observed for 85 nucleotides corresponding to overlapping of exons 19 and 20.

Figure 3

Structures of wild-type DPYD and truncated DPYD.

Notes: The interpretation of mutation effect and the molecular modeling were performed by using Deep View Swiss-PDB viewer and Tasser. (A) Modeling of wild-type DPYD; (B) modeling of truncated DPYD.

Due to the interest of this novel discovery and its potential clinical implications, genotyping of the mutation was later performed in the patient’s offspring: one son, one daughter, and one granddaughter (a daughter descendant). For this purpose, a TaqMan probe was synthesized for 2242+1G>T. All individuals carried the 2242+1G>T mutation in heterozygosis. None of them presented the DPYD* four allele. DPYD phenotype assessment was performed by pretreatment measurement of plasma uracil (U) and dihydrouracil (UH2) in the descendants.13 Unfortunately, we were not able to analyze a sample from the original patient because at the time this analysis was performed, she was already deceased. Two samples showed DPYD deficiency according to established criteria (uracil concentration >16 ng/mL and/or UH2/U ratio <6). The other sample showed values that were close to the limit but within the normal activity range. Phenotyping results are shown in Table 2.
Table 2

DPYD phenotyping results

UH2 concentration, ng/mLU concentration, ng/mLUH2/U concentration ratioActivitya
89.3213.476.6Normal
85.1624.133.5Deficient
47.1918.452.6Deficient

Notes:

Criteria for activity deficiency: uracil concentration >16 ng/mL and/or UH2/U ratio <6.

Abbreviations: UH2, dihydrouracil; U, uracil.

A TaqMan probe was synthesized for genotyping of 2242+1G>T in a cohort of 487 anonymous DNA samples from colorectal cancer patients (mainly Caucasians from Iberian ancestry). None of the samples analyzed, except that of the present case, carried this mutation, indicating that it is a rare variant in our setting.

Discussion

The severe toxicity can be explained by the presence of the variant c.2242+1G>T, which generates shorter mRNA and protein, thus rendering a non-functional DPYD protein that lacks a sequence in the pyrimidine-binding domain (Figure 3). The SNP is just located in the first nucleotide after the end of exon 19. Other DPYD variants affecting donor splicing sites have also demonstrated skipping of the corresponding exon12,14 or generation of an in-frame insertion of small fragments causing severe and occasionally fatal adverse reactions to fluoropyrimidine.15 In this patient, a non-synonymous variant, c.1601G>A (rs1801158, p.Ser534Asn), was also observed. This variant defines the DPYD* four allele and decreases protein activity by 20%. However, although this allele has previously been related to the risk of fluoropyrimidine-induced toxicity,16,17 a recent meta-analysis did not find any significant association between c.1601G>A and severe fluoropyrimidine-induced toxicity.18 The DPYD deficiency observed in two out of three members of the family carrying the c.2242+1G>T mutation supports the effect of this variant on the fluoropyrimidine metabolism. The fact that none of them presented variant c.1601G>A further backs the theory that this new variant may be responsible for the descent in activity. As previously described, individuals carrying one functional and one nonfunctional allele of DPYD are likely to display a partial deficiency with 1.5 The frequency of the DPYD variant c.2242+1G>T variant is lower than 0.002% in our setting, which suggests that it is a rare variant and its inclusion in our routine genotyping tests would not significantly increase their predictive value. Testing for this variant in other populations (since our sample is mainly integrated by Caucasian individuals of Iberian ancestry) would be very interesting as it could help to investigate its possible origins. This is definitely a line of investigation to be pursued in future works.

Conclusion

We consider the newly described variant 2242+1G>T in DPYD to be the most probable cause of very severe toxicity following the first cycle of treatment with capecitabine in a patient with breast cancer. DPYD phenotyping in patient’s offspring carrying the mutation showed decreased enzymatic activity, further supporting this conclusion. Whole DPYD sequencing is an interesting approach for the identification of causal variants in patients with suspected DPYD deficiency in whom routine DPYD tests yield negative results.

Ethics

Written informed consent was obtained from the three patient’s family members that were tested for DPYD defiency and from all patients in the colorectal cancer cohort that were tested for the presence of c.2242+1G>T. Written informed consent from the patient’s next of kin was provided to have this case published since the patient was deceased at that time.
  18 in total

1.  Dihydropyrimidine Dehydrogenase Deficiency: Metabolic Disease or Biochemical Phenotype?

Authors:  M Fleger; J Willomitzer; R Meinsma; M Alders; J Meijer; R C M Hennekam; M Huemer; A B P van Kuilenburg
Journal:  JIMD Rep       Date:  2017-03-09

Review 2.  Profiling dihydropyrimidine dehydrogenase deficiency in patients with cancer undergoing 5-fluorouracil/capecitabine therapy.

Authors:  Cédric Mercier; Joseph Ciccolini
Journal:  Clin Colorectal Cancer       Date:  2006-11       Impact factor: 4.481

3.  Severe fluoropyrimidine toxicity due to novel and rare DPYD missense mutations, deletion and genomic amplification affecting DPD activity and mRNA splicing.

Authors:  André B P van Kuilenburg; Judith Meijer; Dirk Maurer; Doreen Dobritzsch; Rutger Meinsma; Maartje Los; Lia C Knegt; Lida Zoetekouw; Rob L H Jansen; Vincent Dezentjé; Lieke H van Huis-Tanja; Roel J W van Kampen; Jens Michael Hertz; Raoul C M Hennekam
Journal:  Biochim Biophys Acta Mol Basis Dis       Date:  2016-12-24       Impact factor: 5.187

4.  Highlight on DPYD gene polymorphisms and treatment by capecitabine (.).

Authors:  Gérard Milano
Journal:  Scand J Clin Lab Invest Suppl       Date:  2016-07-25

Review 5.  Capecitabine: an overview of the side effects and their management.

Authors:  Muhammad Wasif Saif; Nikos A Katirtzoglou; Kostas N Syrigos
Journal:  Anticancer Drugs       Date:  2008-06       Impact factor: 2.248

6.  Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing.

Authors:  K E Caudle; C F Thorn; T E Klein; J J Swen; H L McLeod; R B Diasio; M Schwab
Journal:  Clin Pharmacol Ther       Date:  2013-08-29       Impact factor: 6.875

7.  DPYD IVS14+1G>A and 2846A>T genotyping for the prediction of severe fluoropyrimidine-related toxicity: a meta-analysis.

Authors:  Salvatore Terrazzino; Sarah Cargnin; Marzia Del Re; Romano Danesi; Pier Luigi Canonico; Armando A Genazzani
Journal:  Pharmacogenomics       Date:  2013-08       Impact factor: 2.533

Review 8.  Clinical relevance of DPYD variants c.1679T>G, c.1236G>A/HapB3, and c.1601G>A as predictors of severe fluoropyrimidine-associated toxicity: a systematic review and meta-analysis of individual patient data.

Authors:  Didier Meulendijks; Linda M Henricks; Gabe S Sonke; Maarten J Deenen; Tanja K Froehlich; Ursula Amstutz; Carlo R Largiadèr; Barbara A Jennings; Anthony M Marinaki; Jeremy D Sanderson; Zdenek Kleibl; Petra Kleiblova; Matthias Schwab; Ulrich M Zanger; Claire Palles; Ian Tomlinson; Eva Gross; André B P van Kuilenburg; Cornelis J A Punt; Miriam Koopman; Jos H Beijnen; Annemieke Cats; Jan H M Schellens
Journal:  Lancet Oncol       Date:  2015-10-23       Impact factor: 41.316

9.  Tolerability of Capecitabine Monotherapy in Metastatic Colorectal Cancer: A Real-World Study.

Authors:  Laura W Leicher; Jacques C de Graaf; Wilko Coers; Metin Tascilar; Jan Willem B de Groot
Journal:  Drugs R D       Date:  2017-03

10.  Pharmacogenetic variants in the DPYD, TYMS, CDA and MTHFR genes are clinically significant predictors of fluoropyrimidine toxicity.

Authors:  A Loganayagam; M Arenas Hernandez; A Corrigan; L Fairbanks; C M Lewis; P Harper; N Maisey; P Ross; J D Sanderson; A M Marinaki
Journal:  Br J Cancer       Date:  2013-06-04       Impact factor: 7.640

View more
  2 in total

1.  New DPYD variants causing DPD deficiency in patients treated with fluoropyrimidine.

Authors:  Xandra García-González; Bartosz Kaczmarczyk; Judith Abarca-Zabalía; Fabienne Thomas; Pilar García-Alfonso; Luis Robles; Vanessa Pachón; Ángeles Vaz; Sara Salvador-Martín; María Sanjurjo-Sáez; Luis A López-Fernández
Journal:  Cancer Chemother Pharmacol       Date:  2020-06-11       Impact factor: 3.333

2.  Consensus of experts from the Spanish Pharmacogenetics and Pharmacogenomics Society and the Spanish Society of Medical Oncology for the genotyping of DPYD in cancer patients who are candidates for treatment with fluoropyrimidines.

Authors:  P García-Alfonso; M Saiz-Rodríguez; R Mondéjar; J Salazar; D Páez; A M Borobia; M J Safont; I García-García; R Colomer; X García-González; M J Herrero; L A López-Fernández; F Abad-Santos
Journal:  Clin Transl Oncol       Date:  2021-11-13       Impact factor: 3.405

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.