| Literature DB >> 30327608 |
Gong Chen1,2,3, Qi Su2,4, Xiaobin Shi2, Huipeng Pan2, Xiaoguo Jiao2,5, Youjun Zhang2.
Abstract
Diverse pathogens, plant hosts, insect vectors, and non-vector herbivores coexist and interact in natural systems. An example is the cooccurrence of insects Bemisia tabaci Q and Frankliniella occidentalis and the pathogens tomato yellow leaf curl virus (TYLCV) and tomato spotted wilt virus (TSWV) on the same plant. In addition, both TYLCV and TSWV are persistently transmitted in these insect species. However, TSWV reduces the fitness of B. tabaci Q; therefore, we investigated whether TSWV affects the transmission of TYLCV to tomato. Both TYLCV and TSWV are persistently transmitted. Although B. tabaci Q cannot transmit TSWV, we found that this insect species is able to acquire and retain this virus serotype, indicating that the effects of TSWV on TYLCV transmission in the current study result from effects on the vector. The acquisition, retention, and transmission of TYLCV by B. tabaci Q were reduced when the insect vector contained TSWV. Additionally, the TYLCV acquisition and transmission by B. tabaci Q were reduced when the host plant was inoculated with TSWV before TYLCV or simultaneously with TYLCV. We also found that F. occidentalis fecundity and transmission of TSWV were reduced when F. occidentalis contained TYLCV. Our findings are consistent with the hypothesis that persistently transmitted viruses can restrict the transmission of other viruses by affecting their insect vectors.Entities:
Keywords: adaptive manipulation; ecological interaction; pathogen competition; persistently transmitted virus; vector transmission
Year: 2018 PMID: 30327608 PMCID: PMC6174246 DOI: 10.3389/fphys.2018.01261
Source DB: PubMed Journal: Front Physiol ISSN: 1664-042X Impact factor: 4.566
Efficiency of TSWV acquisition and retention by Bemisia tabaci Q. B. tabaci Q adult females were assayed for TSWV RNA after they had a 0- to 48-h acquisition access period (AAP) on TSWV-infected pepper plants.
| TSWV acquisition from pepper | TSWV retention on cotton | ||
|---|---|---|---|
| AAP (h)a | Adults with TSWV RNA (%) | Duration of feeding (d) | Adults with TSWV RNA (%) |
| 0 | 0 | 0 | 100 |
| 3 | 40 | 5 | 100 |
| 6 | 50 | 10 | 90 |
| 12 | 90 | 15 | 100 |
| 24 | 100 | 20 | 50 |
| 48 | 100 | ||
Primer sequences used for q-PCR analysis.
| Gene or source of DNA | Primer | Primer sequence (5′ to 3′) | Reference |
|---|---|---|---|
| TYLCV | TY-F | GTCTACACGCTTACGCC | |
| TY-R | GCAATCTTCGTCACCC | ||
| β-actin -F | TCTTCCAGCCATCCTTCTTG | ||
| β-actin-R | CGGTGATTTCCTTCTGCATT | ||
| Tomato | UBI-F | TCGTAAGGAGTGCCCTAATGCTGA | |
| UBI-R | CAATCGCCTCCAGCCTTGTTGTAA | ||