Literature DB >> 30276028

Development of microsatellite markers for the resin-yielding, non-timber forest product species Boswellia serrata (Burseraceae).

Bhavani Shankar Maradani1,2, Ravikanth Gudasalamani1, Siddappa Setty1, Rajasekaran Chandrasekaran2.   

Abstract

PREMISE OF THE STUDY: Boswellia serrata (Burseraceae) is an economically important aromatic, gum-resin-yielding, non-timber forest tree species. Microsatellite markers were developed for B. serrata for the first time to study genetic diversity and population structure. METHODS AND
RESULTS: A magnetic bead enrichment method was used to develop 16 microsatellite markers, of which 11 were polymorphic. The number of alleles per locus in the 60 individuals studied ranged from three to 10, and the levels of observed and expected heterozygosity ranged from 0.50 to 0.90 and 0.666 to 0.861, respectively. The primers successfully amplified in the congeneric species B. ovalifoliolata.
CONCLUSIONS: These microsatellite markers can be used to study the genetic variation and population structure of B. serrata and to provide crucial information on population and ecological issues for management and conservation of the species.

Entities:  

Keywords:  Boswellia serrata; Burseraceae; aromatic resin; microsatellites; non‐timber forest product (NTFP) species

Year:  2018        PMID: 30276028      PMCID: PMC6159645          DOI: 10.1002/aps3.1180

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


Natural gums are one of the important non‐timber forest products (NTFP) in India. India is endowed with highly diverse gum‐yielding tree species and is a leading producer of natural gums (Basch et al., 2004). Olibanum, an oleo‐gum‐resin, is obtained from the bark of Boswellia Roxb. ex Colebr. species (Burseraceae). Boswellia serrata Roxb. ex Colebr. (Leung and Foster, 1996), one of four species in the genus Boswellia, is an endangered species that is found in dry deciduous forests of India, Pakistan, and Arabia (Ghorpade et al., 2010). It is often referred to as Indian frankincense and is locally called dhoopa or salai guggal. Boswellia serrata is a moderate‐ to large‐sized tree found in the deciduous forests of Western Ghats, Eastern Ghats, Rajasthan, Gujarat, Uttar Pradesh, and in other dry and tropical regions of India. Burning B. serrata resin as incense has been part of religious and cultural ceremonies since time immemorial. Boswellia serrata gum‐resin contains essential oils, volatile oils, sugars, and terpenes with β‐boswellic acid (Siddiqui, 2011). In recent years, B. serrata has attracted the attention of pharmacologists for the development of nonsteroidal anti‐inflammatory drugs (NSAIDs) because of its chemical constituents (Singh et al., 1996). Oleo‐gum‐resin of B. serrata is used in the treatment of ulcerative colitis, Crohn's disease, osteoarthritis, rheumatoid arthritis, joint pain (rheumatism), bursitis, abdominal pain, asthma, hay fever, sore throat, syphilis, and liver disorders; it can act as an anti‐inflammatory agent by inhibiting the synthesis of 5‐lipoxygenase (Siddiqui, 2011). Boswellia serrata extract also exhibits antibacterial, antifungal, and antimicrobial activities (Ismail et al., 2014). In recent years, it has also been used in cosmetics and perfumes. In India, approximately 1500 tons of B. serrata gum is harvested annually (Giri et al., 2008). With increasing demand for resin, unsustainable harvesting practices, anthropogenic threats, and lack of regeneration (Tandon et al., 2010) have resulted in the rapid decline of populations of the species. Extraction of the resin by puncturing or damaging the bark can cause trees to be susceptible to pests or diseases, and indiscriminate extraction could lead to mortality. This adult mortality, in combination with fragmentation and low regeneration, threatens the persistence of the species. Boswellia serrata is now reported as a rare species in the Red Data Book of India (Modi and Mathad, 2016). Despite its economic importance, knowledge of the genetic resources of this species is scarce. Information on the genetic diversity and pattern of genetic differentiation across populations is crucial for designing appropriate conservation strategies. Addisalem et al. (2015) developed microsatellite markers for B. papyrifera. However, when we used these markers in B. serrata, we found their amplification efficiency to be low. In this study, we developed microsatellite markers for B. serrata with high efficiency and tested their applicability in the related species B. ovalifoliolata N. P. Balakr. & A. N. Henry.

Methods and results

Sample collection and DNA extraction

Fresh leaves of B. serrata were collected from three populations, Biligiri Ranganathaswamy Temple Tiger Reserve (BRT‐TR), Male Mahadeshwara Hills Wildlife Sanctuary (MM Hills WLS), and Cauvery Wildlife Sanctuary (Cauvery WLS) of Western Ghats, India, to develop genetic markers and from one population of B. ovalifoliolata, from the Seshachalam foothills of Tirupati, Andhra Pradesh, India, to check cross‐amplification (Appendix 1). Genomic DNA was extracted from leaf material using a cetyltrimethylammonium bromide (CTAB) method (Sambrook et al., 1989).

Microsatellite library construction and primer design

A microsatellite enrichment library was constructed using a magnetic bead hybridization method following Glenn and Schable (2005) with minor modifications. Total genomic DNA of one sample from BRT‐TR was digested with the restriction enzymes RsaI and XmnI (New England Biolabs, Ipswich, Massachusetts, USA). Digested products were ligated to double‐stranded SNX linkers using a rapid DNA ligation kit (Fermentas International, Thermo Fisher Scientific, Bangalore, India) and amplified with SNX primers. The amplified products were hybridized with 3′‐biotinylated microsatellite probes, and hybridized probes were captured by streptavidin‐coupled (M‐280) Dynabeads (Invitrogen, Oslo, Norway). The captured fragments containing microsatellite repeats were enriched by amplification with SNX linker‐specific primers. Enriched fragments were transformed into E. coli strain CB‐5α with the pTZ5RT vector (Thermo Fisher Scientific, Bangalore, India). Recombinant clones were identified by colony PCR using M13 primers. The PCR fragments larger than 300 bp were sequenced using an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Waltham, Massachusetts, USA) at Chromous Biotech (Bangalore, India). After trimming vector and linker sequences, 216 nonredundant contig sequences were obtained, of which 68 contained microsatellite repeats. A total of 42 primer pairs were designed using the software Primer3Plus (Untergasser et al., 2007) with the following criteria: amplicon size 100–300 bp, annealing temperature 52–60°C, and GC content 40–60%.

Validation and evaluation of designed markers

Of the 42 primer pairs, 16 successfully amplified (Table 1) and were tested for polymorphism in 60 individuals of B. serrata and for cross‐amplification in 10 individuals of B. ovalifoliolata (Table 2). PCR reactions were performed in a 15‐μL reaction volume containing 10–20 ng of template DNA, 1 mM of dNTP mix, 1× polymerase buffer, 1 unit of Taq polymerase (all reagents from Bangalore Genei, Bangalore, India), and 0.2 μM of each primer. The PCR profile was as follows: an initial denaturation at 95°C for 5 min; followed by 35 cycles of 95°C for 30 s, 50–60°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. Amplicons were analyzed on an ABI 3730 Genetic Analyzer (Applied Biosystems) at Chromous Biotech (Bangalore, India) and scored using GeneMapper version 3.2 (Applied Biosystems) software.
Table 1

Characteristics of 16 microsatellite markers developed in Boswellia serrata

LocusPrimer sequences (5′–3′)Repeat motifFluorescent label T a (°C)Allele size range (bp)GenBank accession no.
BS6F: CTACGTATTGATGAGGCGGC(GA)14 PET60172–228 MG811526
R: GAGATCGATGGAATTGCTGGT
BS8F: CGCCTCAGCTCACCAGTAAT(CAAAA)4…(CAA)4 PET52173–209 MG811527
R: CTGCCAGAGTATGAGAAGCAA
BS10a F: ACACGGGTCTGAACTCCAAC(AAG)20 NED60205 MG811542
R: GGATGATTCATTCCTGGAAAA
BS11F: AACAACCAACCCATCTCACTC(TC)7 NED54172–206 MG811528
R: GGTCGGTTGAGGATGGAATA
BS12a F: ATCGGGTGATTCTGCTATCG(AG)9 HEX58174 MG811537
R: GCAGAATCGCTACTCGATGA
BS13F: TTCCTTGGACATAGCCAAATCT(AG)11 6‐FAM58258–296 MG811529
R: GTAGACCTAGCATCTTCAGCTG
BS14F: CCGGCGCAACTTCAATAATA(AAC)4 6‐FAM58183–208 MG811530
R: ATCAGCAAGTCCGTCTGTCC
BS16F: CGCTTTCTATTTTCCTTTTTGG(CT)15 HEX50118–138 MG811531
R: GCTAACGATTGACAACTGCTG
BS18a F: CAACGAGAGGAGGCAGTGAT(TC)30 6‐FAM58198 MG811540
R: TTAAGGCCTGGCTAGCAGAA
BS19a F: GGATCCAGCCGCAGTATATC(TG)32 HEX56224 MG811541
R: TCGACAGCTCAAGGAATGTG
BS21a F: CAGCCTTCCTCAATCGGATA(TGT)12 NED52218 MG811539
R: AAGTCGGTCACCTCATTGGA
BS23F: CACGATGACGTGATTCTGCT(CA)9 NED52188–216 MG811532
R: CAAGCTTGCACACAGGAAAA
BS25F: TCAAGCCGTTGTAGTTGGTG(TC)15 6‐FAM52206–252 MG811533
R: TGGAAGCACAGAAAGAAGCA
BS28F: CCAGCATTTTTCCTTTCTTTTT(AAG)13 PET56156–185 MG811538
R: TTGCTCACGAAATCCTTCCT
BS29F: CACGATGACGTGATTCTGCT(AG)9 HEX52184–228 MG811535
R: CTTACACCATCTCCCTCTGC
BS32F: CTGCCAGGCCTTAAACAAAA(TG)17 NED60242–270 MG811536
R: GCAGTGGATGGGGTAGAATC

T a = annealing temperature.

Monomorphic locus.

Table 2

Genetic analysis of 11 polymorphic microsatellite markers developed for Boswellia serrata and cross‐amplification to B. ovalifoliolata.a

Locus Boswellia serrata Boswellia ovalifoliolata
BRT‐TR (N = 20)MM Hills WLS (N = 20)Cauvery WLS (N = 20)Seshachalam Hills (N = 10)
A H o H e b PIC A H o H e b PIC A H o H e b PIC A H o H e b PIC
BS670.750.838ns 0.81780.750.851ns 0.83480.650.853ns 0.83650.70.76ns 0.720
BS830.550.666ns 0.59230.550.666ns 0.59230.50.666ns 0.59230.50.655ns 0.580
BS1150.70.778ns 0.74350.70.79ns 0.75770.60.808* 0.78360.80.725ns 0.683
BS1390.750.851ns 0.83580.850.855ns 0.83870.80.843ns 0.82490.80.75ns 0.729
BS1450.70.795ns 0.76250.70.797ns 0.76540.80.728ns 0.67950.60.77ns 0.730
BS1670.750.838ns 0.81780.750.851ns 0.83480.70.852ns 0.83450.70.76ns 0.720
BS23100.750.857ns 0.84180.80.842ns 0.823100.750.861ns 0.84560.80.755ns 0.718
BS2560.750.801ns 0.77170.750.833* 0.81270.750.837** 0.81760.80.8ns 0.772
BS2860.650.802ns 0.77260.90.81ns 0.78440.80.728ns 0.67950.60.77ns 0.730
BS29100.850.837ns 0.81960.750.831ns 0.80860.750.831ns 0.80880.90.78ns 0.758
BS32100.70.851ns 0.83460.550.797ns 0.766100.650.846ns 0.82870.70.83ns 0.808
Mean (SD)0.718 (±0.075)0.81 (±0.054)0.782 (±0.071)0.731 (±0.107)0.811 (±0.053)0.783 (±0.07)0.704 (±0.096)0.805 (±0.066)0.775 (±0.084)0.718 (±0.116)0.759 (±0.044)0.722 (±0.057)

A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled; PIC = polymorphism information content.

Locality and voucher information are available in Appendix 1.

Deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ns = not significant.

Characteristics of 16 microsatellite markers developed in Boswellia serrata T a = annealing temperature. Monomorphic locus. Genetic analysis of 11 polymorphic microsatellite markers developed for Boswellia serrata and cross‐amplification to B. ovalifoliolata.a A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled; PIC = polymorphism information content. Locality and voucher information are available in Appendix 1. Deviation from Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01, ns = not significant. Population genetic diversity parameters, i.e., observed heterozygosity (H o), expected heterozygosity (H e), number of alleles per locus (A), effective number of alleles (A e), Shannon's information index, and the probability of deviations from Hardy–Weinberg equilibrium were estimated using GenAlEx 6.5 (Peakall and Smouse, 2012). Polymorphism information content (PIC) and probability of identity (PI) were calculated by CERVUS 3.0 (Kalinowski et al., 2007). Of the 16 successfully amplified primers, 11 were found to be polymorphic, of which eight had dinucleotide, two had trinucleotide, and one had compound repeat motifs (Table 1). Significant differences were found in allele frequencies between the analyzed populations. A ranged from three to 10, and levels of H o and H e of each population ranged from 0.50 to 0.90 and 0.666 to 0.861 (Table 2), respectively. Shannon's information index values ranged from 1.098 to 2.072 and PIC ranged from 0.592 to 0.845 (Table 2), indicating that the markers designed are highly polymorphic (PIC > 0.5) and informative. The PI value is low for many loci, with the combined PI value of 2.081E‐0015 confirming their applicability for population genetic studies. Significant deviations (P < 0.05 and P < 0.01) from Hardy–Weinberg equilibrium were detected for two markers (BS11 and BS25) but were not consistent across the populations. In B. ovalifoliolata, A ranged from three to nine, H o ranged from 0.5 to 0.9, and H e ranged from 0.66 to 0.83 (Table 2). Raw genotyping data for both species are available in Appendix S1.

Conclusions

In this study, 16 microsatellite markers were developed specifically for B. serrata and 11 of these showed considerable polymorphism in all three studied populations. These markers will be useful for studying genetic diversity, gene flow, population structure, and inbreeding. The resulting information will help in developing appropriate strategies for sustainable utilization and conservation of this important resin‐yielding tree. The allelic overlap and intrageneric amplification of these microsatellite markers indicate a close relationship between B. serrata and B. ovalifoliolata, which needs support from further investigation.

Data accessibility

Sequence information for the developed primers has been deposited to the National Center for Biotechnology Information (NCBI); GenBank accession numbers are provided in Table 1. Raw genotyping data for both species are available in Appendix S1. APPENDIX S1. Genotyping data for Boswellia serrata and B. ovalifoliolata. Click here for additional data file.
SpeciesVoucher specimen accession no.a Collection locality (Code)Geographic coordinates n
Boswellia serrata Roxb. ex Colebr. ATREEBs5925a Biligiri Rangaswamy Temple Tiger Reserve (BRT‐TR)11°59′38″N, 77°8′26″E20
B. serrata ATREEBs5925b Male Mahadeshwara Hills Wildlife Sanctuary (MM Hills WLS)12°1′50.52″N, 77°35′16.8″E20
B. serrata ATREEBs5925c Cauvery Wildlife Sanctuary (Cauvery WLS)12°10′12″N, 77°32′34.8″E20
B. ovalifoliolata N. P. Balakr. & A. N. Henry ATREEBo5926a Seshachalam Hills14°19′59.99″N, 78°15′0″E10

n = number of individuals sampled.

One sample per population is deposited at the ATREE Herbarium, Bangalore, India.

  8 in total

1.  Isolating microsatellite DNA loci.

Authors:  Travis C Glenn; Nancy A Schable
Journal:  Methods Enzymol       Date:  2005       Impact factor: 1.600

Review 2.  Boswellia: an evidence-based systematic review by the Natural Standard Research Collaboration.

Authors:  Ethan Basch; Heather Boon; Theresa Davies-Heerema; Ivo Foppo; Sadaf Hashmi; Jens Hasskarl; David Sollars; Catherine Ulbricht
Journal:  J Herb Pharmacother       Date:  2004

3.  Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment.

Authors:  Steven T Kalinowski; Mark L Taper; Tristan C Marshall
Journal:  Mol Ecol       Date:  2007-03       Impact factor: 6.185

4.  In vitro zygotic embryo germination and propagation of an endangered Boswellia serrata Roxb., a source of boswellic acid.

Authors:  Ravi P Ghorpade; Arvind Chopra; Tukaram D Nikam
Journal:  Physiol Mol Biol Plants       Date:  2010-09-05

5.  GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update.

Authors:  Rod Peakall; Peter E Smouse
Journal:  Bioinformatics       Date:  2012-07-20       Impact factor: 6.937

6.  Boswellia serrata, a potential antiinflammatory agent: an overview.

Authors:  M Z Siddiqui
Journal:  Indian J Pharm Sci       Date:  2011-05       Impact factor: 0.975

7.  Genomic sequencing and microsatellite marker development for Boswellia papyrifera, an economically important but threatened tree native to dry tropical forests.

Authors:  A B Addisalem; G Danny Esselink; F Bongers; M J M Smulders
Journal:  AoB Plants       Date:  2015-01-07       Impact factor: 3.276

8.  Primer3Plus, an enhanced web interface to Primer3.

Authors:  Andreas Untergasser; Harm Nijveen; Xiangyu Rao; Ton Bisseling; René Geurts; Jack A M Leunissen
Journal:  Nucleic Acids Res       Date:  2007-05-07       Impact factor: 16.971

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.