| Literature DB >> 30208328 |
Rong Gao1, Ann M Stock2.
Abstract
A fundamental trade-off between rapid response and optimal expression of genes below cytotoxic levels exists for many signaling circuits, particularly for positively autoregulated systems with an inherent response delay. Here, we describe a regulatory scheme in the E. coli PhoB-PhoR two-component system, which overcomes the cost of positive feedback and achieves both fast and optimal steady-state response for maximal fitness across different environments. Quantitation of the cellular activities enables accurate modeling of the response dynamics to describe how requirements for optimal protein concentrations place limits on response speed. An observed fast response that exceeds the limit led to the prediction and discovery of a coupled negative autoregulation, which allows fast gene expression without increasing steady-state levels. We demonstrate the fitness advantages for the coupled feedbacks in both dynamic and stable environments. Such regulatory schemes offer great flexibility for accurate control of gene expression levels and dynamics upon environmental changes.Entities:
Keywords: DNA-binding affinity; autoregulation; coupled feedback; fitness; negative feedback; positive feedback; promoter architecture; response dynamics; transcription dual regulation; two-component system
Mesh:
Substances:
Year: 2018 PMID: 30208328 PMCID: PMC6194859 DOI: 10.1016/j.celrep.2018.08.023
Source DB: PubMed Journal: Cell Rep Impact factor: 9.423
Figure 1.Dependence of Response Kinetics on PhoB Accumulation Rate
(A) Schematic diagram of PhoBR autoregulation.
(B and C) Time-dependent PhoB expression examined with immunoblots. At time = 0, cells were starved for Pi by resuspension in MOPS medium (2 μM Pi). For comparison with the expression kinetics of the autoregulated WT (BW25113), PhoB levels of RU1616 were constantly maintained with 150 μM IPTG (constitutive) or induced by adding 150 μM IPTG at the start of Pi starvation (induced). One representative of at least two immunoblots is shown in (B). Data in (C) are shown as mean ± SD from quantifications of at least two immunoblots.
(D) Response kinetics of Pi starvation examined using the phoA-yfp reporter plasmid pRG161. Fluorescence traces are shown in the inset. OD-normalized first derivatives of fluorescence are used to represent promoter activity. Data are shown as mean ± SD from 11 individual wells; symbols are as indicated in (C).
Figure 2.Effects of TF DNA-Binding Affinity and Promoter Strength on PhoB Expression Kinetics
(A) Phosphorylation and transcription feedbackmodules for the autoregulation model (see details in Figure S1).
(B) Slower PhoB kinetics caused by weaker DNA affinity. PhoB expression kinetics modeled with different affinities are shown in curves. The solid and dotted curves were modeled with the affinities of PhoB~P to the phoB (KDNA = 0.25 mM) and phnC (KDNA = 1.7 μM) promoters. Affinities were measured by EMSAs (Figure S2). The horizontal line indicates the half-maximal PhoB level. Symbols represent PhoB expression kinetics experimentally measured (Figure S3) for RU1878 (P) and RU1881 (P). Data are shown as mean ± SD from five (P) or four (P) experiments. RU1881 is engineered to express phoBR from the phnC promoter. RU1878 and RU1881 have identical genetic backgrounds. The WT phoBR operon in RU1878 is not at its original location; however, RU1878 displayed identical expression kinetics as the WT strain BW25113 (Figure S3).
(C) Dependence of rising time on promoter affinity. Rising time was calculated as the time required to reach the half-maximal PhoB level, 4.7 μM. Solid curves indicate the rising times calculated with different values of the autophosphorylation kinetics parameter kk. WT has a kk of 0.06 s−1.
(D) Effects of promoter strength on autoregulation kinetics and fitness. Solid lines represent modeled data with indicated promoter strengths. The value of P is set at 20 × P0. Open circles show the experimental data for RU1878, as in (B). The curve in the fitness sub-panel is simulated with a log-normal curve that illustrates the fitness trend of previous data (Gao and Stock, 2013a).
Figure 3.Auto-repression of the phoB Promoter
(A) Repression of phoB promoter activity during the late stage of Pi starvation. Net promoter activities of phoB-yfp (pJZG202), phoA-yfp (pRG161), and phnC-yfp (pRG162) were assayed in the WT strain BW25113 and calculated as the first derivatives of fluorescence. Solid symbols show the average of 11 individual wells and solid lines illustrate the smoothed data. Open circles with a dashed line show the phosphorylation kinetics measured previously (Gao et al., 2017).
(B) Repression of phoB-yfp in the rpoS deletion strain RU1646. Promoter activity data are shown as mean ± SD from 22 individual wells.
(C) Dependence of phoB repression on PhoB levels. Reporter dynamics were measured in the non-autoregulatory strains RU1616 or RU1783 at different IPTG concentrations that yield the indicated PhoB levels. Time zero represents the onset time of Pi starvation. One representative sample for each indicated PhoB level is shown.
(D) Dependence of reporter output on PhoB expression levels. Promoter activity of phoB-yfp (open circles) and OD-normalized fluorescence of three YFP reporters (solid symbols) were measured at 90 min after the onset of starvation and plotted against PhoB concentrations. The shaded area indicates the PhoB concentration range that displayed phoB promoter repression. Data are shown as mean ± SD from at least four independent experiments.
Figure 4.Identification of an Auto-repression Site in the phoB Promoter
(A) Illustration of PhoBP binding sites. Sequence of the phoB promoter region is shown with the 35, 10, and transcription start (+1) labeled. The dotted box indicates the PhoB activation site, Pho box. Bold letters mark the highly conserved sequence tracts for major groove binding and the arrows above indicate the orientation of the tandem half-sites. The sequence logo of the half-site was generated with the position-weighted matrix that was used for identification of PhoBbinding sites. An additional site (solid box) was identified on the antisense strand and the reverse complementary sequence is shown. Sequence alignments show the major groove sites of WT as well as mutants designed to disrupt (rp2 and rp1) or enhance (rp-hi) the binding of PhoB~P to the newly identified site.
(B) Binding of PhoB~P to the repression site. EMSA was done using the indicated DNA fragments with PhoB~P concentrations at 0, 1, 2.1, 4.2, 6.3, and 8.4 mM, analyzed in successive lanes from left to right.
(C–E) Correlation of phoB repression with mutations in the PhoB-binding site. Reporter activities of phoB-rp2-yfp (pRG368), phoB-rp1-yfp (pRG369), and phoBrp-hi-yfp) (pRG367) were examined in the non-autoregulatory strains RU1616 or RU1783 at the indicated PhoB levels. OD-normalized fluorescence and promoter activities of phoB-rp2-yfp following the onset of Pi starvation are shown for a representative experiment (C). OD-normalized fluorescence at 90 min after the onset of starvation are shown in (D) across different PhoB levels and in (E) at a concentration of 8.2 mM, a level close to the WT level under Pi-depleted conditions. Data in (D) and (E) are shown as mean ± SD from at least four independent experiments.
Figure 5.Acceleration of Response Kinetics with Coupled Negative Feedback
(A) Schematic diagram of the coupled feedback with both activation and repression sites in the same promoter.
(B) Increased PhoB expression in the repression mutant. PhoB expression levels 3 hr after the onset of starvation were quantitated by immunoblotting for the repression mutant strain RU1879 (PphoB-rp2) and the corresponding WT strain RU1878 (PphoB). Average and SD from eight experiments are shown.
(C) Recapitulation of PhoB autoregulation kinetics with the coupled feedback model. Experimentally measured PhoB expression kinetics for the WT and mutant autoregulatory strains are shown in circles and squares as average and SD from at least three experiments (details in Figure S3). The dotted line indicates kinetics that are modeled with the promoter strength parameter, P, valued at 20 × P0 without any repression. The other two lines are modeled with P valued at 41 × P0 without (dashed line) or with (solid line) the coupled negative feedback.
(D) Relationship of PhoB expression to the affinity of PhoB for the repression site. All curves are modeled with the value of KDNA at 0.25 μM and the value of P at 41 × P0.
(E) Adjustment of the autoregulation kinetics with the coupled feedback. Parameters for the modeled curves are selected to produce comparable steady-state PhoB expression levels. NR, no repression.
Figure 6.Superior Fitness of the WT Strain with Coupled Feedback
(A and B) Steady-state expression levels of PhoB (A) and fitness (B) of autoregulatory variants in Pi-depleted continuous cultures. Levels of PhoB in RU1878 (P), RU1879 (P), and the RU1879-derivative, RU1880 (P, see details in Figure S5) were quantitated by immunoblotting. Levels of PhoB in the mutant strains were determined relative to that in RU1878 and data are shown as mean ± SD from four independent experiments. The three above strains carrying a CFP-expressing plasmid pRG411 were competed against RU1878 carrying pRG426, which expresses a non-fluorescent CFP variant. Fluorescent bacterial populations were quantified using a thresholding algorithm (Figure S6). Fitness was calculated as the ratio of the fluorescent bacterial population after competition over the population before competition.
(C and D) Bacterial competition in batch cultures. Indicated strains carrying a CFP-expressing plasmid pRG411 were competed against RU1878/pRG426 in batch cultures with a starting Pi concentration at 50 μM. Shaded areas illustrate the approximate range when Pi is replete; however the exact boundary, or the exact time of onset of Pi starvation, has not been determined. Solid, dashed and dotted lines show the growth curves of RU1878, RU1879 and RU1880, respectively. Fluorescent bacteria populations are shown as mean ± SD from eight individual cultures for one starvation (C) or multiple consecutive starvations (D). For consecutive starvations, fluorescent populations at 150 min after each round of inoculation into media containing 50 mM Pi were used for the plot.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-PhoB serum | This study | RRID: AB_2722768 |
| Cy5 Goat anti-rabbit IgG (H+L) | ThermoFisher | Cat# A10523; Lot #1512070; RRID: AB_2534032 |
| Bacterial and Virus Strains | ||
| ThermoFisher | Cat# 18265017 | |
| CGSC, Yale University | CGSC# 7080 | |
| N/A | ||
| N/A | ||
| N/A | ||
| N/A | ||
| N/A | ||
| N/A | ||
| This paper | N/A | |
| This paper | N/A | |
| This paper | N/A | |
| This paper | N/A | |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Phos-tag Acrylamide AAL-107 | Wako Chemicals | Cat# 304–93521 |
| N/A | ||
| Oligonucleotides | ||
| RG278-f: TCTGACACATAATGACGTCGCA | This paper | RG278-f |
| RG279-r: TGCGACGTCATTATGTGTCAGA | This paper | RG279-r |
| RG280-f: ATCTGTTCCATAATGTGCTCGCATTA | This paper | RG280-f |
| RG281-r: TAATGCGAGCACATTATGGAACAGAT | This paper | RG281-r |
| RG282-f: TCTGTTCCATAATGACGTCGCATTA | This paper | RG282-f |
| RG283-r: TGCGACGTCATTATGGAACAGATTTATGAC | This paper | RG283-r |
| RG293-r:TTGCGATCATTAATGCGAGCACATNATN GAACAGAT | This paper | RG293-r |
| RG294-f: GTGCTCGCATTAATGATCGCAACC | This paper | RG294-f |
| RG322-f: TGACCACCCTGGCCTCGGCCGTGCAGT GCTTCA-3 | This paper | RG322-f |
| RG323-r: AGCACTGCACGGCCGAGGCCAGGGTG GTCACGA | This paper | RG323-r |
| Recombinant DNA | ||
| pAH144 [CRIM plasmid for integration at | pAH144 | |
| pRG22 [Multi-cloning site (MCS) in a p15A orgin plasmid, Cmr] | pRG22 | |
| pJZG146 [ | pJZG146 | |
| pRG161 [ | pRG161 | |
| pJZG202 [ | pJZG202 | |
| pRG162 [ | pRG162 | |
| pRG252 [ | pRG252 | |
| pRG367 [ | This paper | pRG367 |
| pRG368 [ | This paper | pRG368 |
| pRG369 [ | This paper | pRG369 |
| pRG387 [ | This paper | pRG387 |
| pRG390 [ | This paper | pRG390 |
| pRG391 [ | This paper | pRG391 |
| pRG393 [ | This paper | pRG393 |
| pRG396 [ | This paper | pRG396 |
| pRG411 [ | This paper | pRG411 |
| pRG426 [ | This paper | pRG426 |
| This paper | N/A | |
| This paper | N/A | |
| Software and Algorithms | ||
| MATLAB R2009a | MathWorks | |
| OriginPro 8 | OriginLab | |
| FIMO tool (MEME suite) | ||
| RSAT tool | ||
| ImageJ | ||
| Thresholding algorithm for colony counting | This paper | N/A |