Literature DB >> 30343553

Ginseng berry extract increases nitric oxide level in vascular endothelial cells and improves cGMP expression and blood circulation in muscle cells.

Cho In-Ho, Kang Byung-Woo, Park Yun-Jae, Lee Han-Joo, Park Sok, Lee Namju.   

Abstract

PURPOSE: The purpose of this study was to determine whether ginseng berry extract improves blood circulation by regulating vasodilator expression in exposed to tumor necrosis factor alpha (TNF-α)-exposed endothelial cells and muscle cells.
METHODS: Nitric oxide (NO) and cGMP levels in human umbilical vein endothelial cells (HUVECs) and A7r5 cells exposed to ginseng berry extract were investigated. Based on the in vitro results, healthy participants were treated with ginseng berry extract for 4 weeks and then a non-invasive vascular screening device was used to confirm the improvement of blood circulation.
RESULTS: When TNF-α-treated cells were exposed to the ginseng berry extract, the expression levels of endothelial nitric oxide synthase (eNOS), NO, and cGMP were recovered to almost normal levels. In addition, TNF-ɑ-induced overexpression of vascular cell adhesion molecule 1 (VCAM-1), intracellular adhesion molecule 1 (ICAM-1), e-selectin, and p-selectin was lowered by ginseng berry extract. The ginseng berry extract significantly increased ankle brachial pressure index compared to placebo (p < 0.05).
CONCLUSION: This study confirmed that the intake of ginseng berry extract improved blood circulation and therefore, its intake would be helpful for people having problems with blood circulation. ©2018 The Korean Society for Exercise Nutrition.

Entities:  

Keywords:  ginseng berry extract

Year:  2018        PMID: 30343553      PMCID: PMC6199483          DOI: 10.20463/jenb.2018.0018

Source DB:  PubMed          Journal:  J Exerc Nutrition Biochem        ISSN: 2233-6834


INTRODUCTION

Blood via blood vessels delivers oxygen and nutrients to each tissue in the body and removes the waste produced by cells[1,2], transports hormones, defends cells from external harmful substances, and maintains proper body temperature and homeostasis[3]. Therefore, a normal blood circulation is very important for maintenance of body function[4]. The vascular endothelium is a layer of endothelial cells on the inner surface of the vascular layer[5]. It regulates fluidity and flow of blood and blood vessel tension via the synthesis and secretion of various kinds of substances having biological activity[6]. It also plays an important role in maintaining and controlling arterial blood vessel function and health by participating in platelet aggregation, thrombogenesis, and dissolution[7]. In other words, vascular endothelial cells primarily serve as an anatomical barrier to prevent blood circulation in the vessel wall, as well as to control blood vessel tension, partially control cell growth in the blood vessel wall, and regulate extracellular matrix deposition[8]. These cells are also involved in blood vessel protection from substances and cells, blood clotting in response to partial injury and inflammation, and homeostasis of blood vessels by repair responses[9]. Continued inflammatory stimuli (e.g., oxidative stress, inflammatory cytokines, exposure to pathogenic agents) cause endothelial dysfunction, with endothelial cells becoming overactive or chronically active[10]. In this condition, damage to the vascular endothelium leads to excessive inflammation, resulting in excessive secretion of soluble adhesion molecules such as intercellular adhesion molecule (ICAM)-1, vascular cell adhesion molecule (VCAM)-1, e-selectin, and p-selectin from endothelial cells[11]. Oxidized cholesterol accumulates in the injured area, forming a plaque, and the inner wall of the blood vessel swells up, resulting in narrowing of the blood vessels and decreased blood circulation[11]. Nitric oxide (NO), which plays a key role in maintaining endothelial homeostasis, is produced by endothelial nitric oxide synthase (eNOS) from the amino acid L-arginine in endothelial cells[12]. A typical function of NO is vasodilation[13]. The NO produced diffuses into the smooth muscle cells of the blood vessels and activates the soluble guanylate cyclase to induce cyclic guanosine-5'-monophosphate (cGMP)-mediated vascular relaxation[14]. cGMP acts as a second messenger to induce many biological effects of NO, such as relaxation of smooth muscle or inhibition of platelet aggregation[15]. NO inhibits the expression of proinflammatory cytokines, chemokines, and adhesion molecules in addition to vascular relaxation[16]. Therefore, it plays a key role in regulating vascular endothelial function, inhibiting vascular recruitment of white blood cells, proliferation of vascular smooth muscle cells, platelet aggregation, and inhibiting the production of tissue factor involved in thrombus formation[17]. However, when functional and structural changes of vascular endothelial cells occur due to risk factors for vascular diseases such as hypertension, diabetes, hyperlipidemia, and smoking, endothelial cells cannot play the protective role mentioned above, but cause atherosclerosis[18]. NO production cannot be achieved by eNOS; NO is oxidized by reactive oxygen species to ONOO-, thus reducing the bioavailability of NO[19]. The resulting ONOO-oxidizes BH4, the coenzyme of eNOS, or increases the activity of arginase[20]. Therefore, eNOS uncoupling phenomenon (excessive O2 · - and H2O2 formation due to abnormal action of eNOS) is induced by decreasing L-arginine or insufficient BH4, which is the substrate of eNOS[21]. As a result, NO-mediated endothelium-dependent vascular dilation leads to impairment and negative effects on blood flow[22]. Ginseng and its associated ingredients have been used in food or herbal medicines for thousands of years to treat many diseases[23]. It exhibits anti-aging, anti-diabetic, anticancer, and anti-fatigue effects through promotion of DNA, RNA, and protein synthesis[24]. In addition, ginseng contains many ingredients, such as ginsenosides, polysaccharides, polyacetylenes, fatty acids, mineral oil, peptides, and amino acids[25]. The bioactivity of ginseng is attributable to the presence of ginsenosides in the root[26]. Thus far, studies have focused on the effects of ginseng roots[26]. However, these ingredients were also distributed in other parts of ginseng, such as berries and leaves[26]. Ginseng berry was reported to have a higher ginsenoside content than roots, and its anti-hyperglycemia and anti-obesity activities were studied[27,28]. Despite its efficacy, ginseng berry has not received much attention[29]. No studies have been reported on the effects of ginseng berry extract in improving blood circulation. Therefore, the purpose of this study was to determine whether tumor necrosis factor (TNF)-□-induced endothelial cells and muscle cells would be recovered using ginseng berry extract and to investigate the effect of the extract intake on blood circulation. NO is expected to be produced in vascular endothelial cells owing to treatment with the extract, and the produced NO is expected to increase cGMP level and decrease the level of adhesion molecules in vascular muscle cells.

METHODS

Preparation of ginseng berry extract

Raw ginseng berries were harvested from Hongcheon, Gangwon-do, South Korea, and the seeds were separated and removed. Ginseng berries were dried and refluxed with 100% distilled water and concentrated under reduced pressure at 45˚C (the patent number 10-2015-0101209).

Cell culture

Human umbilical vein endothelial cells (HUVECs) and smooth muscle cells (A7r5) were both purchased from ATCC (Manassas, VA, USA). HUVECs were cultured in complete microvascular endothelial cell growth medium (EGM-2, Lonza Walkersville, Inc.), in humidified 5% CO2 incubator at 37˚C. A7r5 cells were cultured in complete medium (DMEM, Hyclone, GE Healthcare Life Sciences, South Logan, Utah, USA), in humidified 5% CO2 incubator at 37˚C.

A7r5 and HUVEC co-culture

Co-culture plates, SPLINsertTM Hanging plates were purchased from SPL (SPL Life Sciences, Pochun, Gyeonggi-do, South Korea). A7r5 cells were seeded at a density of 1 × 105 cells per well in complete DMEM, and HUVECs were seeded at a density of 5 × 104 cells per cassette in complete EGM-2. Cassettes with HUVECs were placed on each well and incubated in humidified 5% CO2 incubator at 37˚C.

Cell viability

HUVECs were seeded at a density of 1 × 104 cells per well in a 96-well plate. Cells were incubated for 24 h with EGM-2, in humidified 5% CO2 incubator at 37˚C. After 24 h, the medium was removed and cells were washed with 1× DPBS (Hyclone). Fresh medium was added and ginseng berry extract at various concentrations (0, 15. 63, 31. 25, 62. 5, 125, 250 and 500 μg/ml) was added. TNF-α (10 ng/ml) was added after 30 min and the cells were incubated in humidified 5% CO2 incubator at 37˚C. A Cell counting Kit-8 (Dojindo, Rockville, MD, USA) was used to determine the viability of HUVECs. CCK-8 solution (10 μl) was added in each well and incubated for 4 h in humidified 5% CO2 incubator at 37˚C. The absorbance was measured at 450 nm with a plate reader (Varioskan Lux, Thermofisher).

Total RNA extraction and cDNA synthesis

HUVECs were seeded at a density of 2 × 105 cells per well and incubated for 24 h. Culture medium without FBS was added, and ginseng berry extract at various concentrations (20, 100, and 500 μg/ml) was added. TNF-α (10 ng/ml) was added to each group (except normal cell group) and incubated for 24 h. Cells were washed with 1× DPBS and treated with easy-BLUETM (1 ml) of the Total RNA Extraction Kit (Intron Biotechnology, Sungnam, Gyeonggi-do, South Korea). Cell lysates were collected, 200 μl of chloroform was added, and centrifuged at 10,000 ×g (4˚C, 10 min). Supernatants were collected, iso-propanol (500 μl) was added, and the mixture was kept for standing for 10 min at room temperature. The mixed solution was centrifuged at 7,500 ×g (4˚C, 10 min), and the supernatants were discarded. Pellets were washed with 75% ethanol and centrifuged at 7,500 ×g (4˚C, 5 min) twice. Pellets were dissolved with distilled water and treated with DEPC. Extraction of total RNA from A7r5 cells, which were co-cultured with HUVECs, was performed following the same procedure. cDNA synthesis was performed with Power cDNA Synthesis Kit (Intron Biotechnology), according to the manual in the kit. Total RNA (1 μg) was used to synthesize cDNA, which was used to perform reverse transcription-polymerase chain reaction.

Intracellular nitric oxide production in HUVECs

HUVECs were seeded at a density of 2 × 104 cells per well in a 96-well black plate (SPL Life Sciences, Pochun, Gyeonggi-do, South Korea) and incubated in humidified 5% CO2 incubator at 37˚C. The culture medium was changed to FBS-free culture medium after 24 h, and ginseng berry extract at various concentrations (20, 100, and 500 μg/ml) was added to each well. TNF-α (10 ng/ml) was added after 30 min. Detection of intracellular NO was performed according to the kit, OxiSelectTM Intracellular Nitric Oxide (NO) Assay Kit (Cell Biolabs, San Diego, CA, USA) manual and fluorescence was measured with a fluorometric plate reader at 480 nm/530 nm.

cGMP quantification in A7r5 cells

A colorimetric cGMP ELISA Kit (Cell Biolabs) was used to determine the cGMP level in A7r5 smooth muscle cells. A7r5 cells were co-cultured with HUVECs and the samples were treated with or without with TNF-α for 24 h in humidified 5% CO2 incubator at 37˚C. Cells were lysed and the cGMP level was determined in the lysates following the kit manual. At the end of the experiment, the absorbance was read at 450 nm using a plate reader.

Reverse transcription-polymerase chain reaction

Primers for HUVECs, β-actin, eNOS, ET-1, VCAM-1, ICAM-1, e-selectin, and p-selectin mRNA specific primers were synthesized and purchased from Macrogen (Seoul, South Korea). Primers for A7r5, GAPDH, VCAM-1, ICAM-3, e-selectin, and p-selectin were also synthesized and purchased from Macrogen (Table 1). Maxime PCR PreMix Kit (i-Taq) from Intron was used to perform PCR amplification. PCR products were loaded on 1% agarose gel to perform electrophoresis.
Table 1.

Blood circulation changes following ginseng berry extract intake

GroupPrePostp value
RPWV, cm/secGBE1222. 73±203. 801208. 93±209. 750. 44
PG1213. 38±163. 321226. 31±201. 27
LPWV, cm/secGBE1239. 53±212. 071225. 13±210. 610. 66
PG1227. 85±153. 631227. 85±153. 63
RABPIGBE1. 15±0. 081. 13±0. 080. 016
PG1. 06±0. 071. 11±0. 10
LABPIGBE1. 12±0. 091. 14±0. 080. 57
PG1. 10±0. 111. 10±0. 11

Mean ± Standard deviation (SD)

GBE; ginseng berry extract supplements group, PG; placebo supplements group, RPWV; right brachial ankle pulse wave velocity, LPWV; left brachial ankle pulse wave velocity, RABPI; right ankle brachial pressure index, LABPI; left ankle brachial pressure index

Mean ± Standard deviation (SD) GBE; ginseng berry extract supplements group, PG; placebo supplements group, RPWV; right brachial ankle pulse wave velocity, LPWV; left brachial ankle pulse wave velocity, RABPI; right ankle brachial pressure index, LABPI; left ankle brachial pressure index

Subject characteristics and ginseng berry extract administration

In this study, 30 males (over 20 years of age) were included and divided into the following groups: Ginseng berry extract group (n=15; age, 34. 73 ± 6. 97 years; height, 172. 33 ± 7. 20 cm; weight, 73. 33 ± 12. 19 kg) and placebo group (n=13; age, 35. 07 ± 10. 25 years; height, 170. 79 ± 9. 19 cm; weight, 65. 43 ± 14. 67 kg). Two subjects in the placebo group voluntarily discontinued after 1 week of initiating the administration of ginseng berry extract and were excluded from the study. Thus, 28 patients orally took ginseng berry extract for 4 weeks, and ginseng berry extract distributed to the subjects completed an average intake of 66%. Ginseng berry extract was administered in the form of hard capsules containing ginseng fruit extract powder (500 mg strength); the capsules were administered twice daily to ensure a dose of 1000 mg per day. The intake setting was based on a significant increase in serum NO based on the previous animal study result[9].

Evaluation of improvement of blood circulation

To evaluate the improvement of blood circulation, brachial ankle pulse wave velocity and ankle brachial pressure index were measured before and after ingestion of ginseng berry extract. All subjects randomly assigned to the ginseng berry extract group visited the laboratory before and 4 weeks after ingestion and took a rest for 10-15 minutes while they were in stable condition. During the resting period, the heart rate reached 60 bpm, and the stable heart rate was maintained for more than 2 min. All measurements were performed using a non-invasive vascular screening device (VP-1000 plus, Omron Healthcare Co., Ltd., Japan).

Data analysis

All data were analyzed using SPSS 21. 0 statistical package, and the mean and standard deviation were calculated. The changes in NO and cGMP levels were tested by independent t-tests. In addition, independent t-test was used to determine the difference among subject characteristics and baseline blood circulation values before the administration of ginseng berry extract, and 2-way mixed ANOVA was used to test the difference between groups before and after ingestion of ginseng berry extract. The significance test level was set at p < 0.05.

RESULTS

Effects of ginseng berry extract on HUVEC viability

No cytotoxicity or adverse effects were observed in HUVECs even after treatment with the highest concentration of the ginseng berry extract (500 μg/ml; Figure 1). Since no cytotoxicity was observed at up to 500 μg/ml, we used the extract at a concentration up to 100 μg/ml in subsequent experiments.
Fig. 1.

Ginseng berry extract contents and cell viability in HUVEC.Component of Ginseng Berry and Cell Viability in HUVECs.

(A) Percentage of Ginsenoside Re, Rg1, Rf, Rg2, 20R_Rg2, Rh1 and Rh4 in Ginseng Berry Extract. (B) Cell Viability in HUVECs treated with Ginseng Berry extract 0, 31.25, 62.5, 125, 250 and 500 ug/ml were measured by CCK-8 kit.

Ginseng berry extract contents and cell viability in HUVEC.Component of Ginseng Berry and Cell Viability in HUVECs.

(A) Percentage of Ginsenoside Re, Rg1, Rf, Rg2, 20R_Rg2, Rh1 and Rh4 in Ginseng Berry Extract. (B) Cell Viability in HUVECs treated with Ginseng Berry extract 0, 31.25, 62.5, 125, 250 and 500 ug/ml were measured by CCK-8 kit.

Ginseng berry extract induces eNOS expression, which increases intracellular NO levels in HUVECs

TNF-α-induced cells showed downregulated eNOS expression and decreased NO production compared to normal cells. Treatment with the ginseng berry extract recovered the expression of eNOS and thereby the production NO. This result confirms that the ginseng berry extract affects the production of NO (Figure 2).
Fig. 2.

Ginseng berry Extract induces eNOS expression which leads increase of intracellular NO in HUVEC.

eNOS Expression and Intacellular NO level in HUVEC. (A) eNOS exprssion level and (B) intracellular NO level in HUVECs, treated with 0, 20, 100 and 500 ug/ml. (mean ± s.d., *P<0.05, **P<0.01 as compared to TNF-a-induced Ginseng berry 0 ug/ml treated group).

Ginseng berry Extract induces eNOS expression which leads increase of intracellular NO in HUVEC.

eNOS Expression and Intacellular NO level in HUVEC. (A) eNOS exprssion level and (B) intracellular NO level in HUVECs, treated with 0, 20, 100 and 500 ug/ml. (mean ± s.d., *P<0.05, **P<0.01 as compared to TNF-a-induced Ginseng berry 0 ug/ml treated group).

Ginseng berry extract regulates adhesion molecules through the NO-cGMP pathway in A7r5 muscle cells

HUVECs and A7r5 cells were co-cultured. Treatment with TNF-α decreased cGMP level, which was recovered by the ginseng berry extract in a dose-dependent manner. This result indicates that the ginseng berry extract has a significant effect on the NO-cGMP pathway. The expression of the adhesion molecules VCAM-1, ICAM-1, e-selectin, and p-selectin increases in endothelial cells in response to excessive diet or stress. The results show that the expression of adhesion molecules increased in TNF-α-induced A7r5 cells and was reduced in cells treated with the ginseng berry extract (Figure 3).
Fig. 3.

Ginseng berry Extract reduce TNF-a-induced adhesion molecules through NO-cGMP pathway in A7r5. RT-PCR results of cGMP and Adhesion Molecules Expression level by Ginseng berry extract in A7r5.

(A) Reletive expression of cGMP and (B) adhesion molecules in A7r5, treated by 0, 20, 100 and 500 ug/ml Ginseng berry extract and (C) RT-PCR results, treated with 0, 20, 100 and 500 ug/ml. (mean ± s.d.,P *<0.05, **P<0.01 as compared toT NF-a-induced Ginseng berry 0 ug/ml treated group).

Ginseng berry Extract reduce TNF-a-induced adhesion molecules through NO-cGMP pathway in A7r5. RT-PCR results of cGMP and Adhesion Molecules Expression level by Ginseng berry extract in A7r5.

(A) Reletive expression of cGMP and (B) adhesion molecules in A7r5, treated by 0, 20, 100 and 500 ug/ml Ginseng berry extract and (C) RT-PCR results, treated with 0, 20, 100 and 500 ug/ml. (mean ± s.d.,P *<0.05, **P<0.01 as compared toT NF-a-induced Ginseng berry 0 ug/ml treated group).

Ginseng berry extract reduces TNF-α-induced adhesion molecule and ET-1 expression in HUVECs

The increased expression of adhesion molecules and ET-1 in TNF-α-induced HUVECs was decreased by treatment with the ginseng berry extract (Figure 4).
Fig. 4.

Ginseng berry Extract reduce TNF-a-induced adhesion molecules and ET-1 expression in HUVEC. RT-PCR results of Adhesion Molecules and ET-1 Expression level by Ginseng berry extract in HUVEXs.

(A) Reletive expression of adhesion molecules and ET-1 in HUVEXs, treated by 0, 20, 100 and 500 ug/ml Ginseng berry extract and (B) RT-PCR results, treated with 0, 20, 100 and 500 ug/ml. (mean ± s.d., *P<0.05, **P<0.01 as compared to TNF-a-induced Ginseng berry 0 ug/ml treated group).

Ginseng berry Extract reduce TNF-a-induced adhesion molecules and ET-1 expression in HUVEC. RT-PCR results of Adhesion Molecules and ET-1 Expression level by Ginseng berry extract in HUVEXs.

(A) Reletive expression of adhesion molecules and ET-1 in HUVEXs, treated by 0, 20, 100 and 500 ug/ml Ginseng berry extract and (B) RT-PCR results, treated with 0, 20, 100 and 500 ug/ml. (mean ± s.d., *P<0.05, **P<0.01 as compared to TNF-a-induced Ginseng berry 0 ug/ml treated group).

Blood circulation changes following the intake of ginseng berry extract

This study confirmed the relaxation of smooth muscle cells by the ginseng berry extract through in vitro experiments and clinical trials. There was no significant difference in age and physical characteristics among the participants in this study. In addition, there was no significant difference between the groups in blood circulation factors (RPWV, LPWV, RABPI, LABPI) at baseline (p>0. 05). There was no interaction effect among RPWV, LPWV, and LABPI in the ginseng berry extract supplement group, but RABPI decreased in the ginseng berry extract supplement group and significantly increased in the placebo group (p=0. 016; Table 1).

DISCUSSION

TNF-α decreases eNOS expression and intracellular NO level and markedly increases the expression of adhesion molecules and ET-1 in endothelial cells and muscle cells, resulting in endothelium dysfunction. The results showed that these abnormalities prevented endothelium dysfunction. Many ginsenosides in ginseng berry, including ginsenoside Re, are reported to have effect on penile erection in in vivo studies. Erectile dysfunction is also associated with blood circulation and muscle contraction and relaxation[30]. The problem of blood circulation is caused by endothelial dysfunction. Endothelial dysfunction has been reported to result from a reduction in NO level, which is also referred to as impaired vasodilation[31]. The decrease in NO synthesis is due to a decrease in the expression of eNOS, a deficiency in substrate or cofactor required for eNOS activity, a change in cell signal transduction, impaired eNOS activation, and reactive oxygen species (ROS)[32-35]. As expected, the ginseng berry extract first increased the expression of eNOS and decreased the expression of ET-1 in endothelial cells. Increased expression of eNOS in endothelial cells eventually leads to NO production, which leads to the expression of cGMP in smooth muscle cells. Increased expression of cGMP causes smooth muscle cell relaxation and ultimately induces vasodilation. In addition, expression of VCAM-1, ICAM-1, p-selectin, and e-selectin increased by high-fat diet was reduced by ginseng berry extract, resulting in smooth muscle cell relaxation. It is known that ET-1 is strongly expressed in obese conditions in which muscle cells shrink to interfere with blood flow; however, the mechanism is not clear (Figure 5).
Fig. 5.

Schematic diagram of ginseng berry-blood circulation

A decrease in blood pressure and PWV levels was observed after ingesting ginseng berry extract for a certain period of time. Increasing the diameter of the blood vessel or decreasing the thickness of the vessel wall should occur to confirm PWV reduction. In vitro experiments using vascular endothelial cells and smooth muscle cells showed that ginseng berry relaxed muscles. When the muscles relax, the thickness of the vessel wall decreases and the blood vessels expand. Based on the results of our in vitro experiments and clinical trials, we found that the ginseng berry extract helps to improve blood circulation.

CONCLUSION

This study confirmed the effect of ginseng berry on blood circulation. Because of the difficulty in elucidating the clinical outcome, we constructed an in vitro system with two different cell lines. The change in the NO-cGMP pathway induced by ginseng berry extract was confirmed. Moreover, ginseng berry extract also decreased the expression of cell adhesion molecules causing inflammation in the blood vessel. As a result, this study suggests that the intake of ginseng berry extract improves blood circulation and therefore, ginseng berry extract intake would be helpful for people having problems with blood vessel function.
Table 2.

Primers used for reverse transcription-PCR

GeneCell LineDirectionSequence (5’ → 3’)
β-actinHUVECSenseCCAGGTCATCACCATTGG
AntisenseCAGAGTACTTGCGCTCAG
eNOSHUVECSenseACGGCCTCTTTCATGAAGCA
AntisenseGGGATCAAAAGCCTTCCGGA
ET-1HUVECSenseACTCAGGGCTGAAGACAT
AntisenseTGACGCTGTTTCTCATGG
VCAM-1HUVECSenseAATGGGAGCTCTGTCACT
AntisenseCTCTGCCTTTGTTTGGGT
ICAM-1HUVECSenseCAGCTCCAGACCTTTGTC
AntisenseCACTTCACTGTCACCTCG
e-selectinHUVECSenseGCTGTGAGGAGGGATTTG
AntisenseGCAGAAAGTCCAGCTACC
p-selectinHUVECSenseTGGAATGATGAGCACTGC
AntisenseTCATGAGCACGTGTTGAG
GAPDHA7r5SenseGTCAAGGCTGAGAATGGG
AntisenseGTCTTCTGAGTGGCAGTG
VCAM-1A7r5SenseCCCAAACAAAGGCAGAGT
AntisenseATGTCTCCTGTCTTGGCT
ICAM-1A7r5SenseCATCCCACAGAAGCCTTC
AntisenseCAGGATGAGGTTCTTGCC
e-selectinA7r5SenseGGAAGCTAAGAACTGGGC
AntisenseCAGGTTGGGTCAAAGCTT
p-selectinA7r5SenseTAGTGGCCATCCAGAACA
AntisenseTTCACACTCTGGCCCATA
  33 in total

Review 1.  Preventive and therapeutic roles of ginseng - focus on colon cancer.

Authors:  Hamed Jafari Vayghan; Sevda Saleh Ghadimi; Ali Reza Nourazarian
Journal:  Asian Pac J Cancer Prev       Date:  2014

Review 2.  Evolutionary origins of the blood vascular system and endothelium.

Authors:  R Monahan-Earley; A M Dvorak; W C Aird
Journal:  J Thromb Haemost       Date:  2013-06       Impact factor: 5.824

3.  Activation of vascular endothelial cell adhesion molecule expression by sickle blood cells.

Authors:  M D Brown; T M Wick; J R Eckman
Journal:  Pediatr Pathol Mol Med       Date:  2001 Jan-Feb

4.  Expression of multiple isoforms of nitric oxide synthase in normal and atherosclerotic vessels.

Authors:  J N Wilcox; R R Subramanian; C L Sundell; W R Tracey; J S Pollock; D G Harrison; P A Marsden
Journal:  Arterioscler Thromb Vasc Biol       Date:  1997-11       Impact factor: 8.311

Review 5.  Guanylate cyclase and the .NO/cGMP signaling pathway.

Authors:  J W Denninger; M A Marletta
Journal:  Biochim Biophys Acta       Date:  1999-05-05

Review 6.  Nitric oxide and vasodilation in human limbs.

Authors:  M J Joyner; N M Dietz
Journal:  J Appl Physiol (1985)       Date:  1997-12

Review 7.  Endothelial function and oxidant stress.

Authors:  D G Harrison
Journal:  Clin Cardiol       Date:  1997-11       Impact factor: 2.882

Review 8.  Ginseng compounds: an update on their molecular mechanisms and medical applications.

Authors:  Jian-Ming Lü; Qizhi Yao; Changyi Chen
Journal:  Curr Vasc Pharmacol       Date:  2009-07       Impact factor: 2.719

9.  Loss of endothelial pertussis toxin-sensitive G protein function in atherosclerotic porcine coronary arteries.

Authors:  H Shimokawa; N A Flavahan; P M Vanhoutte
Journal:  Circulation       Date:  1991-02       Impact factor: 29.690

Review 10.  The vascular endothelium and human diseases.

Authors:  Peramaiyan Rajendran; Thamaraiselvan Rengarajan; Jayakumar Thangavel; Yutaka Nishigaki; Dhanapal Sakthisekaran; Gautam Sethi; Ikuo Nishigaki
Journal:  Int J Biol Sci       Date:  2013-11-09       Impact factor: 6.580

View more
  5 in total

1.  Plasma soluble P-selectin correlates with triglycerides and nitrite in overweight/obese patients with schizophrenia.

Authors:  Katelynn A Bourassa; Teodor T Postolache; Aline Dagdag; Dietmar Fuchs; Olaoluwa O Okusaga
Journal:  Pteridines       Date:  2020-05-23       Impact factor: 0.581

2.  Ginseng berry aqueous extract prevents scopolamine-induced memory impairment in mice.

Authors:  Jin Ryul Hu; Yoon Seok Chun; Jong Kyu Kim; Il Je Cho; Sae Kwang Ku
Journal:  Exp Ther Med       Date:  2019-10-08       Impact factor: 2.447

Review 3.  COVID-19 and Panax ginseng: Targeting platelet aggregation, thrombosis and the coagulation pathway.

Authors:  Yuan Yee Lee; Yixian Quah; Jung-Hae Shin; Hyuk-Woo Kwon; Dong-Ha Lee; Jee Eun Han; Jin-Kyu Park; Sung Dae Kim; Dongmi Kwak; Seung-Chun Park; Man Hee Rhee
Journal:  J Ginseng Res       Date:  2022-01-19       Impact factor: 5.735

Review 4.  Panax ginseng: Inflammation, platelet aggregation, thrombus formation, and atherosclerosis crosstalk.

Authors:  Yuan Yee Lee; Sung Dae Kim; Seung-Chun Park; Man Hee Rhee
Journal:  J Ginseng Res       Date:  2021-10-05       Impact factor: 6.060

5.  Effect of Ginsenoside Rh1 on Proliferation, Apoptosis, and Oxidative Stress in Vascular Endothelial Cells by Regulation of the Nuclear Erythroid 2-related Factor-2/Heme Oxygenase-1 Signaling Pathway.

Authors:  Hai Xu; Yicheng Jiang; Kun Yu; Xiwen Zhang; Yafei Shi
Journal:  J Cardiovasc Pharmacol       Date:  2022-03-01       Impact factor: 3.271

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.