Literature DB >> 30204081

Oligodendrocyte-encoded Kir4.1 function is required for axonal integrity.

Lucas Schirmer1,2,3,4, Wiebke Möbius5,6, Chao Zhao4,7, Andrés Cruz-Herranz8,9, Lucile Ben Haim1,2, Christian Cordano8,9, Lawrence R Shiow1,2, Kevin W Kelley1,2, Boguslawa Sadowski5,6, Garrett Timmons8,9, Anne-Katrin Pröbstel8,9, Jackie N Wright1,2, Jung Hyung Sin8,9, Michael Devereux8,9, Daniel E Morrison4,7, Sandra M Chang1,2, Khalida Sabeur1,2, Ari J Green8,9,10, Klaus-Armin Nave5,6, Robin Jm Franklin4,7, David H Rowitch1,2,3,4,11.   

Abstract

Glial support is critical for normal axon function and can become dysregulated in white matter (WM) disease. In humans, loss-of-function mutations of KCNJ10, which encodes the inward-rectifying potassium channel KIR4.1, causes seizures and progressive neurological decline. We investigated Kir4.1 functions in oligodendrocytes (OLs) during development, adulthood and after WM injury. We observed that Kir4.1 channels localized to perinodal areas and the inner myelin tongue, suggesting roles in juxta-axonal K+ removal. Conditional knockout (cKO) of OL-Kcnj10 resulted in late onset mitochondrial damage and axonal degeneration. This was accompanied by neuronal loss and neuro-axonal dysfunction in adult OL-Kcnj10 cKO mice as shown by delayed visual evoked potentials, inner retinal thinning and progressive motor deficits. Axon pathologies in OL-Kcnj10 cKO were exacerbated after WM injury in the spinal cord. Our findings point towards a critical role of OL-Kir4.1 for long-term maintenance of axonal function and integrity during adulthood and after WM injury.
© 2018, Schirmer et al.

Entities:  

Keywords:  Kir4.1 (KCNJ10); mouse; neurobiology; neurodegeneration; neuroscience; oligodendrocytes; visual System; white matter

Mesh:

Substances:

Year:  2018        PMID: 30204081      PMCID: PMC6167053          DOI: 10.7554/eLife.36428

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Glial support of axons is essential for the maintenance of normal function in the central nervous system (CNS) (Nave, 2010; Nave and Trapp, 2008). For example, oligodendrocytes (OLs) maintain metabolic and trophic support of axons by providing lactate in response to sensing of axonal firing (Lee et al., 2012; Fünfschilling et al., 2012; Saab et al., 2016). Exchange and buffering of ions such as K+ between astrocytes (AS) and neurons have been well described and led to the current understanding that those cells are major regulators of neuronal excitability (Cui et al., 2018; Tong et al., 2014; Kelley et al., 2018). However, not much is known about OL-dependent regulation of axonal excitability through buffering of ions like K+ during action potential propagation. Here, we focused on Kir4.1 (Kcnj10), a highly conserved ATP- and pH-sensitive K+ channel expressed in both AS and OL cells of the CNS (Hibino et al., 2004; Tanemoto et al., 2000; Hibino et al., 2010). Kir channels regulate K+ transmembrane gradients (Rash, 2010; Menichella et al., 2006; Olsen and Sontheimer, 2008; Chever et al., 2010), which are critical for action potential propagation as well as axonal K+ outflow that is necessary to establish resting membrane potential and neuronal repolarization (Yasuda et al., 2008; Seifert et al., 2009; Djukic et al., 2007; Bay and Butt, 2012; Sibille et al., 2015). Its complex expression pattern, including homo- and heterotetrameric association with Kir5.1 (Kcnj16), underlies potentially diverse roles depending on glial cell sub-type and CNS anatomical regions (Cui et al., 2018; Tong et al., 2014; Kelley et al., 2018; Hibino et al., 2004; Larson et al., 2018). However, precise functions for Kir4.1 in OLs versus AS are only poorly understood. Homotetrameric Kir4.1 is the major inward-rectifying K+ channel in OLs, and its downregulation has been reported in glial cells in CNS disease (Zurolo et al., 2012; Eberhardt et al., 2011; Schirmer et al., 2014). Because glial Kir4.1 channels help remove extracellular K+ during neuronal activity, general loss-of-function is associated with severe human neurological conditions. Human congenital KCNJ10 loss-of-function mutations in EAST/SeSAME syndrome cause electrolyte imbalance, seizures, pathological changes in the retina, sensorineural deafness and progressive motor deficits in affected individuals (Bockenhauer et al., 2009; Cross et al., 2013; Scholl et al., 2009; Thompson et al., 2011). Prior reports have found early lethality in young adult mice lacking glial-Kcnj10, attributable to increased neuronal excitability and epileptic activity (Djukic et al., 2007; Larson et al., 2018). In particular, conditional ablation of Kcnj10 using Gfap-cre (that targets both AS and OL glial cell types) was lethal before P30 (Djukic et al., 2007; Neusch et al., 2001), an early/severe phenotype that precluded study of late functions in adult white matter (WM). In contrast to prior studies, we studied the role of OL-Kir4.1 channels in long-term maintenance of axonal function during adulthood and white matter injury focusing on long white matter tracts, such as the optic nerves and the spinal cord. We found early and late roles for Kir4.1 in OL progenitor cells (OPCs) and myelinating OLs using two distinct cre lines to study age- and disease-related functions during development, adulthood and in the setting of WM injuries. We observed that Kir4.1 is localized to both OL cell bodies and myelin, where it is found within the inner tongue of myelin and in AS processes near the node of Ranvier, which appear poised to remove axonal K+. By dissecting out early from late developmental functions, we found that OL-Kir4.1 conditional knockout (cKO) was dispensable for early myelin production but resulted in pronounced late onset axonal degeneration with damage to mitochondria in long fiber tracts of the optic nerve (ON) and spinal WM as well as after focal WM demyelination. Hence, our data suggest that K+ clearance via OL-Kir4.1 channels is critical for sustained axonal function and integrity.

Results

OL-Kir4.1 is gradually upregulated during early postnatal development and shows a peri-axonal expression pattern

As Kir4.1 channels are assembled as homo- and heterotetramers with Kir5.1, we investigated the expression of both proteins throughout development (Hibino et al., 2004; Ishii et al., 2003). While in control littermates the number of ON OL-Kir4.1+ channels increased with age (Figure 1A–C), we observed significantly lower Kir4.1 and Kir5.1 protein levels in Kcnj10 cKO mice expressing cre recombinase under control of the Olig2 promoter (Figure 1A–B; note that persistent expression corresponds to intact AS Kir4.1 in cKO animals) (Schüller et al., 2008). To study specific Kir4.1 functions in OLs in vivo, we studied Kcnj10 loss-of-function in OPCs and mature OLs. As shown (Figure 1D, Figure 1—figure supplement 1A), Kir4.1 staining was substantially reduced from Apc+ OL cell bodies but not Gfap+ astrocyte fibers in ON samples from adult Olig2-cre:Kir4.1 (cKO-1) and Cnp-cre:Kir4.1 (cKO-2) mice (Figure 1D) confirming robust knockout efficiency in OLs (Djukic et al., 2007; Schüller et al., 2008; Lappe-Siefke et al., 2003). Levels of Kcnj10 transcripts were higher in myelinating OLs compared to OPCs in vitro, whereas Kcnj16 mRNA decreased during OL maturation (Figure 1—figure supplement 1B–C) (Kalsi et al., 2004; Nwaobi et al., 2014). Notably, we observed higher Cacna1c mRNA levels in the setting of loss-of-OPC-encoded Kcnj10 in-vitro (Figure 1—figure supplement 1D) (Paez et al., 2010; Cheli et al., 2015). Cacna1c encodes Cav1.2, a major voltage-gated Ca2+ channel in OPCs. These findings demonstrate gradual upregulation of OL-Kir4.1 during postnatal development and suggest a more critical role of the channel later in life.
Figure 1.

OL-Kir4.1 is upregulated during postnatal development and localized to peri-axonal spaces.

Kir4.1 ON protein levels were upregulated between age P40 and P140, whereas Kir5.1 protein levels did not change during aging (A–B). Note substantial loss of Kir4.1 protein in Olig2-cre driven Kcnj10 cKO (cKO-1) mice at P40, which became more apparent at P140; Kir5.1 protein was also reduced in cKO-1 ONs at P40 and P140 (control and cKO-1: n = 3 for all time points) (A–B). Quantification of Kir4.1+ Apc+ OLs confirmed age-dependent upregulation of OL-Kir4.1 channels between P40 and P140 (n = 4 for all time points) (C). One-way ANOVA with Tukey’s multiple comparison tests were performed in B and C; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. Kir4.1 channels were lost from both ON OL cell bodies in cKO-1 and Cnp-cre driven Kcnj10 cKO (cKO-2) mice versus controls (D). Note that Kir4.1+ OL are marked by magenta-colored arrowhead; Apc+ OLs are indicated by green arrowheads. Note AS Kir4.1 immunoreactivity and contacts of Kir4.1+ AS fibers with OLs (white arrowheads). Merged images are shown in panels highlighted by yellow surroundings (D). Kir4.1 was strongly expressed in OLs along spinal fiber tracts; note that cyan-colored arrowheads mark juxta-axonal Kir4.1 IR (E). Kir4.1 immunogold electron microscopy (IEM) labeling revealed presence of gold particles at inner and outer myelin tongue (cyan-colored arrowheads) and within AS fibers (magenda-colored arrowheads) adjacent to myelin sheaths (M = myelin) and blood vessels (BV = blood vessel; ctrl: n = 3, cKO-1: n = 3; F–G). Axon structures are highlighted in yellow, AS fibers are highlighted in magenta. Note decrease in inner tongue (F) but not compact myelin (F) or AS fiber (G) IEM labeling in cKO-1 ON tissue versus controls. Cartoon highlights proposed mechanism of glial K+ siphoning from axons during saltatory conduction towards blood vessels via a network of axonal Kv and glial Kir4.1 channels (H). Mann-Whitney tests were performed in F–G; ***p≤0.001, p=0.06 (F, compact myelin IEM), p=0.74 (G, AS fiber IEM). Data are presented as mean ±s.e.m in B–C and F–G.

Kir4.1 channels were efficiently ablated from ON OLs in cKO-1 (n = 5) and cKO-2 (n = 4) mice versus control ONs (n = 5; A). One-way ANOVA with Tukey’s multiple comparisons test was performed in A; ****p≤0.0001. Kcnj10 was upregulated during OL differentiation, and expression significantly suppressed in purified and immunopanned OPCs (ctrl: n = 3, cKO-1: n = 3) and OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice (B). Conversely, Kcnj16 was not downregulated in OPCs (ctrl: n = 3, cKO-1: n = 3) and OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice in vitro, however, note Kcnj16 downregulation during OPC-OL maturation (C). Cacna1c mRNA levels were increased in cultured OPCs (ctrl: n = 3, cKO-1: n = 3) but not OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice suggesting a partial activation of Cav1.2 channels in OPCs (D). One-way ANOVA with Tukey’s multiple comparison tests were performed in B–D; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. No difference in outer tongue Kir4.1 IEM labeling between controls and ON cKO-1 tissue (E). Trend towards decreased Kir4.1 IEM labeling in cKO-2 ON tissue as compared to controls with respect to myelin compartments but not AS fibers (F). Background IEM labeling without primary antibody confirmed specificity of Kir4.1 IEM antibody labeling of myelin compartments and astrocyte fibers (G). Mann-Whitney tests were performed in E–G; ****p≤0.0001, p=0.8 (E, outer tongue IEM), p=0.07 (F, inner tongue IEM), p=0.6 (F, compact myelin IEM), p=0.3 (F, outer tongue IEM), p=0.81 (F, AS fiber IEM), p=0.12 (G, compact myelin IEM), p=0.08 (G, outer tongue IEM), p=0.03 (G, AS fiber IEM). Data are presented as mean ±s.e.m in A–G.

Kcnj10-deficient OPCs exhibited less BrdU incorporation in spinal cord tissue of P1 mice suggesting precocious exit from the cell cycle (ctrl: n = 4, cKO-1: n = 4; A). Likewise, purified and immunopanned Kcnj10-deficient OPCs exhibited less EdU incorporation but no difference in the mitosis marker phospho-histone H3 (pH3) in-vitro (ctrl: n = 3, cKO-1: n = 3; B). cKO-1 mice showed enhanced myelination in spinal cord WM at P1 by Mbp IHC (ctrl: n = 4, cKO-1: n = 4; C), and Kcnj10-deficient OLs showed more myelination during differentiating culture conditions in-vitro (ctrl: n = 4, cKO-1: n = 4; D). Mann-Whitney tests were performed in A–D; *p≤0.05, ***p≤0.001. Transcript levels for Cdk1 and Cdk2 were not different between control and Kcnj10-deficient OPCs in-vitro, whereas mRNA levels for Uhrf1 and Nkx2-2 were reduced in Kcnj10-deficient OPCs (ctrl: n = 3, cKO: n = 3; E). Note transcript levels for Nkx2-2 and Cnp were not different between control and Kcnj10-deficient OLs in-vitro after switching to differentiating culture conditions, however, Mbp mRNA levels increased in Kir4.1-deficient OPCs (ctrl: n = 3, cKO-1: n = 3; F). Multiple t tests were performed in E–F; **p≤0.01, ***p≤0.001; E: p=0.25 (Cdk1), p=0.88 (Cdk2) and F): p=0.97 (Nkx2-2), p=0.42 (Cnp). Data are presented as mean ±s.e.m in A–F.

Figure 1—figure supplement 1.

Validation of OL-encoded Kcnj10 cKO efficiency

Kir4.1 channels were efficiently ablated from ON OLs in cKO-1 (n = 5) and cKO-2 (n = 4) mice versus control ONs (n = 5; A). One-way ANOVA with Tukey’s multiple comparisons test was performed in A; ****p≤0.0001. Kcnj10 was upregulated during OL differentiation, and expression significantly suppressed in purified and immunopanned OPCs (ctrl: n = 3, cKO-1: n = 3) and OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice (B). Conversely, Kcnj16 was not downregulated in OPCs (ctrl: n = 3, cKO-1: n = 3) and OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice in vitro, however, note Kcnj16 downregulation during OPC-OL maturation (C). Cacna1c mRNA levels were increased in cultured OPCs (ctrl: n = 3, cKO-1: n = 3) but not OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice suggesting a partial activation of Cav1.2 channels in OPCs (D). One-way ANOVA with Tukey’s multiple comparison tests were performed in B–D; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. No difference in outer tongue Kir4.1 IEM labeling between controls and ON cKO-1 tissue (E). Trend towards decreased Kir4.1 IEM labeling in cKO-2 ON tissue as compared to controls with respect to myelin compartments but not AS fibers (F). Background IEM labeling without primary antibody confirmed specificity of Kir4.1 IEM antibody labeling of myelin compartments and astrocyte fibers (G). Mann-Whitney tests were performed in E–G; ****p≤0.0001, p=0.8 (E, outer tongue IEM), p=0.07 (F, inner tongue IEM), p=0.6 (F, compact myelin IEM), p=0.3 (F, outer tongue IEM), p=0.81 (F, AS fiber IEM), p=0.12 (G, compact myelin IEM), p=0.08 (G, outer tongue IEM), p=0.03 (G, AS fiber IEM). Data are presented as mean ±s.e.m in A–G.

OL-Kir4.1 is upregulated during postnatal development and localized to peri-axonal spaces.

Kir4.1 ON protein levels were upregulated between age P40 and P140, whereas Kir5.1 protein levels did not change during aging (A–B). Note substantial loss of Kir4.1 protein in Olig2-cre driven Kcnj10 cKO (cKO-1) mice at P40, which became more apparent at P140; Kir5.1 protein was also reduced in cKO-1 ONs at P40 and P140 (control and cKO-1: n = 3 for all time points) (A–B). Quantification of Kir4.1+ Apc+ OLs confirmed age-dependent upregulation of OL-Kir4.1 channels between P40 and P140 (n = 4 for all time points) (C). One-way ANOVA with Tukey’s multiple comparison tests were performed in B and C; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. Kir4.1 channels were lost from both ON OL cell bodies in cKO-1 and Cnp-cre driven Kcnj10 cKO (cKO-2) mice versus controls (D). Note that Kir4.1+ OL are marked by magenta-colored arrowhead; Apc+ OLs are indicated by green arrowheads. Note AS Kir4.1 immunoreactivity and contacts of Kir4.1+ AS fibers with OLs (white arrowheads). Merged images are shown in panels highlighted by yellow surroundings (D). Kir4.1 was strongly expressed in OLs along spinal fiber tracts; note that cyan-colored arrowheads mark juxta-axonal Kir4.1 IR (E). Kir4.1 immunogold electron microscopy (IEM) labeling revealed presence of gold particles at inner and outer myelin tongue (cyan-colored arrowheads) and within AS fibers (magenda-colored arrowheads) adjacent to myelin sheaths (M = myelin) and blood vessels (BV = blood vessel; ctrl: n = 3, cKO-1: n = 3; F–G). Axon structures are highlighted in yellow, AS fibers are highlighted in magenta. Note decrease in inner tongue (F) but not compact myelin (F) or AS fiber (G) IEM labeling in cKO-1 ON tissue versus controls. Cartoon highlights proposed mechanism of glial K+ siphoning from axons during saltatory conduction towards blood vessels via a network of axonal Kv and glial Kir4.1 channels (H). Mann-Whitney tests were performed in F–G; ***p≤0.001, p=0.06 (F, compact myelin IEM), p=0.74 (G, AS fiber IEM). Data are presented as mean ±s.e.m in B–C and F–G.

Validation of OL-encoded Kcnj10 cKO efficiency

Kir4.1 channels were efficiently ablated from ON OLs in cKO-1 (n = 5) and cKO-2 (n = 4) mice versus control ONs (n = 5; A). One-way ANOVA with Tukey’s multiple comparisons test was performed in A; ****p≤0.0001. Kcnj10 was upregulated during OL differentiation, and expression significantly suppressed in purified and immunopanned OPCs (ctrl: n = 3, cKO-1: n = 3) and OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice (B). Conversely, Kcnj16 was not downregulated in OPCs (ctrl: n = 3, cKO-1: n = 3) and OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice in vitro, however, note Kcnj16 downregulation during OPC-OL maturation (C). Cacna1c mRNA levels were increased in cultured OPCs (ctrl: n = 3, cKO-1: n = 3) but not OLs (ctrl: n = 3, cKO-1: n = 3) from cKO-1 mice suggesting a partial activation of Cav1.2 channels in OPCs (D). One-way ANOVA with Tukey’s multiple comparison tests were performed in B–D; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. No difference in outer tongue Kir4.1 IEM labeling between controls and ON cKO-1 tissue (E). Trend towards decreased Kir4.1 IEM labeling in cKO-2 ON tissue as compared to controls with respect to myelin compartments but not AS fibers (F). Background IEM labeling without primary antibody confirmed specificity of Kir4.1 IEM antibody labeling of myelin compartments and astrocyte fibers (G). Mann-Whitney tests were performed in E–G; ****p≤0.0001, p=0.8 (E, outer tongue IEM), p=0.07 (F, inner tongue IEM), p=0.6 (F, compact myelin IEM), p=0.3 (F, outer tongue IEM), p=0.81 (F, AS fiber IEM), p=0.12 (G, compact myelin IEM), p=0.08 (G, outer tongue IEM), p=0.03 (G, AS fiber IEM). Data are presented as mean ±s.e.m in A–G.

Early developmental changes in OL-encoded Kcnj10 loss-of-function

Kcnj10-deficient OPCs exhibited less BrdU incorporation in spinal cord tissue of P1 mice suggesting precocious exit from the cell cycle (ctrl: n = 4, cKO-1: n = 4; A). Likewise, purified and immunopanned Kcnj10-deficient OPCs exhibited less EdU incorporation but no difference in the mitosis marker phospho-histone H3 (pH3) in-vitro (ctrl: n = 3, cKO-1: n = 3; B). cKO-1 mice showed enhanced myelination in spinal cord WM at P1 by Mbp IHC (ctrl: n = 4, cKO-1: n = 4; C), and Kcnj10-deficient OLs showed more myelination during differentiating culture conditions in-vitro (ctrl: n = 4, cKO-1: n = 4; D). Mann-Whitney tests were performed in A–D; *p≤0.05, ***p≤0.001. Transcript levels for Cdk1 and Cdk2 were not different between control and Kcnj10-deficient OPCs in-vitro, whereas mRNA levels for Uhrf1 and Nkx2-2 were reduced in Kcnj10-deficient OPCs (ctrl: n = 3, cKO: n = 3; E). Note transcript levels for Nkx2-2 and Cnp were not different between control and Kcnj10-deficient OLs in-vitro after switching to differentiating culture conditions, however, Mbp mRNA levels increased in Kir4.1-deficient OPCs (ctrl: n = 3, cKO-1: n = 3; F). Multiple t tests were performed in E–F; **p≤0.01, ***p≤0.001; E: p=0.25 (Cdk1), p=0.88 (Cdk2) and F): p=0.97 (Nkx2-2), p=0.42 (Cnp). Data are presented as mean ±s.e.m in A–F. To understand spatial expression of OL-Kir4.1 channels in WM tracts, we studied longitudinal ON and spinal cord sections by high-resolution confocal microscopy and performed immunogold labeling of Kir4.1 channels in ON sections by electron microscopy (Figure 1E–F). Using antibodies either against an extracellular or intracellular Kir4.1 epitope, we could determine that OL-Kir4.1 channels are localized towards perinodal and juxta-axonal regions such as the inner tongue of myelin sheaths. Quantification of immunogold particles in ON sections using the Kir4.1 antibody against the intracellular epitope of the channel revealed a substantial decrease in inner but not outer tongue labeling in both Olig2-cre and Cnp-cre cKO lines as compared to controls (Figure 1F, Figure 1—figure supplement 1E–F). Using a no-antibody control labeling, we could confirm specificity of the Kir4.1 labeling to myelin compartments and AS fibers (Figure 1—figure supplement 1G). In WM AS, Kir4.1 immunogold particles were abundant in fibers and particular seen in processes in contact to the outer myelin tongue, in perivascular end feet and adjacent to the node of Ranvier (Figure 1F–G). Thus, the age-dependent and specific spatial expression pattern of glial Kir4.1 channels provides more evidence for a role of those channels in extracellular K+ buffering during electric activity along WM fiber tracts (Figure 1H).

OL-Kir4.1 regulates but is not required for OL differentiation and early postnatal myelination

To investigate a role of OL-Kir4.1 in OL development, we compared OPC differentiation under control and Kcnj10 loss-of-function conditions. We found that OPCs lacking Kcnj10 exhibited precocious cell cycle exits as shown by decreased numbers of dividing cells (Figure 1—figure supplement 2A–B) and earlier onset of myelin production (Figure 1—figure supplement 2C–D). In addition, we found decreased mRNA levels of cell cycle and progenitor cell markers, such as Uhrf1 and Nkx2-2 in OPCs and conversely observed increased myelin basic protein (Mbp) mRNA levels in OLs in vitro (Figure 1—figure supplement 2E–F) (Magri et al., 2014). Mice deficient in OL-encoded Kcnj10 had normal g-ratios in ON tissue at P40 (Figure 2A–B); however, they showed slightly smaller g-ratios in spinal WM tracts corresponding to thicker myelin sheaths (Figure 2—figure supplement 1B–C). Axonal diameters were not different in both ON and spinal WM samples at P40 (Figure 2C, Figure 2—figure supplement 1C). The morphology of intra-axonal mitochondria with respect to circularity and density of mitochondria was not different in the ON and spinal cord WM between control and Kcnj10 cKO mice at P40 (Figure 2C, Figure 2—figure supplement 1A,D). Notably, the density of mature Apc+ Olig2+ OLs was transiently higher in Kcnj10 cKO mice at P40, however, normalized during adulthood (Figure 2D–E). These results suggest that OL-Kir4.1 is involved in regulating cell cycle exit and OL differentiation during early postnatal development but is not a requirement for normal myelination.
Figure 1—figure supplement 2.

Early developmental changes in OL-encoded Kcnj10 loss-of-function

Kcnj10-deficient OPCs exhibited less BrdU incorporation in spinal cord tissue of P1 mice suggesting precocious exit from the cell cycle (ctrl: n = 4, cKO-1: n = 4; A). Likewise, purified and immunopanned Kcnj10-deficient OPCs exhibited less EdU incorporation but no difference in the mitosis marker phospho-histone H3 (pH3) in-vitro (ctrl: n = 3, cKO-1: n = 3; B). cKO-1 mice showed enhanced myelination in spinal cord WM at P1 by Mbp IHC (ctrl: n = 4, cKO-1: n = 4; C), and Kcnj10-deficient OLs showed more myelination during differentiating culture conditions in-vitro (ctrl: n = 4, cKO-1: n = 4; D). Mann-Whitney tests were performed in A–D; *p≤0.05, ***p≤0.001. Transcript levels for Cdk1 and Cdk2 were not different between control and Kcnj10-deficient OPCs in-vitro, whereas mRNA levels for Uhrf1 and Nkx2-2 were reduced in Kcnj10-deficient OPCs (ctrl: n = 3, cKO: n = 3; E). Note transcript levels for Nkx2-2 and Cnp were not different between control and Kcnj10-deficient OLs in-vitro after switching to differentiating culture conditions, however, Mbp mRNA levels increased in Kir4.1-deficient OPCs (ctrl: n = 3, cKO-1: n = 3; F). Multiple t tests were performed in E–F; **p≤0.01, ***p≤0.001; E: p=0.25 (Cdk1), p=0.88 (Cdk2) and F): p=0.97 (Nkx2-2), p=0.42 (Cnp). Data are presented as mean ±s.e.m in A–F.

Figure 2.

OL-Kir4.1 regulates early OL differentiation but is dispensable for myelination.

Early developmental loss of OL-Kcnj10 did not affect myelin sheath thickness or axon diameters in ONs from animals at P40 (210 axons from 4 control mice, 202 axons from 4 cKO-1 mice; A–C). Densities of intra-axonal mitochondria were not different between control and cKO-1 ONs at P40 (81 axons from 4 control mice, 77 axons from 4 Kcnj10 cKO-1 mice; C). Mann-Whitney test was performed in B–C; p=0.49 (g-ratios, B), p=0.89 (axon diameter, C) and p=0.89 (mitochondria density, C). Immunostaining for Olig2 (pan-lineage marker for OPC/OL cells) and Apc (OL maturation marker) demonstrated precocious OL differentiation in cKO-1 ONs at P40 versus P80 and P140 (D–E). Two-way ANOVA with Sidak’s multiple comparison test was performed in E; **p≤0.01. Data are presented as mean ±s.e.m in B, C and E.

Intra-axonal mitochondria did not differ with respect to circularity and numbers per individual axon between ON tissue from control and cKO-1 mice (210 axons from 4 control mice, 202 axons from 4 cKO-1 mice; A). Mann-Whitney test was performed in A; p=0.31 (mitochondria circularity) and p=0.69 (mitochondria counts/axon). In line with ON results, spinal cord WM axon diameters and intra-axonal mitochondrial parameters (density, numbers/axon) were not different between cKO-1 mice and control littermates at P40 (191 axons from control mice, 193 axons from 4 cKO-1 mice; (B–D). Of note, g-ratios were slightly smaller in cKO-1 mice corresponding to thicker myelin sheaths in spinal cord axons at P40. Mann-Whitney tests were performed in A and C–D; *p≤0.05, p=0.31 (mitochondrial circularity, A), p=0.2 (mitochondria counts/axon, A), p=0.68 (axon diameters, C), p=0.49 (mitochondria density, D), p=0.2 (mitochondria counts/axon, D). Data are presented as mean ±s.e.m in A and C–D.

Figure 2—figure supplement 1.

Early white matter changes in OL-encoded Kcnj10 loss-of-function

Intra-axonal mitochondria did not differ with respect to circularity and numbers per individual axon between ON tissue from control and cKO-1 mice (210 axons from 4 control mice, 202 axons from 4 cKO-1 mice; A). Mann-Whitney test was performed in A; p=0.31 (mitochondria circularity) and p=0.69 (mitochondria counts/axon). In line with ON results, spinal cord WM axon diameters and intra-axonal mitochondrial parameters (density, numbers/axon) were not different between cKO-1 mice and control littermates at P40 (191 axons from control mice, 193 axons from 4 cKO-1 mice; (B–D). Of note, g-ratios were slightly smaller in cKO-1 mice corresponding to thicker myelin sheaths in spinal cord axons at P40. Mann-Whitney tests were performed in A and C–D; *p≤0.05, p=0.31 (mitochondrial circularity, A), p=0.2 (mitochondria counts/axon, A), p=0.68 (axon diameters, C), p=0.49 (mitochondria density, D), p=0.2 (mitochondria counts/axon, D). Data are presented as mean ±s.e.m in A and C–D.

OL-Kir4.1 regulates early OL differentiation but is dispensable for myelination.

Early developmental loss of OL-Kcnj10 did not affect myelin sheath thickness or axon diameters in ONs from animals at P40 (210 axons from 4 control mice, 202 axons from 4 cKO-1 mice; A–C). Densities of intra-axonal mitochondria were not different between control and cKO-1 ONs at P40 (81 axons from 4 control mice, 77 axons from 4 Kcnj10 cKO-1 mice; C). Mann-Whitney test was performed in B–C; p=0.49 (g-ratios, B), p=0.89 (axon diameter, C) and p=0.89 (mitochondria density, C). Immunostaining for Olig2 (pan-lineage marker for OPC/OL cells) and Apc (OL maturation marker) demonstrated precocious OL differentiation in cKO-1 ONs at P40 versus P80 and P140 (D–E). Two-way ANOVA with Sidak’s multiple comparison test was performed in E; **p≤0.01. Data are presented as mean ±s.e.m in B, C and E.

Early white matter changes in OL-encoded Kcnj10 loss-of-function

Intra-axonal mitochondria did not differ with respect to circularity and numbers per individual axon between ON tissue from control and cKO-1 mice (210 axons from 4 control mice, 202 axons from 4 cKO-1 mice; A). Mann-Whitney test was performed in A; p=0.31 (mitochondria circularity) and p=0.69 (mitochondria counts/axon). In line with ON results, spinal cord WM axon diameters and intra-axonal mitochondrial parameters (density, numbers/axon) were not different between cKO-1 mice and control littermates at P40 (191 axons from control mice, 193 axons from 4 cKO-1 mice; (B–D). Of note, g-ratios were slightly smaller in cKO-1 mice corresponding to thicker myelin sheaths in spinal cord axons at P40. Mann-Whitney tests were performed in A and C–D; *p≤0.05, p=0.31 (mitochondrial circularity, A), p=0.2 (mitochondria counts/axon, A), p=0.68 (axon diameters, C), p=0.49 (mitochondria density, D), p=0.2 (mitochondria counts/axon, D). Data are presented as mean ±s.e.m in A and C–D.

OL-Kir4.1 is critical for normal motor and visual function in the adult CNS

We next investigated roles of OL-Kir4.1 during adulthood for maintenance of WM integrity in Olig2-cre driven Kcnj10-cKO-1 and Cnp-cre driven Kcnj10-cKO-2 mice and corresponding littermate controls up to 6 months of age. Both Kcnj10-cKO lines exhibited progressive neurological symptoms including abnormal gait and ataxia (Video 1), generalized seizures (Video 2) and hindlimb clasping (Videos 3 and 4) starting as early as three months of age. Early lethality by 6 months of age, most likely due to complications of epileptic seizures, was observed in ~70% of Cnp-cre and ~40% in Olig2-cre driven Kcnj10 cKO mice (Figure 3A) (Larson et al., 2018). Higher seizure frequencies were a common feature of both cKO lines with increasing age, in keeping with prior findings (Djukic et al., 2007; Larson et al., 2018). All cKO mice showed reduced body weights versus control littermates at P140 (Figure 3B), and we found motor dysfunction as shown by reduced rotarod performance in both cKO cohorts at P140 (Figure 3C).
Video 1.

Ataxia and motor dysfunction are progressive symptoms in OL-Kcnj10 cKO mice.

Video shows gait ataxia in OL-Kcnj10 cKO mouse (left) as compared to littermate control (right) at P140.

Video 2.

Seizures are common and progressive in adult OL-Kcnj10 cKO mice.

Video shows generalized seizure in OL-Kcnj10 cKO mouse at P140.

Video 3.

Hind limb clasping is characteristic in adult OL-Kcnj10 cKO mice.

Video 3 shows hind limb clasping as typical sign of motor dysfunction in OL-Kcnj10 cKO mice compared to Video 4 without presence of hind limb clasping in a control mouse at P140.

Video 4.

Hind limb clasping is not typical in normal adult mice.

Video 4 shows that hind limb clasping is not typical in an adult control mice.

Figure 3.

OL-Kir4.1 controls motor performance and visual function in adult mice.

Mice lacking OL-Kir4.1 channels had increased mortality with survival rates of 96% in the control group (n = 29), 54% in cKO-1 (n = 13) and only 33% in cKO-2 (n = 9) mice at P180 (A). Log-rank (Mantel-Cox) test was performed and p-value shown in A. Kcnj10 cKO-1 (n = 10) and cKO-2 (n = 9) mice were significantly smaller than control littermates (n = 30) at P140 (B). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in B; **p≤0.01, ***p≤0.001. Motor dysfunction with reduced rotarod performance has been observed in both cKO-1 (n = 7) and cKO-2 (n = 7) mice as compared to controls (n = 21) (C). Two-way ANOVA with Tukey’s multiple comparisons test was performed in C; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. Visual function was measured by single-flash light VEP recordings from control and Kcnj10 cKO mice (D–E). VEPs were delayed in cKO-1 (n = 7) and cKO-2 (n = 4) mice versus controls (n = 14) (E). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in E; *p≤0.05. Retina integrity was measured by OCT imaging at P140 and revealed IRL thinning in cKO-1 (n = 5) and cKO-2 (n = 4) mice as compared to controls (n = 15; F). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in F; *p≤0.05, ***p≤0.001.

OL-Kir4.1 controls motor performance and visual function in adult mice.

Mice lacking OL-Kir4.1 channels had increased mortality with survival rates of 96% in the control group (n = 29), 54% in cKO-1 (n = 13) and only 33% in cKO-2 (n = 9) mice at P180 (A). Log-rank (Mantel-Cox) test was performed and p-value shown in A. Kcnj10 cKO-1 (n = 10) and cKO-2 (n = 9) mice were significantly smaller than control littermates (n = 30) at P140 (B). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in B; **p≤0.01, ***p≤0.001. Motor dysfunction with reduced rotarod performance has been observed in both cKO-1 (n = 7) and cKO-2 (n = 7) mice as compared to controls (n = 21) (C). Two-way ANOVA with Tukey’s multiple comparisons test was performed in C; *p≤0.05, **p≤0.01, ***p≤0.001, ****p≤0.0001. Visual function was measured by single-flash light VEP recordings from control and Kcnj10 cKO mice (D–E). VEPs were delayed in cKO-1 (n = 7) and cKO-2 (n = 4) mice versus controls (n = 14) (E). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in E; *p≤0.05. Retina integrity was measured by OCT imaging at P140 and revealed IRL thinning in cKO-1 (n = 5) and cKO-2 (n = 4) mice as compared to controls (n = 15; F). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in F; *p≤0.05, ***p≤0.001.

Ataxia and motor dysfunction are progressive symptoms in OL-Kcnj10 cKO mice.

Video shows gait ataxia in OL-Kcnj10 cKO mouse (left) as compared to littermate control (right) at P140.

Seizures are common and progressive in adult OL-Kcnj10 cKO mice.

Video shows generalized seizure in OL-Kcnj10 cKO mouse at P140.

Hind limb clasping is characteristic in adult OL-Kcnj10 cKO mice.

Video 3 shows hind limb clasping as typical sign of motor dysfunction in OL-Kcnj10 cKO mice compared to Video 4 without presence of hind limb clasping in a control mouse at P140.

Hind limb clasping is not typical in normal adult mice.

Video 4 shows that hind limb clasping is not typical in an adult control mice. To investigate visual functions in live animals, we recorded single-flash light visual evoked potentials (VEPs) from anesthetized mice to measure conduction along the visual system. VEP has proven to be a useful method to study ON function in neurological patients with optic neuritis, such as multiple sclerosis (MS) (Ridder and Nusinowitz, 2006; Graham and Klistorner, 2017; Kraft, 2013). Here, both Kcnj10 cKO lines had delayed VEP latencies at P140 (Figure 3D–E) indicating dysfunction in the visual system. In addition, we studied structural changes in the retina of live animals utilizing optical coherence tomography (OCT), where the thickness of specific retinal layers can be used as a surrogate for retinal ganglion cell (RGC) survival. Indeed, OCT imaging showed thinning of inner retinal layers (IRL) in cKO mice at P140 revealing a reduction in the number of ganglion cells and their corresponding axons (Figure 3F) (Cruz-Herranz et al., 2016). In summary, permanent loss-of-Kcnj10 function in OLs results in visual dysfunction with retinal atrophy in adult mice as well as motor deficits and early mortality.

OL-Kir4.1 is required for maintenance of WM integrity and late neuronal survival

We observed decreased Mbp protein levels, a critical myelin component, in ON and spinal cord lysates from 6 month old Kcnj10 cKO mice, which could explain the delayed VEP latencies observed in older animals (Figure 4A, Figure 4—figure supplement 1B–C). A substantial loss of Kir4.1 protein could be detected in Kcnj10 cKO ON and spinal cord tissue at P180 confirming robust knockout efficiency at that age (Figure 4A, Figure 4—figure supplement 1A–C). Additionally, at ultrastructural level, we observed disorganization of WM tracts (Figure 4—figure supplement 1D) and loss of myelin compactness in a subset of axons as well as evidence for axonal degeneration in Olig2-cre driven Kcnj10 cKO ON and spinal cord tissue at P140 (Figure 4B, Figure 4—figure supplement 1E). Are these results OL-specific or general to glial encoded-Kir4.1 function? To address this, we investigated Aldh1l1-cre driven Kcnj10 cKO that specifically deleted the Kir4.1 allele in AS of the spinal cord (Kelley et al., 2018). In contrast to findings above, those AS-specific cKO mice did not show spinal WM tract abnormalities (Figure 4—figure supplement 1E) indicating specificity of OL-mediated Kir4.1 functions.
Figure 4.

OL-Kir4.1 has a critical role in WM integrity and long-term maintenance.

Myelin basic protein (Mbp) was decreased in ON lysates from cKO-1 (n = 4) mice versus controls (n = 4) at P180 (A). Mann-Whitney test was performed in A; *p≤0.05. Transmission electron microscopy demonstrated WM pathology with presence of degenerating (highlighted in yellow) and damaged axons of mild (highlighted in blue) and more pronounced severity (green highlight) at P140 (B). Axons were larger in cKO-1 versus control ONs at P140 (146 axons from 4 control mice, 139 axons from 4 cKO mice; C). Intra-axonal mitochondria were more circular as a proxy for swelling and dysfunction in cKO-1 mice ONs as compared to controls at P140 (86 axons from four control mice, 73 axons from 4 cKO mice; C). Mann-Whitney tests were performed in C; *p≤0.05. Numbers of physiological SMI312+ (phosphorylated neurofilaments) axon profiles were reduced in ONs from cKO-1 (n = 5) and cKO-2 (n = 4) versus controls (n = 5; D), and numbers of dystrophic SMI32+ (non-phosphorylated neurofilaments) axons were increased in ONs from cKO-2 (n = 4) versus control (n = 5) and cKO-1 (n = 5) mice (E). Kruskal-Wallis with Dunn’s multiple comparisons tests were performed in D and E; **p≤0.01, ***p≤0.001, ****p≤0.0001. Iba1+ microglia activation was a common feature in ONs from cKO-1 (n = 5) and cKO-2 (n = 4) versus control (n = 5) mice (F–G). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in G; *p≤0.05. Note microglial cell (highlighted in magenta) adjacent to dystrophic axons in cKO-1 ON (F). Astrogliosis as indicated by increased Gfap IR was enhanced in cKO-1 (n = 5) and cKO-2 (n = 4) ONs versus controls (n = 5) (H). One-way ANOVA with Tukey’s multiple comparison test was performed in H; *p≤0.05, ***p≤0.001. Reduced densities of Brn3a+ RGCs in cKO-1 (n = 7) and cKO-2 (n = 2) versus control mice (n = 10) were indicative of retrograde retinal neurodegeneration (I–J). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in J; *p≤0.05. Cartoon highlights pathological changes in the retina of Kcnj10 cKO versus control mice with retrograde ‘dying back’ degeneration of RGCs and compensatory upregulation of Kir4.1 in retinal glial cells of Kcnj10 cKO mice (K). Data are presented as mean ±s.e.m in A, C, D–E, G–H and J.

Note Kir4.1 protein levels were significantly reduced in ONs from cKO-1 mice at P180 (ctrl: n = 4, cKO-1: n = 4; A). Likewise, Kir4.1 protein levels were substantially decreased in spinal cord tissue from cKO-1 mice at P180 (B–C); note that Mbp protein levels are slightly reduced, but not significantly different between control and OL-Kcnj10 cKO-1 animals (ctrl: n = 4, cKO-1: n = 4; B–C); Mann-Whitney tests were performed in A and C; *p≤0.05, p=0.06 (Mbp, C). Representative toluidine blue staining of control and cKO-1 spinal WM at P140 (D); note disorganized WM tracts in Kcnj10 cKO mice. By electron microscopy, dystrophic myelin and altered axonal integrity was observed in spinal WM tracts of OL-specific cKO-1 but not in control or AS-specific Kcnj10 cKO (Aldh1l1-cre) mice (E). At P140, g-ratios (146 axons from 4 control mice, 139 axons from 4 cKO-1 mice), densities and counts of intra-axonal mitochondria (73 axons from 4 control mice, 86 axons from 4 cKO-1 mice) were not altered in ONs between control and cKO-1 mice (F–G). Mann-Whitney tests were performed in F–G; p=0.18 (g-ratios, F), p=0.23 (mitochondrial densities, G) and p=0.20 (mitochondria/axon, G).

Cartoon shows cross-section of inner retinal layers with glial cells expressing Kir4.1 (A); note that Kir4.1 immunoreactivity was increased in inner retinal layers of cKO-1 mice at P180 (B–C). Conversely, IRs for Gfap (B–C), Aqp4 (D–E) and Iba1 (F–G) were not different in retinal layers between control and cKO-1 mice at P180 (ctrl: n = 3, cKO: n = 3; A–F). Mann-Whitney tests were performed in C, E and G; *p≤0.05, p=0.1 (Gfap, C), p=0.2 (Aqp4, E), p=0.7 (Iba1, G). Data are presented as mean ±s.e.m in C, E and G.

Figure 4—figure supplement 1.

Long-term white matter pathologies in chronic OL-encoded Kcnj10 loss of function

Note Kir4.1 protein levels were significantly reduced in ONs from cKO-1 mice at P180 (ctrl: n = 4, cKO-1: n = 4; A). Likewise, Kir4.1 protein levels were substantially decreased in spinal cord tissue from cKO-1 mice at P180 (B–C); note that Mbp protein levels are slightly reduced, but not significantly different between control and OL-Kcnj10 cKO-1 animals (ctrl: n = 4, cKO-1: n = 4; B–C); Mann-Whitney tests were performed in A and C; *p≤0.05, p=0.06 (Mbp, C). Representative toluidine blue staining of control and cKO-1 spinal WM at P140 (D); note disorganized WM tracts in Kcnj10 cKO mice. By electron microscopy, dystrophic myelin and altered axonal integrity was observed in spinal WM tracts of OL-specific cKO-1 but not in control or AS-specific Kcnj10 cKO (Aldh1l1-cre) mice (E). At P140, g-ratios (146 axons from 4 control mice, 139 axons from 4 cKO-1 mice), densities and counts of intra-axonal mitochondria (73 axons from 4 control mice, 86 axons from 4 cKO-1 mice) were not altered in ONs between control and cKO-1 mice (F–G). Mann-Whitney tests were performed in F–G; p=0.18 (g-ratios, F), p=0.23 (mitochondrial densities, G) and p=0.20 (mitochondria/axon, G).

OL-Kir4.1 has a critical role in WM integrity and long-term maintenance.

Myelin basic protein (Mbp) was decreased in ON lysates from cKO-1 (n = 4) mice versus controls (n = 4) at P180 (A). Mann-Whitney test was performed in A; *p≤0.05. Transmission electron microscopy demonstrated WM pathology with presence of degenerating (highlighted in yellow) and damaged axons of mild (highlighted in blue) and more pronounced severity (green highlight) at P140 (B). Axons were larger in cKO-1 versus control ONs at P140 (146 axons from 4 control mice, 139 axons from 4 cKO mice; C). Intra-axonal mitochondria were more circular as a proxy for swelling and dysfunction in cKO-1 mice ONs as compared to controls at P140 (86 axons from four control mice, 73 axons from 4 cKO mice; C). Mann-Whitney tests were performed in C; *p≤0.05. Numbers of physiological SMI312+ (phosphorylated neurofilaments) axon profiles were reduced in ONs from cKO-1 (n = 5) and cKO-2 (n = 4) versus controls (n = 5; D), and numbers of dystrophic SMI32+ (non-phosphorylated neurofilaments) axons were increased in ONs from cKO-2 (n = 4) versus control (n = 5) and cKO-1 (n = 5) mice (E). Kruskal-Wallis with Dunn’s multiple comparisons tests were performed in D and E; **p≤0.01, ***p≤0.001, ****p≤0.0001. Iba1+ microglia activation was a common feature in ONs from cKO-1 (n = 5) and cKO-2 (n = 4) versus control (n = 5) mice (F–G). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in G; *p≤0.05. Note microglial cell (highlighted in magenta) adjacent to dystrophic axons in cKO-1 ON (F). Astrogliosis as indicated by increased Gfap IR was enhanced in cKO-1 (n = 5) and cKO-2 (n = 4) ONs versus controls (n = 5) (H). One-way ANOVA with Tukey’s multiple comparison test was performed in H; *p≤0.05, ***p≤0.001. Reduced densities of Brn3a+ RGCs in cKO-1 (n = 7) and cKO-2 (n = 2) versus control mice (n = 10) were indicative of retrograde retinal neurodegeneration (I–J). Kruskal-Wallis with Dunn’s multiple comparisons test was performed in J; *p≤0.05. Cartoon highlights pathological changes in the retina of Kcnj10 cKO versus control mice with retrograde ‘dying back’ degeneration of RGCs and compensatory upregulation of Kir4.1 in retinal glial cells of Kcnj10 cKO mice (K). Data are presented as mean ±s.e.m in A, C, D–E, G–H and J.

Long-term white matter pathologies in chronic OL-encoded Kcnj10 loss of function

Note Kir4.1 protein levels were significantly reduced in ONs from cKO-1 mice at P180 (ctrl: n = 4, cKO-1: n = 4; A). Likewise, Kir4.1 protein levels were substantially decreased in spinal cord tissue from cKO-1 mice at P180 (B–C); note that Mbp protein levels are slightly reduced, but not significantly different between control and OL-Kcnj10 cKO-1 animals (ctrl: n = 4, cKO-1: n = 4; B–C); Mann-Whitney tests were performed in A and C; *p≤0.05, p=0.06 (Mbp, C). Representative toluidine blue staining of control and cKO-1 spinal WM at P140 (D); note disorganized WM tracts in Kcnj10 cKO mice. By electron microscopy, dystrophic myelin and altered axonal integrity was observed in spinal WM tracts of OL-specific cKO-1 but not in control or AS-specific Kcnj10 cKO (Aldh1l1-cre) mice (E). At P140, g-ratios (146 axons from 4 control mice, 139 axons from 4 cKO-1 mice), densities and counts of intra-axonal mitochondria (73 axons from 4 control mice, 86 axons from 4 cKO-1 mice) were not altered in ONs between control and cKO-1 mice (F–G). Mann-Whitney tests were performed in F–G; p=0.18 (g-ratios, F), p=0.23 (mitochondrial densities, G) and p=0.20 (mitochondria/axon, G).

Long-term retinal changes in chronic OL-encoded Kcnj10 loss-of-function

Cartoon shows cross-section of inner retinal layers with glial cells expressing Kir4.1 (A); note that Kir4.1 immunoreactivity was increased in inner retinal layers of cKO-1 mice at P180 (B–C). Conversely, IRs for Gfap (B–C), Aqp4 (D–E) and Iba1 (F–G) were not different in retinal layers between control and cKO-1 mice at P180 (ctrl: n = 3, cKO: n = 3; A–F). Mann-Whitney tests were performed in C, E and G; *p≤0.05, p=0.1 (Gfap, C), p=0.2 (Aqp4, E), p=0.7 (Iba1, G). Data are presented as mean ±s.e.m in C, E and G. We further characterized WM pathologies and examined morphological features of ON and spinal WM intra-axonal mitochondria by electron microscopy. At P140, we noted enlarged axons in Olig2-cre driven Kcnj10 cKO ONs (Figure 4B,C) with g-ratios not different between control and cKO mice (Figure 4—figure supplement 1F). Densities and total counts of intra-axonal mitochondria did not change in cKO ONs as compared to controls (Figure 4—figure supplement 1G). However, we found evidence for mitochondrial swelling as shown by increased mitochondrial circularity in Olig2-cre driven Kcnj10 cKO ONs (Figure 4C). Immunostaining for neurofilaments (NFs) demonstrated loss of normally phosphorylated NFs (P- NF-H, SMI312+) in cKO ONs (Figure 4D) and an increase in non-phosphorylated NFs (non-P-NF-H, SMI32+) (Figure 4E), indicative of axon damage and increase in dystrophic axon numbers (Trapp et al., 1998; Schirmer et al., 2011). Axon pathology was accompanied by Iba1+ microglia activation in ONs from Olig2-cre driven Kcnj10 cKO animals (Figure 4F–G) and increased Gfap+ staining (Figure 4F,H). We confirmed loss of Brn3a+ RGCs through Brn3a staining of retinal whole mount preparations from both Kcnj10 cKO lines at P180 (Figure 4I–J), consistent with the OCT data (see above) indicating retrograde degeneration along the ON (Figure 4K) (Raff et al., 2002). In addition, by immunoreactivity retinal Gfap, Aqp4 and Iba1 levels were not significantly altered (Figure 4—figure supplement 2). However, we found increased Kir4.1 immunoreactivity in AS and Müller glia in Olig2-cre driven Kcnj10 cKO retinae, which could reflect reactive upregulation of Kir4.1 channels in those glial cells (Figure 4—figure supplement 2). Together, these findings demonstrate that OL-Kir4.1 plays a major role in long-term neuro-axonal maintenance and integrity of long WM tracts of the ON and spinal cord.
Figure 4—figure supplement 2.

Long-term retinal changes in chronic OL-encoded Kcnj10 loss-of-function

Cartoon shows cross-section of inner retinal layers with glial cells expressing Kir4.1 (A); note that Kir4.1 immunoreactivity was increased in inner retinal layers of cKO-1 mice at P180 (B–C). Conversely, IRs for Gfap (B–C), Aqp4 (D–E) and Iba1 (F–G) were not different in retinal layers between control and cKO-1 mice at P180 (ctrl: n = 3, cKO: n = 3; A–F). Mann-Whitney tests were performed in C, E and G; *p≤0.05, p=0.1 (Gfap, C), p=0.2 (Aqp4, E), p=0.7 (Iba1, G). Data are presented as mean ±s.e.m in C, E and G.

OL-Kir4.1 is essential for WM integrity after chronic but not acute demyelinating injury

To study the role of OL-Kir4.1 during acute and chronic remyelination after focal white matter injury, we utilized the lysolecithin glial toxic injury model in the spinal cord at P80 (Fancy et al., 2009; Fancy et al., 2011; Franklin and Ffrench-Constant, 2017). In the acute situation, 14 days post-lysolecithin-induced focal demyelination of spinal WM tracts (14 dpl, corresponding to P94), we found that axons in lesions from Olig2-cre driven Kcnj10 cKO animals harbored more mitochondria, which were significantly more swollen/circular than their control counterparts (Figure 5A–B). However, we observed that early remyelination efficiency and axon diameters were not altered with similar g-ratios in WM lesions from Olig2-cre driven Kcnj10 cKO mice and control littermates 14 dpl (Figure 5C, Figure 5—figure supplement 1A).
Figure 5.

OL-Kir4.1 is dispensable for remyelination, but critical for long-term axon maintenance after WM demyelinating injury.

OL-Kir4.1 function was studied in short- (A–C) and long-term remyelination (D–F) after lysolecithin-induced focal demyelination to ventrolateral spinal WM tracts. Mice were euthanized and perfused at two survival time points corresponding to days post lesioning (dpl, n = 4 for each time point and genotype): 14 dpl (corresponding to P94, representing new myelin sheath formation) and 60 dpl (corresponding to P140, full remyelination). Densities of intra-axonal mitochondria were increased in cKO-1 (176 axons from 4 mice) versus control animals (230 axons from 4 mice) at 14 dpl and circularity/swelling of intra-axonal mitochondria was higher in cKO-1 (79 axons from 4 mice) versus controls (141 axons from four mice; A-B). Note high-magnification images of representative mitochondria in A indicating enlarged mitochondria in axons from cKO-1 versus control lesioned tissue. Conversely, loss of OL-Kir4.1 did not affect g-ratios and axon diameters in cKO-1 (176 axons from 4 mice) versus control mice (230 axons from four mice) (C). At 60 dpl, cKO-1 mice exhibited pronounced WM damage during long-term remyelination with presence of enlarged and degenerating axons (highlighted in green and yellow) as well as increased numbers of swollen intra-axonal mitochondria (D). Numbers of intra-axonal mitochondria were increased in cKO-1 versus control mice 60 dpl but densities of mitochondria were not different due to enlargement of lesion axons and thus relative lower mitochondria densities in cKO-1 axons; intra-axonal mitochondria were more circular in cKO-1 (90 axons from 4 mice) mice as compared to controls (88 axons from 4 mice) at 60 dpl (E). Remyelination was efficient and not different between cKO-1 (139 axons from 4 mice) and control mice (152 axons from 4 mice) at 60 dpl, however, enlarged axons were observed in cKO-1 mice as compared to controls (F). Mann-Whitney tests were performed in B–C and E–F; *p≤0.05, p=0.69 (C). Data are presented as mean ±s.e.m in B–C and E–F.

No differences in g-ratios were observed in early (14dpl) and late (60dpl) remyelinating white matter lesions from control and cKO-1 mice.

Mann-Whitney tests were performed in A and B; p=0.34 (A and B). Data are presented as mean ±s.e.m in A and B.

Figure 5—figure supplement 1.

Short- and long term remyelination efficiencies in chronic OL-Kcnj10 loss-of-function 

No differences in g-ratios were observed in early (14dpl) and late (60dpl) remyelinating white matter lesions from control and cKO-1 mice.

Mann-Whitney tests were performed in A and B; p=0.34 (A and B). Data are presented as mean ±s.e.m in A and B.

OL-Kir4.1 is dispensable for remyelination, but critical for long-term axon maintenance after WM demyelinating injury.

OL-Kir4.1 function was studied in short- (A–C) and long-term remyelination (D–F) after lysolecithin-induced focal demyelination to ventrolateral spinal WM tracts. Mice were euthanized and perfused at two survival time points corresponding to days post lesioning (dpl, n = 4 for each time point and genotype): 14 dpl (corresponding to P94, representing new myelin sheath formation) and 60 dpl (corresponding to P140, full remyelination). Densities of intra-axonal mitochondria were increased in cKO-1 (176 axons from 4 mice) versus control animals (230 axons from 4 mice) at 14 dpl and circularity/swelling of intra-axonal mitochondria was higher in cKO-1 (79 axons from 4 mice) versus controls (141 axons from four mice; A-B). Note high-magnification images of representative mitochondria in A indicating enlarged mitochondria in axons from cKO-1 versus control lesioned tissue. Conversely, loss of OL-Kir4.1 did not affect g-ratios and axon diameters in cKO-1 (176 axons from 4 mice) versus control mice (230 axons from four mice) (C). At 60 dpl, cKO-1 mice exhibited pronounced WM damage during long-term remyelination with presence of enlarged and degenerating axons (highlighted in green and yellow) as well as increased numbers of swollen intra-axonal mitochondria (D). Numbers of intra-axonal mitochondria were increased in cKO-1 versus control mice 60 dpl but densities of mitochondria were not different due to enlargement of lesion axons and thus relative lower mitochondria densities in cKO-1 axons; intra-axonal mitochondria were more circular in cKO-1 (90 axons from 4 mice) mice as compared to controls (88 axons from 4 mice) at 60 dpl (E). Remyelination was efficient and not different between cKO-1 (139 axons from 4 mice) and control mice (152 axons from 4 mice) at 60 dpl, however, enlarged axons were observed in cKO-1 mice as compared to controls (F). Mann-Whitney tests were performed in B–C and E–F; *p≤0.05, p=0.69 (C). Data are presented as mean ±s.e.m in B–C and E–F.

Short- and long term remyelination efficiencies in chronic OL-Kcnj10 loss-of-function

No differences in g-ratios were observed in early (14dpl) and late (60dpl) remyelinating white matter lesions from control and cKO-1 mice. Mann-Whitney tests were performed in A and B; p=0.34 (A and B). Data are presented as mean ±s.e.m in A and B. In contrast, in chronic lesions 60 days post-lysolecithin lesioning (60 dpl, corresponding to P140) mitochondrial and axon pathologies were readily detectable in Olig2-cre driven Kcnj10 cKO mice with increased numbers of swollen intra-axonal mitochondria (Figure 5D–E) and enlarged axons (Figure 5F), whereas remyelination as measured by g-ratios was not affected (Figure 5—figure supplement 1B). These results indicate that OL-Kir4.1 is dispensable for (re)myelination but that its function is crucial for axon support and maintenance after long-term demyelinating WM injury.

Discussion

Although support of axons by myelinating oligodendrocytes is an essential requirement for long-term maintenance of function in the CNS, precise mechanisms of OL-axon trophic interactions are incompletely understood. Here, we studied the role of OL-Kir4.1 channels for WM integrity and maintenance in the ON and spinal WM tracts during postnatal development, adulthood and WM injury. Both fiber tracts are composed of long axons that rely on a strong glial support establishing proper action potential propagation (Nave, 2010). Long fiber tracts are particularly vulnerable to WM pathologies as observed in MS and EAST/SeSAME syndrome, and the anterior visual system comprising the retina and the ON is a common lesion site in MS. Also, the system is easily accessible to precise imaging and measurements such as OCT and VEP to monitor neuro-axonal function (Green et al., 2017; Ontaneda et al., 2017). Interestingly, we found that Kir4.1 channels were localized to perinodal OLs and within myelin in juxta-axonal spaces along the ON, suggesting roles of Kir4.1 channels for proper axonal function (Hibino et al., 2004; Bay and Butt, 2012; Ishii et al., 2003; Kalsi et al., 2004). To our knowledge, this is the first report of a mature OL-associated K+ channel with polar expression oriented towards axons, i.e. localization at the inner myelin tongue. Because the lactate transporter MCT1 also shows a similar juxta-axonal expression pattern (Lee et al., 2012), it is possible that other ion channels and solute carrier transporters are arrayed in a similar way to maintain axon energy, activity and integrity. Thus, we propose that Kir4.1 comprises a ‘myelin nanochannel’. While this positioning is consistent with a role in siphoning K+ within myelin segments, further studies are needed to confirm this function. Our loss-of-function studies identified two temporally-regulated roles for OL-Kir4.1. Using both early-acting Olig2-cre or CNP-cre, which initiates expression at a later stage, we defined early and later functions of Kir4.1 and ruled out caveats associated with heterozygous effects of cre knockin to the Olig2 and Cnp loci . Regarding early developmental requirements of OL-Kir4.1 function, the cKO resulted in somewhat precocious maturation and myelination. This suggests either a direct role in regulating differentiation or indirect effects of altered ion currents on voltage-gated Ca2+ channels in Kcnj10-deficient OPCs (Paez et al., 2010; Cheli et al., 2015; Cheli et al., 2016). Based on observations during development and regeneration, we conclude that Kir4.1 regulates, but is not required for normal myelination. Other studies have indicated early roles for OL-Kir4.1 channels in support of acute axonal activity (Larson et al., 2018). Secondly, we studied late (adult) functions of glial Kir4.1 and identified a specific OL-related role of Kir4.1 channels for support of long axons of the ON and the spinal WM. Indeed, our data demonstrated that OL-mediated Kir4.1 function was essential in WM maintenance, a function not found in AS-specific Kcnj10 cKO mice (Kelley et al., 2018). While in principle, loss of OL-Kir4.1 currents can be compensated for by OPC- or AS-encoded Kir4.1/Kir5.1 channels, or homotetrameric Kir5.1 channels with PSD-95 (Hibino et al., 2010; Tanemoto et al., 2002), it is evident that such compensation eventually fails during adulthood in OL-specific Kcnj10 cKO mice, possibly due to increasing demand for perinodal K+ buffering during sustained electric activity, such as with physical exertion (rotarod performance) or after (excitotoxic) demyelinating WM injury. Indeed, we found that Kir4.1 (Kcnj10) expression increases in OLs during maturation and aging, and consistent with progressive requirements in adults, it has been reported that Kir4.1-mediated K+ buffering becomes more important during ON high-frequency stimulation and that OL-Kcnj10 loss-of-function increases neuronal excitability in adult mice (Bay and Butt, 2012; Larson et al., 2018). In contrast, mice without AS-encoded Kcnj10 lack spinal WM tract abnormalities typical of OL-encoded Kir4.1 cKO mice. Thus, our data parses out the specific roles of OL-Kir4.1 and reveals a new supportive role of OLs for long-term axonal maintenance. Overall, our findings suggest a model in which developmental upregulation of OL-Kir4.1 is linked to increasing needs for axonal K+ homeostasis during adulthood. Siphoning of K+ is most likely established through an orchestrated action of juxta-axonal and perinodal glial Kir4.1 channels. The ad-axonal expression pattern of mature OL-Kir4.1 channels emphasizes that those channels might have an essential role in K+ clearance from axons, a function that becomes more critical later in life. However, we cannot rule out other distinct functions of Kir4.1 that are more linked to cell body-associated localization of Kir4.1 and OL-intrinsic functions like differentiation during early postnatal development (see above). Indeed, motor dysfunction and spastic paraplegia are progressive age-related neurological symptoms in individuals with EAST/SeSAME syndrome (Cross et al., 2013), which would resemble features that come with permanent knockout of mature OL-Kir4.1 channels resulting in mitochondrial damage and progressive neurodegeneration. Increased numbers and swelling of mitochondria as well as enlarged axon diameters were early indicators of impending axonal degeneration in OL-Kcnj10 cKO mice, especially when challenged with focal WM demyelination. Of note, morphological changes of intra-axonal mitochondria have been associated with lysolecithin-induced demyelinating lesions (Zambonin et al., 2011; Kiryu-Seo et al., 2010) and axonal degeneration in experimental autoimmune encephalomyelitis (EAE), an animal model of MS (Nikić et al., 2011). In the latter, it might characterize a phenomenon that is reversible and precede ultimate axonal degeneration. Notably, higher seizure frequencies with increasing age might contribute to chronic cognitive and motivational dysfunction in cKO animals; however, it is unlikely that this has a major effect on degenerative changes in long white matter tracts. In summary, we identified that OL-Kir4.1 channels are localized to myelin inner tongue and juxta-nodal regions suggesting functions in removal of K+ commensurate with axonal activity. Moreover, we describe a novel role for OL-encoded Kcnj10 in long-term maintenance of axons in WM tracts of the CNS. Permanent loss of OL-Kir4.1 channels resulted in progressive damage to axons and ultimately loss of neurons with increasing age. Our findings raise the question of whether similar mechanisms might exist in Schwann cells that serve the myelinating function in the peripheral nervous system. Additionally, our finding might have relevance for understanding mechanisms of axonal degeneration in chronic MS lesions, where KIR4.1 channels are dysregulated and lost during lesion progression (Schirmer et al., 2014). If so, dissecting mechanisms of dysregulated K+ homeostasis in chronic neuro-inflammatory conditions could help develop neuroprotective strategies designed to correct local peri-axonal K+ imbalances.

Materials and methods

Mice

All mouse strains were maintained at the University of California, San Francisco (UCSF) specific pathogen-free animal facility under protocol number AN110094. All animal protocols were approved by and in accordance with the guidelines established by the Institutional Animal Care and Use Committee and Laboratory Animal Resource Center. Kir4.1 mice were obtained from Ken D. Mc Carthy (University of North Carolina, Chapel Hill, NC, USA) and generated as previously described (Kelley et al., 2018; Djukic et al., 2007). Olig2-tva-cre transgenic mice were generated as previously described (Schüller et al., 2008). Cnp-cre transgenic mice were commercially available (Jackson Lab) and had been previously generated (Lappe-Siefke et al., 2003). Aldh1l1-cre mice were generated by the GENSAT project as previously described (Tien et al., 2012). All mice were maintained on a 12 hr light/dark cycle with food and water available ad libitum. All mice were kept on a C57BL/6J background and Kir4.1 littermate controls were used for all experiments.

Behavioral analysis

All behavioral experiments were performed at the UCSF Neurobehavioral Core for Rehabilitation Research. Rotarod (Ugo Basile) testing was performed on a rotating rod that accelerated from 0 to 40 rotations per minute (rpm) during a 5 min period. The latency to fall (in seconds) was recorded for each mouse in order to assess for motor deficits and endurance. Animals were tested three times per day for three consecutive days.

Optical coherence tomography

Retinal in-vivo imaging using optical coherence tomography (OCT) was carried out as previously described (Sagan et al., 2017; Sagan et al., 2016). Briefly, pupils were dilated with 1% tropicamide (Akorn), and mice were anesthesized using isoflurane (Isothesia, Henry Schein Animal Health). Guided by the infrared fundus image, vertical and horizontal OCT scans confirmed that the retina lays perpendicular to the laser. Then, 25 B-scans in high-resolution mode were taken and rasterized from 30 averaged A-Scans using the Spectralis Diagnostic Imaging system with the TruTrack eye-tracker to avoid motion artifacts (Heidelberg Engineering). Automated segmentation was done using the modular imaging software (Heidelberg Eye Explorer). Retinal segments were manually corrected corresponding to the inner limiting membrane (ILM) and inner plexiform layer (IPL), representing the limits of the inner retinal layers (IRL). IRL thicknesses were calculated using the Early Treatment Diabetic Retinopathy Study (ETDRS) grid with diameters of 1, 2, and 3 mm centered on the optic disc, and exported into a spreadsheet file. Both eyes for each mouse were examined, using generalized estimating equations with an exchangeable correlation matrix and adjustments for intra-subject inter-eye correlations (Cruz-Herranz et al., 2016). All experiments were carried out by an operator blinded for mouse genotype and treatment condition.

Visual evoked potentials

Visual pathway conduction was examined by recording of flash-light visual evoked potentials (VEP) using an Espion Diagnosys setup (Diagnosys). Mice were anesthetized using xylazine (20 mg/ml, Anased, Akorn) and ketamine (100 mg/ml, Ketathesia, Henry Schein Animal Health) in sterile 0.1M PBS through intraperitoneal (i.p.) injection. Mice were adapted to darkness for 5 min before placed in the recording system. The measuring electrode was a needle electrode placed medially in the area corresponding to the visual cortex, the reference electrode was placed under the nasal skin, while the grounding electrode was positioned at the tail root. VEP recordings started 13 min after i.p. injection and consisted of three runs (3 cd·s/m2, 1 Hz, 4 ms, 6500K, 100 sweeps). Mice VEP results in a negative wave, corresponding to P100 in humans, after approximately 75 ms, called N1. After three recordings per mouse were collected, the latency was calculated as the average of the second and third N1 result. All experiments were carried out by an operator blinded for mouse genotype and treatment condition.

Oligodendrocyte progenitor cell cultures

Isolation and purification of mouse OPCs was performed according to previously described immunopanning protocols using an anti-Pdgfra (CD140a) antibody for positive selection of OPCs (Shiow et al., 2017; Yuen et al., 2014; Dugas and Emery, 2013). Briefly, OPCs were immunopanned from P7-P9 mouse cortices and plated on poly-D-lysine coverslips (Neuvitro). Cells were kept in proliferation media (PDGF-AA, CNTF, and NT3; Peprotech) at 10% CO2 and 37°C. After two days in proliferation media, differentiation was induced by changing media to contain CNTF and triiodothyronine (T3; Sigma). Note that mycoplasma contamination testing was negative.

Focal white matter demyelinating injury

Mice were anesthetized using xylazine (20 mg/ml, Anased) and ketamine (100 mg/ml, Ketathesia) in sterile 0.1M PBS through i.p. injection. Focal demyelinating WM lesions were induced in the lower thoracic spinal cord around T12/13 according to previously published protocols (Fancy et al., 2009; Fancy et al., 2011). Briefly, 1 µL of 1% lysolecithin (l-a-lysophosphatidylcholine, Sigma) were injected to induce focal WM demyelination in the ventrolateral spinal cord of P80 cKO and control littermate mice.

Mouse tissue immunohistochemistry

Mice were deeply anesthetized and transcardially perfused with ice-cold phosphate-buffered saline (PBS) followed by 4% paraformaldehyde (PFA) and subsequently post-fixed in PFA for 1 hr. After post-fixation, samples were cryoprotected in 30% sucrose in PBS for 48 hr at 4°C and embedded in optimal cutting temperature (OCT) compound (Tissue-Tek). 16 µm-cryosections were collected on superfrost slides (VWR) using a CM3050S cryostat (Leica) and fixed in either 4% PFA at room temperature (RT) or ice-cold methanol. Sections were blocked in 0.1M PBS/0.1% Triton X-100/10% goat/horse/donkey sera for 1 hr at RT. Primary antibody incubations were carried out overnight at 4°C. After washing in 0.1M PBS, cryosections were incubated with secondary antibodies diluted in 0.1M PSB/0.1% Triton X-100 for 2 hr, RT. For immunofluorescence, Alexa fluochrome-tagged secondary IgG antibodies (1:500, Invitrogen) were used for primary antibody detection. Slides with fluorescent antibodies were mounted with DAPI Fluoromount-G (SouthernBiotech). Negative control sections without primary antibodies were processed in parallel.

Transmission electron microscopy

Tissue processing and image acquisition by transmission electron microscopy (EM) was carried out as previously reported (Harrington et al., 2010). Briefly, mice were perfused transcardially with 0.1M PSB followed by 4% glutaraldehyde and 0.008% CaCl2 in 0.1M PBS. After post-fixation in glutaraldehyde, ON and spinal cord tissue blocks were further fixed in osmium tetroxide at 4°C overnight, dehydrated through ascending ethanol washes, and embedded in TAAB resin (TAAB Laboratories). 1 μm-thick sections were cut, stained with toluidine blue, and examined by light microscopy to assess WM integrity and identify lesions. Non-lesion ON, spinal cord and remyelinating lesion blocks were examined by transmission EM (Hitachi, H600), and g-ratio calculations of axons in the area of interest were calculated by dividing the diameter of an axon by the diameter of axon and associated myelin sheath. Between 100–200 axons per group of 4 animals were analyzed. Briefly, images of transverse ON and spinal cord sections were taken at either 6000x or 10,000x magnification. Digitized and calibrated images were analyzed, and linear regression was used to indicate the differences between cKO and control groups in myelin thickness across the range of axon diameters. Numbers and densities of intra-axonal mitochondria per axon area were quantified, and circularities of individual mitochondria were calculated using Fiji ImageJ software (NIH). Circularity is a two-dimensional sphericity index with a value of 1 corresponding to a perfect sphere: Circularity = 4π × Area/(Perimeter)2.

Immunoelectron microscopy

Briefly, mice at the age of 6 months were perfused with 4% formaldehyde and 0.2% glutaraldehyde in 0.1 M phosphate buffer containing 0.5% NaCl. ONs were dissected and postfixed in the same fixation solution for 24 hr. Small pieces of ON tissue were embedded in 10% gelatine and subsequently infiltrated with 2.3 M sucrose in 0.1 M phosphate buffer overnight. Small blocks of gelatine containing the ON pieces were mounted on aluminum pins for ultramicrotomy and frozen in liquid nitrogen. Ultrathin cryosections were prepared with a 35° cryo-immuno diamond knife (Diatome) using a UC7 cryo-ultramicrotome (Leica). For immuno-labeling sections were incubated with antibodies directed against either intracellular or extracellular epitopes of Kir4.1, which were detected with protein A-gold (10 nm) obtained from the Cell Microscopy Center, Department of Cell Biology, University Medical Center Utrecht, The Netherlands. Sections were analyzed with a LEO EM912AB (Zeiss), and digital micrographs were obtained with an on-axis 2048 × 2048 CCD camera (TRS) (Werner et al., 2007). For quantification of immunogold labeling, 11 images with a size of 8 µm x 8 µm per animal were obtained from one optic nerve section in a systematic random sampling regime. The total analyzed field of view covers 704 µm2 per animal. Of each genotype, three animals were analyzed after labeling with the antibody against the intracellular epitope of Kir4.1 (APC-035, Alomone labs) including a reagent control by omitting the primary antibody. All gold particles were counted and assigned to structures identified by morphology such as astrocyte profiles, compact myelin, myelin inner and outer tongue.

Whole-mount immunohistochemistry

Retinal whole-mount preparations were performed from eyes that were post-fixed in 4% PFA for additional 24 hr after intracardial perfusion. Afterwards, eyes were kept in PBS, and retinal whole mounts were prepared as described previously (Sagan et al., 2016). Retinal ganglion cells were stained with an anti-Brn3a antibody and quantified using the Fiji ImageJ software.

Immunocytochemistry

Proliferating OPCs were quantified by immunoreactivity for EdU or pH3. Stainings were performed on day three after immunopanning and one day after replacement of proliferating media. Mbp immunostaining was performed to quantify myelinating OLs after switching to differentiating culture conditions as previously described (Shiow et al., 2017).

Proliferation assays

P1 pups were injected with 10 mg/ml Bromodeoxyuridine (BrdU) i.p. (BD Pharmingen). After two hours, mice were intracardially perfused. After tissue processing and cryo-sectioning, DNA on sections was denatured by incubation in 2N HCl for 30 min at 37°C, followed by rinses with 0.1M boric buffer. Then, BrdU incorporation was visualized performing IHC using an anti-BrdU antibody. For in-vitro proliferation studies, cells were incubated with 5-ethynyl-2´-deoxyuridine (EdU) for 1 hr, and EdU incorporation was visualized using the Click-iT EdU Kit (Invitrogen) according to the manufacturer’s instructions.

Quantitative polymerase chain reaction (qPCR)

For mouse OPC/OL mRNA analysis, RNA was extracted using Trizol (Invitrogen) and purified using the RNAeasy Kit (Qiagen) according to manufacturer’s instructions. Complementary DNA (cDNA) was generated using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems). qPCR was performed on a LightCycler 480 using LightCycler 480 SYBR Green I Master mix, and melting curves were analyzed to ensure primer specificity. Mouse primers used included Kcnj10 (forward: AGAGGGCCGAGACGAT; reverse: TTGACCTGGTTGAGCCGAATA), Kcnj16 (forward: CCTGTGTCTCCTCTTGAAGG; reverse: TGTGCTTAGGTGATACAATACGG), Cacna1c (forward: CCTAATGGGTTCGTTTCAGAAGT; reverse: TCCGGTTACCTCCAGGTCA), Cdk1 (forward: GCCAGAGCGTTTGGAATACC; reverse: CAGATGTCAACCGGAGTGGAGTA), Cdk2 (forward: GGCTCGACACTGAGACTGAA; reverse: GGTGCAGAAATTCAAAAACCA), Uhrf1 (forward: TGAAGCGGATGACAAGACTG; reverse: CAGGGCTCGTCCTCAGATAG), Nkx2-2 (forward: GCCTCCAATACTCCCTGCAC; reverse: GTCATTGTCCGGTGACTCGT), Cnp (forward: GGCGGCCCCGGAGACATAGTA; reverse: GCTTGGGCAGGAATGTGTGGC), Mbp (forward: CCCAAGGCACAGAGACACGGG; reverse: TACCTTGCCAGAGCCCCGCTT) and 18 s (forward: GTTCCGACCATAAACGATGCC; reverse: TGGTGGTGCCCTTCCGTCAAT). For normalization, mRNA expression levels were calculated according to ribosomal 18 s expression and presented as relative mRNA levels throughout the figures.

Western blot

Preparation of protein extracts, immunoblots and chemiluminescence detection was done as previously described (Kenney and Rowitch, 2000). Fluorescent detection of proteins was carried out using the Li-Cor Odyssey system (Li-Cor) according to the manufacturer’s instructions. After blocking in PBS Odyssey Blocking Buffer (Li-Cor) for 1 hr at RT, primary antibodies were incubated overnight at 4°C. IRDye Goat anti-mouse and anti-rabbit (680 and 800) fluorescent secondary antibodies (Li-cor) were used for protein detection on the Odyssey Cxl imaging system.

Antibodies

The following antibodies were used for immunopanning, immunocytochemistry, immunohistochemistry and Western Blot experiments: goat anti-OLIG2 (AF2418, R and D Systems, 1:50), mouse anti-APC (clone CC1, OP80, 1:300, Millipore Sigma), mouse anti-NOGO-A (clone 11C7, gift from M.E. Schwab, 1:3,000), rat anti-MBP (ab7349, Abcam, 1:500), mouse anti-MOG (clone 8–18 C5, 1:1,000, Millipore Sigma), rat anti-GFAP (clone 2.2B10, 13–0300, Invitrogen, 1:1,000), rabbit anti-AQP4 (AB3594, 1:500, Millipore Sigma), rabbit anti-KIR4.1 (APC035, Alomone Labs, 1:3,000), rabbit anti-KIR4.1 (APC-165, Alomone Labs, 1:1,000), rabbit anti-KIR5.1 (APC123, Alomone Labs, 1:500), mouse anti-Neurofilament H (NF-H), nonphosphorylated (clone SMI32, 801701, Biolegend, 1:10,000), mouse anti-Neurofilament H (NF-H), phosphorylated (clone SMI312, 837904, Biolegend, 1:1,000), rabbit anti-IBA1 (019–19741, Wako, 1:500), goat anti-BRN3a (sc-31984, Santa Cruz, 1:200), rabbit anti-KCNQ2 (ab22897, Abcam, 1:200) rabbit anti-CASPR (ab34151, Abcam, 1:1,000), mouse anti-BRDU (347580, BD Biosciences, 1:200), rabbit anti-phospho-Histone H3 (pH3, 9701, Cell Signaling, 1:500), rat anti-CD140a (558774, BD Biosciences, 1:500), mouse anti-β-ACTIN (A5316, Sigma, 1:7,000).

Image acquisition and analysis

Bright field images were acquired on a Zeiss Axio Imager two microscope. Fluorescent images were taken using Leica TCS SP8 and TCS SPE laser confocal microscopes with either 10x, 20x, 40x or 63x objectives; all fluorescent pictures are Z-stack confocal images, unless stated otherwise. Images were processed using Fiji ImageJ or Photoshop software (Adobe) and exported to Illustrator vector-based software (Adobe) for figure generation.

Statistical analysis

Data are presented as mean ±SE of mean (SEM). Analyses was performed using two-tailed parametric or non-parametric (Mann-Whitney, Kruskal-Wallis) t-tests for two groups if applicable, one-way ANOVA with corresponding post-hoc tests for multiple group comparisons and paired two-way ANOVA with post-hoc tests for longitudinal group comparisons at different time points. Kaplan-Meier estimator was used to quantify survival rates between transgenic mice during aging. Level of significance was determined as described in the individual figure legends. P values were designated as follows: *p≤0.5, **p≤0.01, ***p≤0.001, ****p≤0.0001. Analyses were performed using GraphPad Prism (GraphPad Software). In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. [Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.] Thank you for submitting your work entitled "Oligodendrocyte-Kir4.1 maintains axon integrity and is a therapeutic target in multiple sclerosis" for consideration by eLife. Your article has been reviewed by Gary Westbrook as Senior Editor, a Reviewing Editor, and three reviewers. The reviewers have opted to remain anonymous. Summary: Our decision has been reached after consultation between the reviewers. In the discussion of the manuscript, all three reviewers had concerns about over-interpretation, particularly with the EAE component, as well as the claims concerning therapeutic implications. The consensus from the discussion of the reviewers was that the work on disease modeling work should be dropped and the manuscript focused on the interesting analysis of the cKOs by presenting the study with more clarity, removing the speculative cartoons and rescue experiments and analyzing the results with appropriate statistical approaches (see specific comments below). Of note, the impact of an oligodendrocyte-specific knockout of Kir4.1 on the integrity of myelin is likely to be small is a concern that is further supported by the recent study of Bergles et al., 2018 observing no differences in myelination in the corpus callosum in oligodendrocyte-specific Kir4.1cKO. We expect that the changes to your manuscript would require substantial restructuring, and thus we are not able to consider the manuscript in its current form. However, if you decide to address these general issues as above, and the relevant specific comments in the original reviews below, we would be glad to consider a revised and resubmitted manuscript. Reviewer #1: This is an important and very timely study building further on previous studies of some of the same authors (Schirmer et al., 2014, Srivastava et al., 2012) in which Kir4.1 autoantibodies were identified in multiple sclerosis (MS) patients. Here, the authors provide an extensive in vivo, ultrastructural and immunofluorescence study of Kir4.1 in the optic nerve (ON), both in progressive MS and in a mouse model of demyelination using conditional Kir4.1 knockouts. They reveal Kir4.1 expression both in the oligodendrocyte cell body and in the myelin sheath based on high-pressure freeze immuno-EM, which is new and exciting. They conclude that long-term impairments of OL Kir4.1 mediate axonal damage and myelin degradation. This part of the work is carefully performed and illustrated by (sometimes excessive) quantification but the second part has major problems. 1) The claim that Kir4.1 represents a therapeutic target (as the title mentions) is not supported by the experiments shown from subsection “Retigabine-induced activation of Kv7.2 channels protects against neurodegeneration in aging Kir4.1 cKO animals” and onwards. Retigabine (Ezogabine in the US) is not targeting the Kir4.1 channel and neither is it demonstrated to have a convergent action at the glial and neuronal K+ gradients as the authors postulate in their cartoons (Figure 2A and Figure 5A). On the contrary, ezogabine is likely to cause a greater extracellular K+ accumulation outside of the demyelinated axons and within or around intact internodes and nodes of Ranvier. There is no opening of an additional gate for K+ to mitigate the lack of Kir4.1 activity in the cKO mice. There are more errors. For example, there is no evidence that ezogabine shunts the nodal action potential waveform (e.g. Schwartz et al., 2006). A more likely explanation for the partial neuroprotective action of ezogabine is the concomitant reduction in hyperexcitability. Similar protective effects on axon integrity have been observed with the sodium channel blocker phenytoin (Black et al., 2006). Such methodologies are, however, not providing evidence that Kir4.1 is an effective therapeutic target. 2) If the authors wish to demonstrate that Kir4.1 is a specific "therapeutic target" they will need to develop and test the rescue potential of Kir4.1 openers. In the absence of these, my current recommendation is to remove the entire ezogabine part from the manuscript and focus on the in vivo and in vitro findings in the conditional Kir4.1 knockout model. This is a huge amount of high quality data. On the other hand, if the aim is to show the neuroprotective action of ezogabine in MS and propose a repurposing of the drug, there is the need to show immunofluorescence of Kv7.2 and Kv7.3 expression in the ON in demyelinating neuropathies or MS models 3) It remains unclear to me which subcellular sites contribute to the neuropathology in cKO of Kir4.1. That OL cell bodies with Kir4.1 channels are localized to perinodal domains (Figure 2F-G) is not clear from the data but the assumptions widely propagate throughout the manuscript, mainly in cartoon form. But how is the distribution along the myelin sheath different from random and what are the data to support such claim? What are the distinct contributions of cell body Kir4.1 and myelin sheath Kir4.1 to the neuropathology? Reviewer #2: Overall this an excellent study by Schirmer and colleagues that contains an impressive amount of convincing experiments and state of the art analyses to comprehensively characterize the role of oligodendroglial Kir4.1 during development, adulthood and in demyelinating diseases. My only major concerns are with the EAE experiment shown in Figure 6 and they relate to the following two aspects: 1) The clinical course shown in Figure 1B shows a very mild disease course with an average maximal score of 1 in Sal treated mice (corresponding to a limp tail). As the authors also state that for the Sal-RTG group treatment was only started when an EAE score of 2 was reached – this seems nearly incompatible with the data shown here (max group score of 0.5, assuming that the scale is correct). I would suggest to separately analyse the effect on disease incidence (very unlikely to be influenced by a neuroprotective interventions) and the effect on the disease course of those mice that actually develop clinical signs. To show a protective effect of the Sal-RTG vs. Sal-Sal treatment it would e.g. be important to plot those presumably matched mice treated with either Sal-RTG or Sal-Sal aligned to the start of treatment (so the time when these mice have first reached a score of 2). 2) The argument for a primary neuroprotective effect is that neurons and/or axons are preserved, while no effect on the immune response is observed. This argument is difficult to make based on the data presented here – at least the Sal-RTG group does not appear to show histological protection of axons or RGCs. Such protection is observed in the RTG only group however only one immune parameters is analysed here (microglia number is not significantly changed in 5 mice examined – given that the effect size of RTG on microglia number is similar to the effect size on axons and neurons this could also be the result of a the substantially higher variability in this outcome parameter). In summary to me the claim that RTG is neuroprotective in EAE is the one claim in the manuscript that is currently not sufficiently supported by the data presented here. As this is an important claim for the entire manuscript I would suggest to increase the number of animals in particular in the Sal-RTG vs Sal-Sal group (so treatment only started at an EAE score of 2 with randomization to either RTG or Sal) and analyse both the clinical score as well as the axonal pathology and parameters of adaptive and innate immune cell infiltration in the lesions in a larger number of mice. Reviewer #3: In this manuscript, Schirmer et al., explore the role of Kir4.1, a disease-linked inward rectifying potassium channel in oligodendrocytes (OLs), both in the maintenance of axonal integrity and as a potential therapeutic target for multiple sclerosis. The authors find that conditional deletion of Kir4.1 in OLs or OL precursor cells leads to relatively modest defects in OL differentiation and myelination during development. However, as mice age, OL-specific Kir4.1 loss leads to reduced optic nerve function, fewer RGC neurons, some mitochondrial structural abnormalities, motor defects, and early death, supporting an OL-intrinsic function in maintaining axonal integrity. Finally, the authors provide evidence that administration of retigabine (RTG, to open axonal Kv7.2 channels and presumably help buffer extracellular potassium) ameliorates some of the negative effects of Kir4.1 loss in knockout mice or in the EAE mouse model of multiple sclerosis. Overall the paper is technically rigorous and gives definitive proof that OL-intrinsic Kir4.1 expression is important for function and survival of axons in adult mice, rather than for myelination per se. The weaker part of the story is the disease modeling aspect which is more preliminary and would be improved by additional analysis. Specific points: 1) Throughout the paper, the authors should have performed their statistical analyses using the average measurement for each animal used in the study, rather than on every individual measurement taken. For example, in Figure 2K, statistical analyses on g-ratio seem to have been performed comparing hundreds of axons measured, artificially increasing statistical significance. Same is true for mitochondrial and axonal morphology measurements. Since effect sizes are often very small, it is likely that there is no real statistical or biologically relevant difference between many of these conditions that the authors consider significant. 2) In Figure 1 the authors show that Kir4.1 is reduced in demyelinating lesions. Since Kir4.1 is expressed by mature OLs, does this just reflect loss of mature OLs rather than a specific downregulation of Kir4.1? The plot of MOG (mature OLG marker) versus Kir4.1 in Figure 1E is consistent with this idea. 3) Figure 4: Lysolecithin experiments. The authors conclude that "Kir4.1 is required for white matter integrity after injury" but the data do not robustly support this conclusion. Kir4.1 knockouts have mildly *better* remyelination, consistent with the accelerated differentiation/myelination seen developmentally. There is no data presented on axon degeneration for these experiments, only plots of axon and mitochondrial morphology, all of which suffer from very small effect sizes and inappropriate statistics to suggest these effects are significant (see above point about statistical analysis). The authors state that there is evidence for Wallerian degeneration in Figure 4G but this is just a single TEM micrograph with no quantitative support of this conclusion. I think the paper would be stronger without this set of experiments. 4) In Figure 5 (text in subsection “Retigabine-induced activation of Kv7.2 channels protects against neurodegeneration in aging Kir4.1 cKO animals”), the authors conclude that "RTG-induced activation of Kv7.2 channels protects against neurodegeneration in aging Kir4.1 cKO animals." Therefore, the essential statistical comparison to make is between the groups of mice that were knocked out for Kir 4.1 that either received saline or RTG. The authors do not make this key comparison in their statistical analysis that would support their conclusion, but instead offer statistics for less relevant comparisons (e.g. showing that CKOs treated with saline are statistically different than WT mice treated with RTG is not relevant to the authors' conclusion.) [Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.] Thank you for resubmitting your work entitled "Oligodendrocyte-encoded Kir4.1 function is required for axon integrity and long-term maintenance" for further consideration at eLife. Your revised article has been favorably evaluated by Gary Westbrook (Senior Editor), and three reviewers. The authors have substantially refocused the scope of the manuscript and improved its clarity. They investigated myelin integrity and axonal function in the optic nerve in OL-specific Kir4.1 KO during aging and remyelination. The reviewers were all supportive of the work, but we think that several main points require further clarification or discussion. In some cases, this might require additional data and/or toning down of the conclusions. Essential revisions: 1) One of the new findings is the localization of Kir4.1 within the myelin sheath at the membrane. Although such location was speculated previously (e.g. in Larson et al., 2018) published work so far has only detect Kir4.1 in OL cell bodies and processes (Brasko et al., 2017; Kalsi et al., 2004; Poopalasundaram et al., 2000; Battefeld et al., 2016; Schirmer et al., 2014). Thus, it is important that the authors provide further evidence confirming the specificity of the immunoEM labeling. The optimal control is to stain the conditional knockouts; second best is a no-primary control to look at how "sticky" the tissue is. How many EM sections were analyzed. How do the data compare to background? Were the Olig2-cre:Kir4.1 or Cnp-cre:Kir4.1 mice examined with immuno EM to assess the specificity of the labeling? In addition, the scale bars seem to be wrong. Gold particles are ~10 nm which is not consistent with the scale bars in Figure 1F. 2) The impact on mitochondria integrity is assessed on basis of their numbers and circularity. However, higher magnification images showing mitochondria are needed to assess the validity of these differences between the groups. 3) The authors provide minimal context how their manuscript relates to the previously published study by Larson et al., (2018). In the Introduction they write "we focused on late roles of OL-Kir4.1 in mature adults." The scientific or conceptual advance relative to the published work needs to be honestly and forthrightly discussed. [Editors’ note: the author responses to the first round of peer review follow.] Reviewer #1: This is an important and very timely study building further on previous studies of some of the same authors (Schirmer et al., 2014, Srivastava et al., 2012) in which Kir4.1 autoantibodies were identified in multiple sclerosis (MS) patients. Here, the authors provide an extensive in vivo, ultrastructural and immunofluorescence study of Kir4.1 in the optic nerve (ON), both in progressive MS and in a mouse model of demyelination using conditional Kir4.1 knockouts. They reveal Kir4.1 expression both in the oligodendrocyte cell body and in the myelin sheath based on high-pressure freeze immuno-EM, which is new and exciting. They conclude that long-term impairments of OL Kir4.1 mediate axonal damage and myelin degradation. This part of the work is carefully performed and illustrated by (sometimes excessive) quantification but the second part has major problems. 1) The claim that Kir4.1 represents a therapeutic target (as the title mentions) is not supported by the experiments shown from subsection “Retigabine-induced activation of Kv7.2 channels protects against neurodegeneration in aging Kir4.1 cKO animals” and onwards. Retigabine (Ezogabine in the US) is not targeting the Kir4.1 channel and neither is it demonstrated to have a convergent action at the glial and neuronal K+ gradients as the authors postulate in their cartoons (Figure 2A and Figure 5A). On the contrary, ezogabine is likely to cause a greater extracellular K+ accumulation outside of the demyelinated axons and within or around intact internodes and nodes of Ranvier. There is no opening of an additional gate for K+ to mitigate the lack of Kir4.1 activity in the cKO mice. There are more errors. For example, there is no evidence that ezogabine shunts the nodal action potential waveform (e.g. Schwartz et al., 2006). A more likely explanation for the partial neuroprotective action of ezogabine is the concomitant reduction in hyperexcitability. Similar protective effects on axon integrity have been observed with the sodium channel blocker phenytoin (Black et al., 2006). Such methodologies are, however, not providing evidence that Kir4.1 is an effective therapeutic target. We take the reviewer’s point and based on this suggestion and similar advice from the editor and other reviewers we have removed this data, which will be augmented for an independent study. The suggestions above for additional endpoints and potential mechanisms are helpful and will be pursued in this future work. 2) If the authors wish to demonstrate that Kir4.1 is a specific "therapeutic target" they will need to develop and test the rescue potential of Kir4.1 openers. In the absence of these, my current recommendation is to remove the entire ezogabine part from the manuscript and focus on the in vivo and in vitro findings in the conditional Kir4.1 knockout model. This is a huge amount of high quality data. On the other hand, if the aim is to show the neuroprotective action of ezogabine in MS and propose a repurposing of the drug, there is the need to show immunofluorescence of Kv7.2 and Kv7.3 expression in the ON in demyelinating neuropathies or MS models As suggested, we removed the data on retigabine (ezogabine) as a pharmacological model to improve function in Kir4.1 cKO animals and focused on characterizing the Kir4.1 knockout model during development/aging and white matter injury. 3) It remains unclear to me which subcellular sites contribute to the neuropathology in cKO of Kir4.1. That OL cell bodies with Kir4.1 channels are localized to perinodal domains (Figure 2F-G) is not clear from the data but the assumptions widely propagate throughout the manuscript, mainly in cartoon form. But how is the distribution along the myelin sheath different from random and what are the data to support such claim? What are the distinct contributions of cell body Kir4.1 and myelin sheath Kir4.1 to the neuropathology? We found that Kir4.1 channels are localized in two peri-axonal parts of the oligodendrocytes (juxta-axonal and peri-nodal) and we think that these components are best positioned to explain the pathology of axon degeneration in the Kir4.1 cKO animals. However, we cannot rule out that cell body Kir4.1 also has a role (e.g., in regulating OL differentiation during early steps of development) and a caveat has been added to the Discussion section. Reviewer #2: Overall this an excellent study by Schirmer and colleagues that contains an impressive amount of convincing experiments and state of the art analyses to comprehensively characterize the role of oligodendroglial Kir4.1 during development, adulthood and in demyelinating diseases. My only major concerns are with the EAE experiment shown in Figure 6 and they relate to the following two aspects: 1) The clinical course shown in Figure 1B shows a very mild disease course with an average maximal score of 1 in Sal treated mice (corresponding to a limp tail). As the authors also state that for the Sal-RTG group treatment was only started when an EAE score of 2 was reached – this seems nearly incompatible with the data shown here (max group score of 0.5, assuming that the scale is correct). I would suggest to separately analyse the effect on disease incidence (very unlikely to be influenced by a neuroprotective interventions) and the effect on the disease course of those mice that actually develop clinical signs. To show a protective effect of the Sal-RTG vs. Sal-Sal treatment it would e.g. be important to plot those presumably matched mice treated with either Sal-RTG or Sal-Sal aligned to the start of treatment (so the time when these mice have first reached a score of 2). We thank the reviewer for the comments and suggestions. As indicated in response reviewer 1, point 1, we removed the entire part on EAE and retigabine (ezogabine) rescue trial but will keep this in mind for a future publication and repeat EAE analyses. 2) The argument for a primary neuroprotective effect is that neurons and/or axons are preserved, while no effect on the immune response is observed. This argument is difficult to make based on the data presented here – at least the Sal-RTG group does not appear to show histological protection of axons or RGCs. Such protection is observed in the RTG only group however only one immune parameters is analysed here (microglia number is not significantly changed in 5 mice examined – given that the effect size of RTG on microglia number is similar to the effect size on axons and neurons this could also be the result of a the substantially higher variability in this outcome parameter). We agree with the reviewer and will include additional EAE cohorts with respect to a preclinical RTG trial in a future paper. Also, we will study different inflammatory parameters such as T cell infiltration of presence of phagocytes. For now, we removed the part on EAE and instead focused entirely on the functions of OL-Kir4.1 during development, adulthood and its novel role in long-term axon support. In summary to me the claim that RTG is neuroprotective in EAE is the one claim in the manuscript that is currently not sufficiently supported by the data presented here. As this is an important claim for the entire manuscript I would suggest to increase the number of animals in particular in the Sal-RTG vs Sal-Sal group (so treatment only started at an EAE score of 2 with randomization to either RTG or Sal) and analyse both the clinical score as well as the axonal pathology and parameters of adaptive and innate immune cell infiltration in the lesions in a larger number of mice. We agree with the reviewer that we cannot confidently say that retigabine (ezogabine) treatment has direct neuroprotective effects without more evidence and this data is now removed from the paper. Reviewer #3: In this manuscript, Schirmer et al., explore the role of Kir4.1, a disease-linked inward rectifying potassium channel in oligodendrocytes (OLs), both in the maintenance of axonal integrity and as a potential therapeutic target for multiple sclerosis. The authors find that conditional deletion of Kir4.1 in OLs or OL precursor cells leads to relatively modest defects in OL differentiation and myelination during development. However, as mice age, OL-specific Kir4.1 loss leads to reduced optic nerve function, fewer RGC neurons, some mitochondrial structural abnormalities, motor defects, and early death, supporting an OL-intrinsic function in maintaining axonal integrity. Finally, the authors provide evidence that administration of retigabine (RTG, to open axonal Kv7.2 channels and presumably help buffer extracellular potassium) ameliorates some of the negative effects of Kir4.1 loss in knockout mice or in the EAE mouse model of multiple sclerosis. Overall the paper is technically rigorous and gives definitive proof that OL-intrinsic Kir4.1 expression is important for function and survival of axons in adult mice, rather than for myelination per se. The weaker part of the story is the disease modeling aspect which is more preliminary and would be improved by additional analysis. Specific points: 1) Throughout the paper, the authors should have performed their statistical analyses using the average measurement for each animal used in the study, rather than on every individual measurement taken. For example, in Figure 2K, statistical analyses on g-ratio seem to have been performed comparing hundreds of axons measured, artificially increasing statistical significance. Same is true for mitochondrial and axonal morphology measurements. Since effect sizes are often very small, it is likely that there is no real statistical or biologically relevant difference between many of these conditions that the authors consider significant. We agree with the reviewer and provided additional statistical analyses using the average measurement for each animal when comparing EM-derived data like g-ratios, axon diameter and mitochondrial parameters (please see revised Figure 2, Figure 4 and Figure 5 and corresponding Supplementary Figures). Also, we included statistics on counts for intra-axonal mitochondria per axon versus mitochondrial densities in situations where axons are pathologically enlarged such as chronic lysolecithin lesions (cf. Figure 5) and cited additional references (Kiryu-Seo et al., 2010 and Zambonin et al., 2011) to emphasize increase in intraaxonal mitochondria densities and stationary mitochondrial size in remyelination and lysolecithin-mediated white matter injury (Discussion section) (Kiryu-Seo et al., 2010; Zambonin et al., 2011). 2) In Figure 1 the authors show that Kir4.1 is reduced in demyelinating lesions. Since Kir4.1 is expressed by mature OLs, does this just reflect loss of mature OLs rather than a specific downregulation of Kir4.1? The plot of MOG (mature OLG marker) versus Kir4.1 in Figure 1E is consistent with this idea. The reviewer asks whether loss of Kir4.1 occurs because OLs are lost. We think this is not the case in acute lesions where KIr4.1 becomes downregulated. Also, our loss-of-function studies show that Kir4.1 function is not needed to re-myelinate focal white matter lesions. So, in the acute lesions our conclusion is that Kir4.1 downregulation precedes loss of OLs. However, we do agree with the reviewer about the links in chronic demyelinated lesions that leads to a loss of OLs. Note that because OPCs express little Kir4.1 it is formally possible that OPC differentiation is blocked resulting in Kir4.1 lack of expression. As we removed translational aspects on MS and EAE in the current revised manuscript, we decided not to comment on this issue in the paper but will follow-up on the issue in a follow-up study. 3) Figure 4: Lysolecithin experiments. The authors conclude that "Kir4.1 is required for white matter integrity after injury" but the data do not robustly support this conclusion. Kir4.1 knockouts have mildly *better* remyelination, consistent with the accelerated differentiation/myelination seen developmentally. There is no data presented on axon degeneration for these experiments, only plots of axon and mitochondrial morphology, all of which suffer from very small effect sizes and inappropriate statistics to suggest these effects are significant (see above point about statistical analysis). The authors state that there is evidence for Wallerian degeneration in Figure 4G but this is just a single TEM micrograph with no quantitative support of this conclusion. I think the paper would be stronger without this set of experiments. We take the reviewer’s suggestions and now provide additional statistical analyses using the average measurement for each animal (see above, Figure 5). We removed the term Wallerian degeneration and now describe pathological axon changes like changes in size and mitochondria, which can be reliably quantified. We think that the data sets on acute and chronic white matter injury (14dpl and 60dpl) are important for the current paper to indicate the timing of white matter pathology onset observed in acute versus chronic lesions. Indeed, long-term lesions together with functional and histological results from P140 and P180 allows to parse out a specific function of OL-Kir4.1 for long-term but not early support of axon function. 4) In Figure 5 (text in subsection “Retigabine-induced activation of Kv7.2 channels protects against neurodegeneration in aging Kir4.1 cKO animals”), the authors conclude that "RTG-induced activation of Kv7.2 channels protects against neurodegeneration in aging Kir4.1 cKO animals." Therefore, the essential statistical comparison to make is between the groups of mice that were knocked out for Kir 4.1 that either received saline or RTG. The authors do not make this key comparison in their statistical analysis that would support their conclusion, but instead offer statistics for less relevant comparisons (e.g. showing that CKOs treated with saline are statistically different than WT mice treated with RTG is not relevant to the authors' conclusion.) As above, we removed the entire part on retigabine (ezogabine) as suggested by the editor and other reviewers but will consider those comments and perform additional analyses focusing only on the two cKO groups in a future study. [Editors’ note: the author responses to the re-review follow.] The authors have substantially refocused the scope of the manuscript and improved its clarity. They investigated myelin integrity and axonal function in the optic nerve in OL-specific Kir4.1 KO during aging and remyelination. The reviewers were all supportive of the work, but we think that several main points require further clarification or discussion. In some cases, this might require additional data and/or toning down of the conclusions. Essential revisions: 1) One of the new findings is the localization of Kir4.1 within the myelin sheath at the membrane. Although such location was speculated previously (e.g. in Larson et al., 2018) published work so far has only detect Kir4.1 in OL cell bodies and processes (Brasko et al., 2017; Kalsi et al., 2004; Poopalasundaram et al., 2000; Battefeld et al., 2016; Schirmer et al., 2014). Thus, it is important that the authors provide further evidence confirming the specificity of the immunoEM labeling. The optimal control is to stain the conditional knockouts; second best is a no-primary control to look at how "sticky" the tissue is. How many EM sections were analyzed. How do the data compare to background? Were the Olig2-cre:Kir4.1 or Cnp-cre:Kir4.1 mice examined with immuno EM to assess the specificity of the labeling? We thank the reviewer for this important question and have included an in-depth analysis to confirm specificity of the Kir4.1 immunogold labeling with respect to myelin and astrocyte compartments. We performed a no-primary control and confirmed specificity of the Kir4.1 antibody labeling with the strongest difference at the inner myelin tongue highlighting the potential functional importance of this particular localization. Furthermore, we analyzed immunogold labeling in both Olig2- and Cnp-cre Kcnj10 cKO optic nerve tissues as compared to controls and found a specific lack of labeling in myelin compartments, in particular at the inner tongue and within the compact myelin. Outer tongue and astrocyte labeling was not affected by the cKO; of note, outer tongue labeling might belong to astrocytes due to the direct attachment of astrocyte fibers to myelin; text in the main manuscript (subsection “OL-Kir4.1 channels are gradually upregulated during early postnatal development and show a peri-axonal expression pattern”), figures and corresponding legends have been revised accordingly In addition, the scale bars seem to be wrong. Gold particles are ~10 nm which is not consistent with the scale bars in Figure 1F. We thank the reviewer for this comment and have modified the scale bars and revised the figures accordingly. 2) The impact on mitochondria integrity is assessed on basis of their numbers and circularity. However, higher magnification images showing mitochondria are needed to assess the validity of these differences between the groups. We agree with the reviewer’s comment and have included high-magnification images of representative intra-axonal mitochondria from control and cKO lesioned spinal cord tissue (short- and long-term remyelination) in Figure 5; figures and corresponding legends have been revised accordingly. 3) The authors provide minimal context how their manuscript relates to the previously published study by Larson et al., (2018). In the Introduction they write "we focused on late roles of OL-Kir4.1 in mature adults." The scientific or conceptual advance relative to the published work needs to be honestly and forthrightly discussed. Our study is novel in showing the role of oligodendrocyte Kir4.1 in in long-term maintenance of axon function and integrity in long white matter tracts, such as the optic nerves and the spinal white matter. We think that both studies are complementary showing diverse roles for OL-Kir4.1 in regulating neuroaxonal excitability and function acutely and over a longer time course during white matter injury and aging. We modified the text in the Introduction and Discussion section to clarify these points.
  63 in total

Review 1.  Axonal self-destruction and neurodegeneration.

Authors:  Martin C Raff; Alan V Whitmore; John T Finn
Journal:  Science       Date:  2002-05-03       Impact factor: 47.728

2.  Differential assembly of inwardly rectifying K+ channel subunits, Kir4.1 and Kir5.1, in brain astrocytes.

Authors:  Hiroshi Hibino; Akikazu Fujita; Kaori Iwai; Mitsuhiko Yamada; Yoshihisa Kurachi
Journal:  J Biol Chem       Date:  2004-08-13       Impact factor: 5.157

3.  The visual evoked potential in the mouse--origins and response characteristics.

Authors:  W H Ridder; S Nusinowitz
Journal:  Vision Res       Date:  2005-10-20       Impact factor: 1.886

Review 4.  Myelination and the trophic support of long axons.

Authors:  Klaus-Armin Nave
Journal:  Nat Rev Neurosci       Date:  2010-03-10       Impact factor: 34.870

5.  Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME syndrome) caused by mutations in KCNJ10.

Authors:  Ute I Scholl; Murim Choi; Tiewen Liu; Vincent T Ramaekers; Martin G Häusler; Joanne Grimmer; Sheldon W Tobe; Anita Farhi; Carol Nelson-Williams; Richard P Lifton
Journal:  Proc Natl Acad Sci U S A       Date:  2009-03-16       Impact factor: 11.205

6.  Proteolipid protein is required for transport of sirtuin 2 into CNS myelin.

Authors:  Hauke B Werner; Katja Kuhlmann; Siming Shen; Marina Uecker; Anke Schardt; Kalina Dimova; Foteini Orfaniotou; Ajit Dhaunchak; Bastian G Brinkmann; Wiebke Möbius; Lenny Guarente; Patrizia Casaccia-Bonnefil; Olaf Jahn; Klaus-Armin Nave
Journal:  J Neurosci       Date:  2007-07-18       Impact factor: 6.167

Review 7.  Axon-glial signaling and the glial support of axon function.

Authors:  Klaus-Armin Nave; Bruce D Trapp
Journal:  Annu Rev Neurosci       Date:  2008       Impact factor: 12.449

Review 8.  Regenerating CNS myelin - from mechanisms to experimental medicines.

Authors:  Robin J M Franklin; Charles Ffrench-Constant
Journal:  Nat Rev Neurosci       Date:  2017-11-16       Impact factor: 34.870

9.  Induction of Paralysis and Visual System Injury in Mice by T Cells Specific for Neuromyelitis Optica Autoantigen Aquaporin-4.

Authors:  Sharon A Sagan; Andrés Cruz-Herranz; Collin M Spencer; Peggy P Ho; Lawrence Steinman; Ari J Green; Raymond A Sobel; Scott S Zamvil
Journal:  J Vis Exp       Date:  2017-08-21       Impact factor: 1.355

10.  Kir4.1-Dependent Astrocyte-Fast Motor Neuron Interactions Are Required for Peak Strength.

Authors:  Kevin W Kelley; Lucile Ben Haim; Lucas Schirmer; Giulia E Tyzack; Michaela Tolman; John G Miller; Hui-Hsin Tsai; Sandra M Chang; Anna V Molofsky; Yongjie Yang; Rickie Patani; Andras Lakatos; Erik M Ullian; David H Rowitch
Journal:  Neuron       Date:  2018-04-05       Impact factor: 17.173

View more
  20 in total

Review 1.  Kir5.1 channels: potential role in epilepsy and seizure disorders.

Authors:  Alexander Staruschenko; Matthew R Hodges; Oleg Palygin
Journal:  Am J Physiol Cell Physiol       Date:  2022-07-18       Impact factor: 5.282

Review 2.  Myelin plasticity: sculpting circuits in learning and memory.

Authors:  Wendy Xin; Jonah R Chan
Journal:  Nat Rev Neurosci       Date:  2020-10-12       Impact factor: 34.870

Review 3.  Building a (w)rapport between neurons and oligodendroglia: Reciprocal interactions underlying adaptive myelination.

Authors:  Sarah E Pease-Raissi; Jonah R Chan
Journal:  Neuron       Date:  2021-02-22       Impact factor: 17.173

4.  Neuronal activity disrupts myelinated axon integrity in the absence of NKCC1b.

Authors:  Katy L H Marshall-Phelps; Linde Kegel; Marion Baraban; Torben Ruhwedel; Rafael G Almeida; Maria Rubio-Brotons; Anna Klingseisen; Silvia K Benito-Kwiecinski; Jason J Early; Jenea M Bin; Daumante Suminaite; Matthew R Livesey; Wiebke Möbius; Richard J Poole; David A Lyons
Journal:  J Cell Biol       Date:  2020-07-06       Impact factor: 10.539

5.  An in vitro model for studying CNS white matter: functional properties and experimental approaches.

Authors:  Silvia Bijland; Gemma Thomson; Matthew Euston; Kyriakos Michail; Katja Thümmler; Steve Mücklisch; Colin L Crawford; Susan C Barnett; Mark McLaughlin; T James Anderson; Christopher Linington; Euan R Brown; Eric R Kalkman; Julia M Edgar
Journal:  F1000Res       Date:  2019-01-29

Review 6.  Myelinated axon physiology and regulation of neural circuit function.

Authors:  Daumante Suminaite; David A Lyons; Matthew R Livesey
Journal:  Glia       Date:  2019-06-24       Impact factor: 7.452

7.  Central Nervous System Remyelination: Roles of Glia and Innate Immune Cells.

Authors:  Charbel S Baaklini; Khalil S Rawji; Greg J Duncan; Madelene F S Ho; Jason R Plemel
Journal:  Front Mol Neurosci       Date:  2019-09-19       Impact factor: 5.639

Review 8.  Altered Expression of Ion Channels in White Matter Lesions of Progressive Multiple Sclerosis: What Do We Know About Their Function?

Authors:  Francesca Boscia; Maria Louise Elkjaer; Zsolt Illes; Maria Kukley
Journal:  Front Cell Neurosci       Date:  2021-06-25       Impact factor: 5.505

9.  A critical role for the inward rectifying potassium channel Kir7.1 in oligodendrocytes of the mouse optic nerve.

Authors:  Maria Papanikolaou; Arthur M Butt; Anthony Lewis
Journal:  Brain Struct Funct       Date:  2020-02-21       Impact factor: 3.270

10.  Distinctive waves of innate immune response in the retina in experimental autoimmune encephalomyelitis.

Authors:  Andrés Cruz-Herranz; Frederike C Oertel; Kicheol Kim; Ester Cantó; Garrett Timmons; Jung H Sin; Michael Devereux; Nicholas Baker; Brady Michel; Ryan D Schubert; Lakshmisahithi Rani; Christian Cordano; Sergio E Baranzini; Ari J Green
Journal:  JCI Insight       Date:  2021-06-08
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.