| Literature DB >> 30294338 |
Trinh Ngoc Ai1,2, Aung Htay Naing1, Byung-Wook Yun3, Sun Hyung Lim4, Chang Kil Kim1.
Abstract
The RsMYB1 transcription factor (TF) controls the regulation of anthocyanin in radishes (Raphanus sativus), and its overexpression in tobacco and petunias strongly enhances anthocyanin production. However, there are no data on the involvement of RsMYB1 in the mechanisms underlying abiotic stress tolerance, despite strong sequence similarity with other MYBs that confer such tolerance. In this study, we used the anthocyanin-enriched transgenic petunia lines PM6 and PM2, which overexpress RsMYB1. The tolerance of these lines to heavy metal stress was investigated by examining several physiological and biochemical factors, and the transcript levels of genes related to metal detoxification and antioxidant activity were quantified. Under normal conditions (control conditions), transgenic petunia plants (T2-PM6 and T2-PM2) expressing RsMYB1, as well as wild-type (WT) plants, were able to thrive by producing well-developed broad leaves and regular roots. In contrast, a reduction in plant growth was observed when these plants were exposed to heavy metals (CuSO4, ZnSO4, MnSO4, or K2Cr2O7). However, T2-PM6 and T2-PM2 were found to be more stress tolerant than the WT plants, as indicated by superior results in all analyzed parameters. In addition, RsMYB1 overexpression enhanced the expression of genes related to metal detoxification [glutathione S-transferase (GST) and phytochelatin synthase (PCS)] and antioxidant activity [superoxide dismutase (SOD), catalase (CAT), and peroxidase (POX)]. These results suggest that enhanced expression levels of the above genes can improve metal detoxification activities and antioxidant activity, which are the main components of defense mechanism included in abiotic stress tolerance of petunia. Our findings demonstrate that RsMYB1 has potential as a dual-function gene that can have an impact on the improvement of anthocyanin production and heavy metal stress tolerance in horticultural crops.Entities:
Keywords: MYB transcription factor; abiotic stress; gene expression; genetic transformation; phylogenetic analysis; plant growth
Year: 2018 PMID: 30294338 PMCID: PMC6159756 DOI: 10.3389/fpls.2018.01388
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Primer sequences and PCR conditions used for qRT-PCR analysis in this experiment.
| Genes | Accession no. | Primer sequences (5′ to 3′) | PCR conditions |
|---|---|---|---|
| NM_001325692.1 | F: CGC AAA GGA GAG GAG CAA GA | 95°C (10 min)-[95°C (30 s)- 60°C (30 s)] followed by 40 cycles – 95°C (15 s)- 60°C (30 s)- 95°C (15 s) | |
| KP136425.1 | F: GCC CAG TGT GTG GAC TTG AT | ||
| EU342358.1 | F: GCC AGC TTT GAA GAT GAA CGA | ||
| U93244 | F: GCC AAA TCC CAA GTC CCA TA′ | ||
| D11396.1 | F: ACT GCT CCG TCA CCC AAA AC′ | ||
| SGN-U207876 | F: TGGAAACTCAACCTCCATCCA | ||