| Literature DB >> 30186424 |
Xiaoyu Sui1,2,3, Yadong Li4, Yurong Sun5, Chunyan Li5, Xiulan Li1, Guiyu Zhang2,3.
Abstract
Expression of autophagy-related proteins, microtubule-associated protein light chain 3 (LC3) and Beclin1, and matrix metalloproteinase-2 (MMP-2) was investigated in serum and peritoneal fluid of patients with endometriosis (EM). The messenger ribonucleic acid (mRNA) expression levels of MMP-2, LC3 and Beclin1 in endometrial tissues of EM patients and correlation of these genes with EM and their significance were evaluated. The serum, peritoneal fluid and endometrial tissues of 84 patients treated in The First Affiliated Hospital of Qiqihar Medical University (Qiqihar, China) from March 2016 to March 2017 were collected. The serum, peritoneal fluid and endometrial tissues of 42 EM patients were used as the experimental group, while those of 42 non-EM patients were used as the control group. The levels of LC3, Beclin1 and MMP-2 in serum and peritoneal fluid of EM patients and non-EM patients were quantitatively detected via enzyme-linked immunosorbent assay (ELISA), followed by comparative analysis based on data in both groups. In addition, mRNA expression of LC3, Beclin1 and MMP-2 in the endometrium in both groups were detected via reverse transcription-quantitative polymerase chain reaction (RT-qPCR), and differences in expression of these genes between the groups were analyzed and evaluated. Correlation of LC3, Beclin1 and MMP-2 with EM was explored. Results of ELISA showed that levels of LC3 and Beclin1 in the EM group were significantly lower than those in the control group, while levels of MMP-2 in serum and peritoneal fluid of the EM group were significantly higher than those in the control group (P<0.05). Results of RT-qPCR revealed that mRNA expression of LC3 and Beclin1 in the endometrium of patients in the EM group were obviously decreased compared with those in the control group, while the expression of MMP-2 was high, and differences in expression were statistically significant (P<0.05). The expression of MMP-2 is high, and expression of LC3 and Beclin1 is low in serum, peritoneal fluid and endometrium of EM patients, and investigating the expression of MMP-2, LC3 and Beclin1 in EM is helpful to further clarify the pathogenesis of EM, and guide the clinical diagnosis and treatment.Entities:
Keywords: Beclin1; LC3; MMP-2; autophagy; endometriosis
Year: 2018 PMID: 30186424 PMCID: PMC6122207 DOI: 10.3892/etm.2018.6362
Source DB: PubMed Journal: Exp Ther Med ISSN: 1792-0981 Impact factor: 2.447
Primer sequences in RT-qPCR.
| Genes | Forward | Reverse |
|---|---|---|
| LC3 | AAGGCGCTTACAGCTCAATG | CTGGGAGGCATAGACCATGT |
| Beclin1 | AAACGCATTTGCCATCACA | GGACCTTCAGCAGTTTACAGTCAG |
| MMP-2 | CTTCCAAGTCTGGAGCGATGT | TACCGTCAAAGGGGTATCCAT |
| GAP | CATCACTGCCACCCAGAAGAC | CCAGTGAGCTTCCCGTTCAG |
LC3, light chain 3; MMP-2, matrix metalloproteinase-2.
Comparison of expression levels of serum LC3, Beclin1 and MMP-2 between the two groups of patients.
| Groups | n | MMP-2 (µg/l) | LC3 (µg/l) | Beclin1 (µg/l) |
|---|---|---|---|---|
| EM | 42 | 226.1±49.0 | 36.86±16.86 | 25.16±9.89 |
| Non-EM | 42 | 130.5±13.5 | 75.54±16.09 | 55.45±17.14 |
LC3, light chain 3; MMP-2, matrix metalloproteinase-2; EM, endometriosis.
Comparison of expression levels of LC3, Beclin1 and MMP-2 in peritoneal fluid between the two groups of patients.
| Groups | n | MMP-2 (µg/l) | LC3 (µg/l) | Beclin1 (µg/l) |
|---|---|---|---|---|
| EM | 42 | 48.3±8.4 | 17.64±10.21 | 10.17±4.14 |
| Non-EM | 42 | 22.5±5.2 | 38.97±11.85 | 20.53±5.51 |
LC3, light chain 3; MMP-2, matrix metalloproteinase-2; EM, endometriosis.
Figure 1.mRNA expression levels of LC3, Beclin1 and MMP-2 in endometrial tissues of non-EM and EM patients. Compared with those in the non-EM group, (A) the mRNA expression of MMP-2 in EM patients is remarkably increased, (B) while the mRNA expression of LC3 and (C) Beclin1 is remarkably decreased. LC3, light chain 3; MMP-2, matrix metalloproteinase-2; EM, endometriosis. *P<0.05.