| Literature DB >> 30245680 |
Filip Sima1,2,3, Alexandros Ch Stratakos1,3, Patrick Ward3, Mark Linton1, Carmel Kelly1, Laurette Pinkerton1, Lavinia Stef4, Ozan Gundogdu5, Veronica Lazar2, Nicolae Corcionivoschi1,4.
Abstract
Human campylobacteriosis is considered one of the most common foodborne diseases worldwide with poultry identified as the main source of infection accounting for 50-80% of human cases. Highly virulent Campylobacter spp., positive for the Type VI secretion system (T6SS), which have an increased ability to adhere to and invade the host gastrointestinal epithelium are highly prevalent in poultry. Multidrug resistant strains of bacteria are rapidly evolving and therefore, new antimicrobials to supplement animal feed that are able to control Campylobacter species, are in great need. The work presented herein indicates that a novel phenolic antimicrobial, Auranta 3001, is able to reduce the adhesion and invasion of human intestinal epithelial cells (HCT-8) by two T6SS positive chicken isolates, C. jejuni RC039 (p < 0.05) and C. coli RC013 (p < 0.001). Exposure of C. jejuni RC039 and C. coli RC013 to Auranta 3001 downregulated the expression of hcp and cetB genes, known to be important in the functionality of T6SS. Furthermore, the reduced adhesion and invasion is associated with a significant decrease in bacterial motility of both isolates (p < 0.05-p < 0.001) in vitro. Most importantly our in vivo results show that Auranta 3001 is able to reduce cecum colonization levels from log 8 CFU/ml to log 2 CFU/ml for C. jejuni RC039 and from log 7 CFU/ml to log 2 CFU/ml for C. coli RC013. In conclusion, this novel antimicrobial is able to reduce the pathogenic properties of T6SS campylobacters in vitro and also to decrease colonization in vivo.Entities:
Keywords: Campylobacter coli; Campylobacter jejuni; HCT-8; attachment; gene expression; invasion
Year: 2018 PMID: 30245680 PMCID: PMC6137164 DOI: 10.3389/fmicb.2018.02139
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
List of primer sequences used for qRT-PCR for C. jejuni RC039 and C. coli RC013 genes associated with virulence.
| Gene | Primer sequence – forward | Primer sequence – reverse | Reference |
|---|---|---|---|
| 5′ GCCTTGTTGCTGTTCTGCTC 3′ | 5′ TTCCGTTCGTCGTATGCCAA 3′ | ||
| 5′ CAAGCGGTGCATCTACTCAA 3′ | 5′ TAAGCTTTGCCCTCTCTCCA 3′ | ||
| 5′ ATCTAATGGCTTAACCATTAAAC 3′ | 5′ GGACGGTAACTAGTTTAGTATT 3′ |
Chemical composition of basal diet.
| Item | Starter | Grower | Finisher |
|---|---|---|---|
| 0–10 days | 11–24 days | 25–35 days | |
| Wheat | 54.623 | 57.553 | 61.300 |
| Full fat soya | 12.000 | 12.000 | 12.000 |
| Brazilian GM hipro | 25.000 | 21.000 | 17.000 |
| Lime bulk | 0.717 | 0.700 | 0.500 |
| DCP bulk (18.1% p) | 1.654 | 2.000 | 2.150 |
| Salt bulk | 0.200 | 0.200 | 0.200 |
| Sod.bi-carbonate | 0.199 | 0.166 | 0.162 |
| DL methionine | 0.487 | 0.435 | 0.378 |
| 0.373 | 0.318 | 0.281 | |
| Threonine | 0.247 | 0.128 | 0.029 |
| Vitamin+mineral premix | 0.500 | 0.500 | 0.500 |
| Soyabean oil | 4.000 | 5.000 | 5.500 |
| ME Kcal/kg | 2999 | 3081 | 3133.8 |
| CP | 23.12 | 21.53 | 20.04 |
| Lys | 1.45 | 1.308 | 1.17 |
| Met+Cys | 1.089 | 0.996 | 0.91 |
| Ca | 0.97 | 0.906 | 0.85 |
| AvP | 0.49 | 0.41 | 0.409 |
Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) activity of the Auranta 3001.
| Strains | Origin | MIC | MBC |
|---|---|---|---|
| poultry | 1% | 1% | |
| poultry | 2% | 2% |
Detection of viable campylobacters (log10 CFU/ml).
| Experiment | ||||
|---|---|---|---|---|
| +A3001 | -A3001 | +A3001 | -A3001 | |
| A | 3.9 × 102a | 7.3 × 108 | 4.2 × 102a | 5.1 × 106 |
| B | 2.7 × 102a | 8.1 × 109 | 2.7 × 103a | 3.3 × 107 |
| C | 1.2 × 102a | 6.6 × 108 | 3.9 × 102a | 4.7 × 106 |