Literature DB >> 30185783

Polyphyllin I suppresses the formation of vasculogenic mimicry via Twist1/VE-cadherin pathway.

Ting Xiao1,2, Weilong Zhong1,2, Jianmin Zhao3, Baoxin Qian4, Huijuan Liu1,5, Shuang Chen1, Kailiang Qiao1,2, Yueyang Lei1,2, Shumin Zong1,2, Hongzhi Wang1,2, Yuan Liang1,2, Heng Zhang2, Jing Meng1,2, Honggang Zhou1,2, Tao Sun6,7, Yanrong Liu8,9, Cheng Yang10,11.   

Abstract

Vasculogenic mimicry (VM) is a functional microcirculation pattern formed by aggressive tumor cells and is related to the metastasis and poor prognosis of many cancer types, including hepatocellular carcinoma (HCC). Thus far, no effective drugs have been developed to target VM. In this study, patients with liver cancer exhibited reduced VM in tumor tissues after treatment with Rhizoma Paridis. Polyphyllin I (PPI), which is the main component of Rhizoma Paridis, inhibited VM formation in HCC lines and transplanted hepatocellular carcinoma cells. Molecular mechanism analysis showed that PPI impaired VM formation by blocking the PI3k-Akt-Twist1-VE-cadherin pathway. PPI also displayed dual effects on Twist1 by inhibiting the transcriptional activation of the Twist1 promoter and interfering with the ability of Twist1 to bind to the promoter of VE-cadherin, resulting in VM blocking. This study is the first to report on the clinical application of the VM inhibitor. Results may contribute to the development of novel anti-VM drugs in clinical therapeutics.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30185783      PMCID: PMC6125388          DOI: 10.1038/s41419-018-0902-5

Source DB:  PubMed          Journal:  Cell Death Dis            Impact factor:   8.469


Introduction

Despite considerable advances in treatment of hepatocellular carcinoma (HCC) in recent years, the prognosis of patients with HCC remains very poor[1]. Angiogenesis is crucial to promote the growth and metastasis of HCC, which is a vascularized tumor[2]. Tumor vascularization was thought to be formed only by endothelial cells until Maniotis[3] discovered vasculogenic mimicry (VM) in 1999; VM is the ability of aggressive tumor cells to form functional blood channels without endothelial cell lining. CD34 or CD31 and periodic acid–Schiff (PAS) dual-staining have been applied to distinguish the matrix-rich morphological pattern of VM among endothelial cells undergoing angiogenesis[3]. The phenotype of VM is characterized by increased motility and invasiveness[4,5]. VM has been found in several cancer types, including melanoma[3,6,7], ovarian carcinoma[8], colorectal cancer[9,10], laryngeal squamous cell carcinoma[11,12], and HCC[5]. VM could be related to the poor prognosis of patients with HCC[13,14]. Conventional anti-angiogenic agents cannot inhibit VM[15,16]. Thus, drugs targeting VM must be developed. Polyphyllin I (PPI) isolated from Rhizoma Paridis saponins has important roles in traditional Chinese medicine. Previous studies showed that PPI exhibits remarkable anti-tumor effects via apoptosis induction in a variety of cancers[17,18], including HCC[19,20]. However, the effect of PPI on angiogenesis, particularly in VM formation, remains unclear. In the present study, we found that patients with HCC treated with Rhizoma Paridis extracts exhibited reduced microvessel density (MVD) and number of VM. In particular, PPI, as the main component of Rhizoma Parids, inhibited VM formation in both HCC cell lines and xenografts of HCC. Cancer stem cells (CSCs) and epithelial–mesenchymal transition (EMT) play vital roles in VM formation[21,22]. Our previous study showed that Twist1, the key transcription factor of EMT, promotes VM formation by binding to the promoter of VE-cadherin (CDH5)[5]. Other pathways that regulate VM include the vascular endothelial growth factor receptor-2 (VEGFR-2)/Flk-1 pathway[23-25], the VE-cadherin[5,26,27] and EphA2 pathways[28], the RTK/PI3K/Akt/mTOR signaling pathway[29], and the MMP-laminin-5γ2-chain signaling pathway[30-32]. These molecules were expressed at low levels in HCC tumors treated with Rhizoma Paridis extracts. The molecular pathway analysis also showed that PPI decreases the expression level of Twist1 via the PI3K/Akt/Twist1 pathway and the transcriptional activity of VE-cadherin to impair VM formation in HCC. These findings may elucidate VM mechanism and provide new insights into anti-angiogenesis therapy.

Materials and Methods

Patient samples

Twenty HCC specimens from patients treated with Rhizoma Paridis extracts were collected from the People’s Hospital of Shouguang (Shandong Province, China). Another 69 specimens from patients who did not undergo therapy before tumor surgical operation were collected from the same hospital and used as controls. All clinical tests were approved by the Hospital Research Ethics Committee. Postoperative clinical information of HCC patients, including age, pathological stage, tumor differentiation, tumor diameter, tumor number, vascular invasion, nodal status, metastasis, HBsAg and alkaline phosphatase are shown in Tables S1 and S2. The patients were treated with 60 mg/kg Rhizoma Paridis root extracts twice daily for 10 days. The treatment consisted of six courses and 2 days break for each course. The slides were assessed by two pathologists to determine a pathological diagnosis.

Reagents

Polyphyllin I, polyphyllin II, polyphyllin III, polyphyllin IV, polyphyllin V, polyphyllin VI, polyphyllin VII (with purity more than 98%) were purchased form PUSH Bio-technology (Chengdu, China). Recombinant human VEGF-a protein was obtained from Abcam (Cambridge, UK, No. Ab55566), and 10 ng/mL of the protein was used in each experiment. MTT was acquired from Keygene BioTECH (Nanjing, China). The PI3K inhibitor wortmannin was provided by Huaxia Yuanyang (Beijing, China) and used at 1 µM in vitro.

Cell lines and culture

HCC cell lines including SMMC7721, PLC, HepG2, Hep3B, and Bel7402 were purchased from Keygene BioTECH (Nanjing, China) and validated through a short tandem repeat-based method. The cells were kept in RPMI 1640 (Neuronbc, Beijing, China) medium containing 10% fetal bovine serum (FBS, Neuronbc, Beijing, China) and 1% penicillin-streptomycin (KeyGEN BioTECH, Nanjing, China). All cells were kept in an incubator at 37 °C under a humidified atmosphere of 5% CO2.

Plasmid and transfection

Total complementary DNA (cDNA) from healthy human embryo was used to generate full-length Twist1 cDNA. After the sequence was confirmed, Twist1 cDNA was digested with XhoI and EcoRI. The pcDNA3.1 vector was selected for cloning. Twist1 knockdown assay was performed by transfection with pGP-Twist1-shRNA, which was purchased from GenePharm (Shanghai, China). Twist1 was downregulated using the target sequence AAGCTGAGCAAGATTCAGACC (siTwist1 nucleotides 505–525) in vitro. Non-silencing siRNA with the sequence 5′-AATTCTCCGAACGTGTCACGT-3′ was used as negative control. Vector and scramble plasmids were used with the corresponding controls as previously described[5]. Cells expressing pcDNA3.1-Twist1 or pGP-Twist1-shRNA were transfected with Lipofectamine 2000 (No. 11668019, Invitrogen) according to the manufacturer’s protocol.

Immunohistochemical staining

Slides were vitrified using dimethylbenzene, dehydrated using graded ethanol, and rehydrated in phosphate-buffered saline. The slides were incubated in citrate retrieval buffer (pH 6.0) at 98 °C for 20 min and blocked with 5% goat serum. The slides were incubated overnight at 4 °C with primary antibodies against Twist1, VEGFR1, VEGFR2, E-cadherin, vimentin, PI3K, p-AKT, MMP2, MMP9, and laminin 5 (the details of the antibodies are provided in Supplementary Table S3). The slides were added with an immune enhancement agent at room temperature for 20 min followed by an anti-mouse/anti-rabbit immuno-peroxidase polymer (UltraSensitiveTM SP (Mouse/Rabbit) IHC Kit, MXB, Fujian, China) at room temperature for 30 min. The slides were colorized with a diaminobenzidine substrate-chromogen solution for 3 min. The sections were directly counterstained with hematoxylin or subjected to PAS staining first followed by hematoxylin staining (CD31-PAS staining). The sections were dehydrated, cleared, and placed under coverslips after the reaction. The sections were then examined using Olympus light microscope (Japan). Tissue subjected to the same staining procedure without incubation with the primary antibody was used as negative control.

Circulating tumor cell detection and flow cytometry

Circulating tumor cells (CTCs) from patients’ peripheral blood were detected using DynabeadsTM Epithelial Enrich kit (Thermo Fisher Scientific, USA) as previously reported[33]. Approximately 20 mL of blood were collected from each patient, and the epithelial cells were enriched by immunomagnetic capture according to the manufacturer’s instructions. For the flow cytometry analysis, the primary antibodies were applied overnight at 4 °C. After treatment with VEGF-a or co-treatment with PPI, PLC, and SMMC7721 cells were trypsinized and fixed with 75% ethanol before incubation with primary antibodies against VE-cadherin, VEGFR1, or VEGFR2 (details of antibody are provided in Table S3). The cells were then stained with fluorescein isothiocyanate-conjugated or tetramethyl rhodamine isothiocyanate (TRITC)-conjugated mouse or rabbit secondary antibody (Nos. A0453 and A0460; Beyotime, Shanghai, China). All flow cytometry data were analyzed using CFlow software (version 1.4).

Three-dimensional culture assay

SMMC7721, PLC, HepG2, Hep3B, and Bel7402 cells were seeded in six-well culture plates prepared with Matrigel (Collaborative Biomedical). The cells were co-incubated with VEGF-a and various concentrations of PPI (0.1, 0.3, and 1 µM). After incubation, cell images were captured using the Nikon microscope.

MTT assay

MTT assay was performed as described previously[34] to analyze cell viability after PPI treatment. The cultures were maintained in 96-well plates at 5 × 103 cells/mL for 72 h. Adherent cells were treated with various concentrations of PPI. After 48 h of incubation, the plates were added with 20 μL of MTT solution in each well and incubated at 37 °C for 4 h prior to cell viability measurement. Formazan crystals were dissolved in 150 μL of DMSO. The absorbance of the solution was quantified at 570 nm wavelength by using a microplate reader (Multiskan™ FC, Thermo Scientific, Waltham, MA, USA). All experiments were performed at least three times.

Wound healing and transwell assays

HCC cells were grown in a 35 mm dish to over 80% confluency and transfected into 24-well plates for 24 h. A 200 μm wound was scratched into the cells by using a p20 pipette tip. The cells were then co-incubated with VEGF-a for 1 h and added with different concentrations of PPI (0.1, 0.3, and 1 μM). Cell images were captured after 48 h by using a Nikon microscope (A1 Laser confocal microscope, Nikon, Japan). For the transwell assay, cells in the serum-free medium (grouping was the same as above) were seeded onto a chamber coated with Matrigel (BD, USA) and inserted into the wells of a 24-well plate. The invasive cells were stained with 0.1% crystal violet and counted after 24 h of cell seeding.

Immunofluorescence staining

PLC and SMMC7721 cells (4 × 103 cells/mL) were seeded in 24-well culture plates. The cells were treated with VEGF-a or VEGF-a and PPI (0.1 μM) and incubated for 48 h. The cells were fixed in ice-cold methanol, permeabilized, and blocked with bovine serum albumin (3%). The cells were incubated with primary antibodies against VE-cadherin and E-cadherin for 1 h at room temperature (25 °C) (Table S3). The cells were then incubated with a secondary antibody (No. A0453, A0460, Beyotime, Shanghai, China 1:200 dilution) for 30 min at room temperature. The cells were washed in PBS, stained with DAPI (Sigma), and captured using a confocal fluorescence microscope (A1 Laser confocal microscope, Nikon, Japan).

Western blot analysis

Whole-cell lysates were obtained from cells under different treatments and analyzed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS–PAGE). The proteins were transferred onto polyvinylidene difluoride membranes (Millipore). The blots were blocked with 5% nonfat milk. The membranes were incubated with primary antibodies against Twist1, VE-cadherin, VEGFR1, VEGFR2, AKT, p-AKT, CD133, CD44, or GAPDH for 1 h at room temperature. The membranes were added with a secondary antibody, which is conjugated with either horseradish peroxidase (HRP) or TRITC (No. A0208, A0216, Beyotime, Shanghai, China 1:5000 dilution) and subjected to an electrophoresis gel imaging system (ChemiScope 6000, CLIX, Shanghai, China).

Dual-luciferase assay

PLC and SMMC7721 cells were transfected with Twist1, Twist2, SNAIL1 and SNAIL2, E-cadherin, VE-cadherin, VEGFR1, and VEGFR2 promoter-luciferase reporter plasmids (the promoter sequence and vector information are provided in Table S4). After transfection, fresh medium was applied every 24 h, and the cells were treated with various concentrations of PPI (0.1, 0.3, and 1 μM). After 48 h, the cells were harvested, and their luciferase activity was examined on the dual-luciferase reporter assay system (Promega, E1960) by using a luminometer.

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation (ChIP) assay was performed as follows. In brief, 1 × 107 growing cells were used to prepare soluble chromatin solution. The protein–A/G beads blocked with salmon sperm DNA and pre-immune serum were used to dilute and preclear the chromatin solution. The pre-processed chromatin solution was divided and used for immunoprecipitation assays with an anti-Twist1 antibody. The beads were washed and incubated to reverse the crosslink and elute the antibody-protein-DNA complex. RNA and protein were removed to obtain the purified DNA. DNA with primers specific for the human VE-cadherin promoter was subjected to PCR analysis. The sequence 5′-AGCCAGCCCAGCCCTCAC-3′ was used as forward primer for PCR, and the sequence 5′-CCTGTCAGCCGACCGTCTTTG-3′ was used as reverse primer.

Gene expression profiling microarray assay

PLC cells untreated or treated with PPI for 24 h were collected and lysed using TRIzol to isolate total RNA. The samples were further examined by Genergy Bio-technology (Shanghai, China). Data analysis was performed to determine critical pathways. Gene set enrichment analysis (GSEA) was conducted to detect PPI-induced changes in molecular functions, biological processes, and cellular components. KEGG pathway analysis was also carried out to reveal the affected signaling pathways.

Xenograft model

Male BALB/c nude mice aged 4–6 weeks were used in the experiments. According to institutional guidelines, all animals were maintained in a specific pathogen-free animal care facility. PLC cells (1 × 107) transfected with PLC-pcDNA3.1 or PLC-pcDNA3.1-Twist1 were suspended in PBS and subcutaneously injected into the flank of nude mice. After the tumor volume reached 100 mm3, the mice were randomly divided into PLC-pcDNA3.1 (PLC), PLC-pcDNA3.1-Twist1 (PLC-Twist1), PLC-pcDNA3.1+PPI (PLC+PPI), and PLC-pcDNA3.1-Twist1+PPI (PLC-Twist1+PPI) groups (n = 10/group). In brief, 10 mg/kg PPI (according to the clinical dose conversion) was given to mice in the PLC+PPI or PLC-Twist1+PPI groups. Tumor volume was then monitored for 25 days and calculated with the following formula: TV = ab2/2 (a represents the length and b represents the width of the tumor). Four weeks after groupings, all the animals were euthanized. The xenografts, lungs, and liver were preserved in 10% formalin solution for further study. For survival analysis, another 40 mice were randomly divided into the four groups mentioned (n = 10). In brief, 1 × 107 tumor cells were injected into the caudal vein of the mice. The survival time of each group was recorded.

Statistical analysis

All data were expressed as mean ± standard deviation. After testing for normality and equal variance across groups, intergroup differences were assessed using Student’s t-tests, analysis of variance (ANOVA), and multivariate statistical analysis. Kaplan–Meier test was used for survival analysis. P < 0.05 was considered statistically significant.

Results

Rhizoma Paridis extracts significantly reduce VM formation and inhibit metastasis in patients with HCC

We retrospectively surveyed the clinical stages (measured by Barcelona Clinic Liver Cancer (BCLC) staging system, Table S5) of the patients before Rhizoma Paridis treatment. It was found that no obvious differences can be found between Rhizoma Paridis treated and untreated groups (Table S5). The postoperative clinic data was then analyzed and it was found that the metastasis and vascular invasion rate of HCC patients treated with Rhizoma Paridis was lower than that of patients untreated with Rhizoma Paridis (Table S6). Microvessel density (MVD) and VM in the tumor tissues were analyzed. The results showed that patients with HCC treated with Rhizoma Paridis extract before surgery exhibited less MVD and VM than the untreated patients (Fig. 1a, b). The extracellular matrix-rich channels (PAS-positive) surrounded by tumor cells were negatively stained with CD31 and contained red blood cells. Immunohistochemical staining analysis showed that the expression levels of VM markers (VEGFR1, VEGFR2, and VE-cadherin) and molecules involved in VM (MMP2, MMP9, and laminin5) decreased in the Rhizoma Paridis extract-treated group (Fig. 1c, d). Additionally, the decreased expression levels of vimentin and Twist1 and the increased expression of E-cadherin indicated that Rhizoma Paridis extracts inhibited EMT (Fig. 1c, d). Circulating tumor cells (CTCs) from the peripheral blood of patients were analyzed. Patients treated with Rhizoma Paridis extracts possessed few CTCs in the blood (Fig. 1e). The PPI content in Paridis Rhizoma extract is displayed in Table S7. In this study, the root of Paridis Rhizoma (containing 16.21 mg PPI/g) was given to the patients (60 mg/kg); each of the patient received approximately 1 mg/kg PPI.
Fig. 1

VM formation and EET markers were significantly reduced in patients with HCC treated with Rhizoma Paridis extracts.

a Evidence and morphologic observation of VM in HCC. Red arrow points to the PAS-positive and CD31-negative vessels lining with tumor cells. Yellow arrow points to the endothelial cell lined vessels. b Statistical results of MVD and VM of patients treated and untreated with Rhizoma Paridis extract. Results showed reduced MVD and lack of VM in HCC tissues treated by Rhizoma Paridis extract. c, d Immunohistochemical staining of E-cadherin, vimentin, Twist1, VE-cadherin, VEGFR1, VEGFR2, MMP2, MMP9, and laminin5. e Circulating tumor cells in the peripheral blood of patients. The results showed significantly decreased number of CTCs in patients treated with Rhizoma Paridis extract. The values are means of three experiments, and error bars represent standard deviation (*P < 0.05, **P < 0.01)

VM formation and EET markers were significantly reduced in patients with HCC treated with Rhizoma Paridis extracts.

a Evidence and morphologic observation of VM in HCC. Red arrow points to the PAS-positive and CD31-negative vessels lining with tumor cells. Yellow arrow points to the endothelial cell lined vessels. b Statistical results of MVD and VM of patients treated and untreated with Rhizoma Paridis extract. Results showed reduced MVD and lack of VM in HCC tissues treated by Rhizoma Paridis extract. c, d Immunohistochemical staining of E-cadherin, vimentin, Twist1, VE-cadherin, VEGFR1, VEGFR2, MMP2, MMP9, and laminin5. e Circulating tumor cells in the peripheral blood of patients. The results showed significantly decreased number of CTCs in patients treated with Rhizoma Paridis extract. The values are means of three experiments, and error bars represent standard deviation (*P < 0.05, **P < 0.01)

PPI impairs the tube formation of HCC cells in vitro

The effects of VM inhibition by the bioactive components of Rhizoma Paridis extracts were evaluated in vitro. The tube formation ability of five HCC cell lines (SMC7721, PLC, HepG2, Hep3B, and Bel7402) treated with (PPI, polyphyllin II, polyphyllin III, polyphyllin IV, polyphyllin V, polyphyllin VI, and polyphyllin VII) was determined. It was found that PPI exhibited the most obvious inhibitory effect on VM formation (Fig. 2a and Fig. S1).
Fig. 2

PPI inhibited migration, invasion and tube formation of HCC cells in vitro.

a Polyphyllin I exhibited the most obvious inhibitory effect on VM formation. b Structure of PPI. c Effects of PPI on the viability of SMMC7721, PLC, HepG2, Hep3B, and Bel7402 cells. PPI reduced the survival rate of HCC cells at relatively high concentrations and had slight influence on cell survival below 1 μM. d Cell cycle analysis of PPI in HCC cell lines. 0.1 μM PPI did not influence the cycle of HCC cells. e, f PPI inhibited the migration and invasion of HCC cells. g PPI decreased the number of pipe-like structures in SMMC7721 cells on Matrigel. h Time-lapse images of SMMC7721. PPI inhibited the pipe-like structure formation in SMMC7721 cells (n = 3)

PPI inhibited migration, invasion and tube formation of HCC cells in vitro.

a Polyphyllin I exhibited the most obvious inhibitory effect on VM formation. b Structure of PPI. c Effects of PPI on the viability of SMMC7721, PLC, HepG2, Hep3B, and Bel7402 cells. PPI reduced the survival rate of HCC cells at relatively high concentrations and had slight influence on cell survival below 1 μM. d Cell cycle analysis of PPI in HCC cell lines. 0.1 μM PPI did not influence the cycle of HCC cells. e, f PPI inhibited the migration and invasion of HCC cells. g PPI decreased the number of pipe-like structures in SMMC7721 cells on Matrigel. h Time-lapse images of SMMC7721. PPI inhibited the pipe-like structure formation in SMMC7721 cells (n = 3) The structure of PPI is shown in Fig. 2b. Five HCC cell lines (SMMC7721, PLC, HepG2, Hep3B, and Bel7402) were examined through MTT and cell cycle assays to confirm the effects of PPI on cell viability. Less than 1 μM PPI did not affect cell survival and 0.1 μM PPI did not affect the cell cycle (Fig. 2c, d and Fig. S2). In the wound healing assay, PPI dramatically inhibited the speed of wound healing compared with the control and VEGF-a-treated groups in a dose-dependent manner (Fig. 2e and Fig. S3A). We examined the invasion ability of cultured cells through Transwell assay. The invasion ability of the cultured cells was significantly inhibited by PPI (Fig. 2f and Fig. S3B). The in vitro VM formation ability of HCC cells was then evaluated through three-dimensional Matrigel assays. The number of pipe-like structures in cells treated with PPI considerably decreased compared with that in the untreated groups (Fig. 2g and Fig. S3C). Time-lapse dynamic imaging indicated that PPI inhibited the formation of pipe-like structures in HCC cells (Fig. 2h and Fig. S3D, the red arrow indicates the pipe-like structures). A decrease in the expression of E-cadherin, an epithelial marker associated with intercellular junctions and cell adhesion, causes cells to lose their epithelial phenotype and undergo EMT[35]. By contrast, an increase in the expression of the endothelial cell marker VE-cadherin promotes the transition of tumor cells into endothelial-like cells, leading to VM. As shown in Fig. 3a, PPI treatment induced the increase in the expression of E-cadherin and the decrease in the expression of VE-cadherin. This finding indicates loss of the endothelial characteristic of the tumor cells by PPI treatment. Flow cytometry analysis also showed that PPI decreased the expression levels of VE-cadherin, VEGFR1, and VEGFR2, which were upregulated by VEGF-a induction (Fig. 3b-c). In SMC7721 cells, the VE-cadherin positive ratios were 36.267% in the control group, 67.650% in the VEGF-a treatment group, and only 12.85% in the VEGF-a/PPI group (Fig. 3b). Western blot analysis also showed that PPI reversed the effects of VEGF-a-induced acquisition of the endothelial phenotype, which is characterized by loss of E-cadherin and upregulation of vimentin, VEGFR1, VEGFR2, and VE-cadherin (Fig. 3d). This finding indicated that PPI inhibited epithelial-endothelial transition (EET), a key process that promotes VM formation[36]. Hence, PPI may inhibit EET, resulting in suppressed VM formation.
Fig. 3

PPI decreased the expression of EET markers in HCC cells in vitro.

a Immunofluorescence analysis showed that PPI increased the expression of E-cadherin (green) and decreased the expression of VE-cadherin (red). b, c Flow cytometry analysis showed that VE-cadherin, VEGFR1, and VEGFR2 expression levels were upregulated by VEGF-a and inhibited by PPI. d Western blot analysis results show that PPI increased E-cadherin expression and decreased the expression levels of vimentin, VEGFR1, VEGFR2, and VE-cadherin upregulated by VEGF-a compared with the negative control (n = 3)

PPI decreased the expression of EET markers in HCC cells in vitro.

a Immunofluorescence analysis showed that PPI increased the expression of E-cadherin (green) and decreased the expression of VE-cadherin (red). b, c Flow cytometry analysis showed that VE-cadherin, VEGFR1, and VEGFR2 expression levels were upregulated by VEGF-a and inhibited by PPI. d Western blot analysis results show that PPI increased E-cadherin expression and decreased the expression levels of vimentin, VEGFR1, VEGFR2, and VE-cadherin upregulated by VEGF-a compared with the negative control (n = 3)

PPI causes dual suppression of Twist1

Considering that EMT-inducing transcription factors could promote the differentiation of CSCs into endothelium-like cells to form VM channels[37], we examined whether PPI inhibits VM by inhibiting the promoter activity of EMT transcription factors. In the dual-luciferase assay, PLC and SMMC7721 cells were transfected with luciferase reporter plasmids containing Twist1, Twist2, SNAIL1, and SNAIL2 promoters. PPI suppressed the activity of the Twist1 promoter but did not change those of the Twist2, SNAIL1, and SNAIL2 promoters (Fig. 4a). The immunofluorescence results of Twist1 further confirmed that the expression of Twist1 and its location in the nucleus was suppressed by PPI (Fig. 4b). A previous study reported that hypoxia promotes EMT and EET in HCC cells via Twist1 expression induction[38]. In the present work, hypoxia induced the upregulation of Twist1, vimentin, VEGFR1, VEGFR2, CD133, and CD34; decreased the expression of E-cadherin; and did not change the homologous expression of Twist2 (Fig. 4c). Additionally, PPI significantly reversed the inducible effect of hypoxia, as demonstrated by the decreased expression of Twist1 and endothelial markers, namely, VE-cadherin, VEGFR1, VEGFR2, CD133, and CD34; and the increased expression of E-cadherin (Fig. 4c). Moreover, the expression of Twist1 was partially silenced by Twist1 shRNA, which was further reduced by PPI. The expression levels of VE-cadherin, VEGFR1, VEGFR2, and the mesenchymal marker vimentin synchronously decreased. Thus, PPI enhanced the effect of Twist1 downregulation (Fig. 4d). We also showed that PPI inhibited the transcription of VE-cadherin, VEGFR1, and VEGFR2 and increased that of E-cadherin (Fig. 4e). These results indicate that PPI inhibits the transcription of Twist1, thereby decreasing the expression of EET-related downstream proteins and upregulating the expression of E-cadherin. In our previous study, Twist1 binds to the promoter of VE-cadherin and promotes the transcriptional activity of VE-cadherin[5]. We thus determined whether this mechanism is related to the effect of PPI on VE-cadherin transcription activity. The present Chip-PCR results showed that PPI blocked the binding action of Twist1 to the VE-cadherin promoter and suppressed the transcriptional function of Twist1 (Fig. 4f).
Fig. 4

PPI inhibited the expression and transcription function of Twist1.

a Dual-luciferase assay results of Twist1, Twist2, SNAIL1, and SNAIL2. PPI inhibited the Twist1 promoter activity in a dose-dependent manner. b Immunofluorescence results showed that PPI inhibited Twist1 expression in the nucleus. c Western blot results showed that induced hypoxia upregulated Twist1 and VM markers; this effect was reversed by PPI. d PPI also enhanced Twist1 downregulation in SMMC7721 cells. The expression levels of Twist1, vimentin, VEGFR1, VEGFR2, and VE-cadherin decreased, whereas that of E-cadherin increased. e Dual-luciferase assay of E-cadherin, VE-cadherin, VEGFR1, and VEGFR2. PPI decreased the expression levels of VE-cadherin, VEGFR1, and VEGFR2 and increased that of E-cadherin. f ChIP-PCR assay showed that PPI inhibited the binding of Twist1 to the promoter of VE-cadherin. The values are means of three experiments, and error bars represent standard deviation (n = 3, *P < 0.05, **P < 0.01)

PPI inhibited the expression and transcription function of Twist1.

a Dual-luciferase assay results of Twist1, Twist2, SNAIL1, and SNAIL2. PPI inhibited the Twist1 promoter activity in a dose-dependent manner. b Immunofluorescence results showed that PPI inhibited Twist1 expression in the nucleus. c Western blot results showed that induced hypoxia upregulated Twist1 and VM markers; this effect was reversed by PPI. d PPI also enhanced Twist1 downregulation in SMMC7721 cells. The expression levels of Twist1, vimentin, VEGFR1, VEGFR2, and VE-cadherin decreased, whereas that of E-cadherin increased. e Dual-luciferase assay of E-cadherin, VE-cadherin, VEGFR1, and VEGFR2. PPI decreased the expression levels of VE-cadherin, VEGFR1, and VEGFR2 and increased that of E-cadherin. f ChIP-PCR assay showed that PPI inhibited the binding of Twist1 to the promoter of VE-cadherin. The values are means of three experiments, and error bars represent standard deviation (n = 3, *P < 0.05, **P < 0.01) To further illustrate the molecular mechanism of PPI on VM formation, we conducted gene expression profiling microarray analysis. GSEA analysis revealed that PPI treatment affected cellular functions, including transcription, protein binding, transcriptional activity of RNA polymerase II, sequence-specific DNA binding, regulation of stem cell differentiation, and blood vessel morphogenesis (Fig. 5a). The pathway analysis diagram according to KEGG analysis is presented in Fig. 5b. PPI was shown to inhibit hypoxia or VEGF-a activated the PI3K/Akt pathway, which may be responsible for the upregulation of Twist1 and the induction of VM formation. To validate this hypothesis, we used the PI3k inhibitor wortmannin to inhibit the activation of the PI3K-Akt pathway, which can be activated by hypoxia or VEGF-a. Cells treated with the PI3K inhibitor or PPI inhibited the phosphorylation of AKT but showed no effect on the levels of PI3K and AKT. Meanwhile, the PI3K inhibitor or PPI inhibited the upregulation of Twist 1 expression induced by hypoxia or VEGF-a, thereby suppressing the EET of tumor cells (Fig. 5c,d). All these results show that similar to the PI3K inhibitor, PPI could suppress hypoxia or VEGF-a-activated PI3K/Akt pathway and upregulation of Twist1 and the acquisition of EET characteristics (Fig. 5c, d).
Fig. 5

PPI inhibited the PI3K-AKT-Twist1-VE-cadherin pathway.

a Gene expression profiling microarray analysis of the effect of PPI on PLC cells. GSEA revealed that PPI treatment affected numerous cellular functions including transcription, protein binding, regulation of stem cell differentiation, and blood vessel morphogenesis. b The pathway diagram according to KEGG pathway analysis showed that PPI inhibited hypoxia or VEGF-a activating the PI3K/Akt pathway, which may be responsible for the upregulation of Twist1 and the induction of VM formation. c–f Western blot analysis of the effect of wortmannin or PPI on the PI3K-AKT-Twist1-VE-cadherin pathway of PLC cells.c PI3K inhibitor (wortmannin) or PPI-reversed EET induced by hypoxia or VEGF-a. d, e The effects of PPI were confirmed by Twist overexpression or interference. After Twist1 overexpression, VE-cadherin expression was inhibited by PPI but not by the PI3K inhibitors. The knockdown assay of Twist1 further confirmed that PPI significantly decreased the VE-cadherin level than the PI3K inhibitors (n = 3)

PPI inhibited the PI3K-AKT-Twist1-VE-cadherin pathway.

a Gene expression profiling microarray analysis of the effect of PPI on PLC cells. GSEA revealed that PPI treatment affected numerous cellular functions including transcription, protein binding, regulation of stem cell differentiation, and blood vessel morphogenesis. b The pathway diagram according to KEGG pathway analysis showed that PPI inhibited hypoxia or VEGF-a activating the PI3K/Akt pathway, which may be responsible for the upregulation of Twist1 and the induction of VM formation. c–f Western blot analysis of the effect of wortmannin or PPI on the PI3K-AKT-Twist1-VE-cadherin pathway of PLC cells.c PI3K inhibitor (wortmannin) or PPI-reversed EET induced by hypoxia or VEGF-a. d, e The effects of PPI were confirmed by Twist overexpression or interference. After Twist1 overexpression, VE-cadherin expression was inhibited by PPI but not by the PI3K inhibitors. The knockdown assay of Twist1 further confirmed that PPI significantly decreased the VE-cadherin level than the PI3K inhibitors (n = 3) The PI3k inhibitor and PPI suppressed the EET of tumor cells, which were induced by the overexpression of Twist1 (Fig. 5e). In the overexpressing Twist1 group, the phosphorylation of Akt was inhibited by wortmannin as well as by PPI, suggesting that PPI showed the same inhibition effect on the PI3k/Akt pathway activation as wortmannin. However, Twist1 was still highly expressed, indicating that the E-cadherin level did not further increase after treatment with the PI3K inhibitor or PPI. After Twist1 overexpression, VE-cadherin expression was inhibited by PPI but not by the PI3K inhibitor, thereby validating that PPI could also interfere with the transcription of VE-cadherin by Twist1 (Fig. 5e). This finding was further confirmed by the assay of knocked down Twist1 (Fig. 5f). PPI more significantly decreased the VE-cadherin level than the PI3K inhibitor. All of these results confirm that PPI inhibited Twist1 at the expression and functional levels.

PPI inhibits VM formation and metastasis in HCC xenografts

The inhibition effects of PPI on HCC-bearing xenografts were further examined. PLC cells stably transfected with the empty vector or pcDNA3.1-Twist1 were subcutaneously injected and intragastrically administered with PPI. Tumor volume and metastasis were evaluated. Overexpressing Twist1 in PLC cells significantly enhanced tumor growth, which can be inhibited by PPI treatment (Fig. 6a). The survival analysis showed that PPI treatment significantly prolonged the survival time of the transplanted model established by tail-vein injection of tumor cells (Fig. 6b). The number of cancer cells that metastasized in the lung increased in the PLC/Twist1 group than that in the PLC group. PPI significantly reduced metastasis in the PLC or PLC/Twist1 group (Fig. 6c). PPI also decreased the MVD and VM in PLC and PLC/Twist1 cells (Fig. 6d). The immunohistochemical staining results of the xenografted tumor tissues showed that PPI treatment significantly decreased the expression levels of Twist1, VE-cadherin, vimentin, VEGFR1, and VEGFR2 but significantly increased that of E-cadherin (Fig. 6e, f).
Fig. 6

PPI inhibition of EET depends on Twist1 in vivo.

a, b Tumor volumes and survival time of PPI in PLC and PLC/Twist1 (Twist1 overexpression) cell xenografts. PPI significantly inhibited tumor growth in the PLC/Twist1 group and increased the survival rate. c, d PPI decreased lung metastasis, MVD, and VM, and this effect is dependent on Twist1 in the xenografts. The black arrow points to the pulmonary metastasis focuses in c. The Red arrow points to the PAS-positive and endomucin-negative vessels lining with tumor cells. Yellow arrow points to the endothelial cell lined vessels. e, f Effect of PPI on the expression of VM-related proteins. The expression of E-cadherin, which is located in the cell membrane, increased, whereas those of VM markers, namely, VE-cadherin, VEGFR1, VEGFR2, MMP-2, MMP-9, vimentin, and p-Akt, decreased and were located in the cytoplasm. (*P < 0.05, **P < 0.01)

PPI inhibition of EET depends on Twist1 in vivo.

a, b Tumor volumes and survival time of PPI in PLC and PLC/Twist1 (Twist1 overexpression) cell xenografts. PPI significantly inhibited tumor growth in the PLC/Twist1 group and increased the survival rate. c, d PPI decreased lung metastasis, MVD, and VM, and this effect is dependent on Twist1 in the xenografts. The black arrow points to the pulmonary metastasis focuses in c. The Red arrow points to the PAS-positive and endomucin-negative vessels lining with tumor cells. Yellow arrow points to the endothelial cell lined vessels. e, f Effect of PPI on the expression of VM-related proteins. The expression of E-cadherin, which is located in the cell membrane, increased, whereas those of VM markers, namely, VE-cadherin, VEGFR1, VEGFR2, MMP-2, MMP-9, vimentin, and p-Akt, decreased and were located in the cytoplasm. (*P < 0.05, **P < 0.01)

Discussion

VM represents the plastic ability of tumor cells to form functional microcirculation patterns and is associated with hematogenous metastasis of tumors[3,39-41]. Under multiple stimuli, such as shear stress of blood flow, hypoxia, or VEGF-a, tumor cells lose epithelial characteristics and obtain the endothelial phenotype characterized by increased expression levels of VEGFR1, VEGFR2, and VE-cadherin[42-44]. This process is defined as EET, a subtype of EMT, and is essential for VM formation. In this retrospective analysis, treatment with Rhizoma Paridis extract decreased the rate of VM formation and inhibited the endothelial phenotype in patients with HCC. Hence, the extract may have a potential clinical effect on VM inhibition. As the main component of Rhizoma Paridis extract, PPI exhibited a more significant effect on VM suppression than polyphyllin II, IIII, IV, V, VI, and VII. The synergistic effects of PPI with other active components cannot be excluded in clinical trials and in this study, the anti-tumor effect of PPI was further verified by subsequent in vitro and in vivo animal experiments. PPI exerts anti-tumor effects on a variety or tumors, including HCC, by apoptosis induction or migration inhibition[19,20]. Consistent with previous works, the present study indicated that PPI inhibited the growth and arrest the cycle of HCC cells in vitro when administered at high concentrations but inhibited migration, invasion, and VM formation in the cells at relatively low concentrations. Twist1 is a crucial regulator in EMT and EET because it upregulates the transcription of VE-cadherin, promotes the transition of tumor cells to endothelial-like cells and the expression and remodeling of laminin 5, and induces the activity of MMPs and secretion of PAS-positive substances[5]. In the present study, PPI inhibited Twist1 expression and thus decreased the expression levels of EMT and EET markers, leading to impaired VM formation. Previous research demonstrated that hypoxia and VEGF-a may induce EET[45]. The activation of PI3K–Akt signaling also activates Twist1[46,47]. In the present study, PPI inhibited the Twist1 expression upregulated by hypoxia or VEGF-a, thereby inhibiting the tube formation in vitro and the expression of endothelial markers. PPI also inhibited Twist1 promoter activity. Hence, the target of PPI could be the transcription-associated proteins of Twist1 upstream of the PI3K/AKT signaling pathway. Further results of the ChIP-PCR analysis revealed that PPI interfered with the binding of Twist1 to the VE-cadherin promoter, thereby inhibiting EET and the promoter activity of VE-cadherin. PPI exhibited dual effects on Twist1. First, as mentioned above, PPI inhibited Twist1 promoter activity, resulting in decreased expression of Twist1. Second, it inhibited the transcription function of Twist1 and blocked the regulation of VE-cadherin promoter activity. The dual effects of PPI were confirmed by the experiment on Twist overexpression or interference. After Twist1 overexpression, VE-cadherin expression was inhibited by PPI but not by the PI3K inhibitors. The knockdown assay of Twist1 further confirmed that PPI more significantly decreased the VE-cadherin level than the PI3K inhibitors. In general, PPI decreased the inhibitory effect of Twist1 on E-cadherin and the transcription-promoting effect on VE-cadherin, leading to termination of EET in tumor cells. The advantages that PPI has over P13K inhibitors are as follows: (1) PPI exhibits dual effects on Twist1. First, PPI decreases the expression of Twist1 via the inhibition of the PI3k/Akt pathway activation as wortmannin. Second, PPI inhibits the transcription function of Twist1 and blocks the regulation of VE-cadherin promoter activity. (2) PPI, as herbal medicine from herb extracts, functions superior to synthetic drugs because it is safer, of better quality, cost-effective, and features a longer history proving their effectiveness. In summary, PPI could be a potent inhibitor of EET-VM via the inhibition of PI3K/Akt/Twist1/VE-cadherin pathway. PPI reduces the risk of hematogenous metastasis and thus may have a significant role in clinical therapeutics. Supplementary Data Table S1 Table S2
  47 in total

1.  AKT1 Inhibits Epithelial-to-Mesenchymal Transition in Breast Cancer through Phosphorylation-Dependent Twist1 Degradation.

Authors:  Chia-Wei Li; Weiya Xia; Seung-Oe Lim; Jennifer L Hsu; Longfei Huo; Yun Wu; Long-Yuan Li; Chien-Chen Lai; Shih-Shin Chang; Yi-Hsin Hsu; Hui-Lung Sun; Jongchan Kim; Hirohito Yamaguchi; Dung-Fang Lee; Hongmei Wang; Yan Wang; Chao-Kai Chou; Jung-Mao Hsu; Yun-Ju Lai; Adam M LaBaff; Qingqing Ding; How-Wen Ko; Fuu-Jen Tsai; Chang-Hai Tsai; Gabriel N Hortobagyi; Mien-Chie Hung
Journal:  Cancer Res       Date:  2016-01-12       Impact factor: 12.701

2.  Melanoma spheroid formation involves laminin-associated vasculogenic mimicry.

Authors:  Allison R Larson; Chung-Wei Lee; Cecilia Lezcano; Qian Zhan; John Huang; Andrew H Fischer; George F Murphy
Journal:  Am J Pathol       Date:  2014-01       Impact factor: 4.307

Review 3.  Systemic Therapy for Hepatocellular Carcinoma: 2017 Update.

Authors:  Masatoshi Kudo
Journal:  Oncology       Date:  2017-12-20       Impact factor: 2.935

4.  Cooperative interactions of laminin 5 gamma2 chain, matrix metalloproteinase-2, and membrane type-1-matrix/metalloproteinase are required for mimicry of embryonic vasculogenesis by aggressive melanoma.

Authors:  R E Seftor; E A Seftor; N Koshikawa; P S Meltzer; L M Gardner; M Bilban; W G Stetler-Stevenson; V Quaranta; M J Hendrix
Journal:  Cancer Res       Date:  2001-09-01       Impact factor: 12.701

5.  Hypoxia promotes epithelial-mesenchymal transition of hepatocellular carcinoma cells via inducing Twist1 expression.

Authors:  X-D Zhang; X-Q Dong; J-L Xu; S-C Chen; Z Sun
Journal:  Eur Rev Med Pharmacol Sci       Date:  2017-07       Impact factor: 3.507

6.  A synergistic antitumor effect of polyphyllin I and formosanin C on hepatocarcinoma cells.

Authors:  Jing Liu; Shuli Man; Zhen Liu; Long Ma; Wenyuan Gao
Journal:  Bioorg Med Chem Lett       Date:  2016-09-03       Impact factor: 2.823

7.  Vasculogenic mimicry contributes to lymph node metastasis of laryngeal squamous cell carcinoma.

Authors:  Wei Wang; Peng Lin; Chunrong Han; Wenjuan Cai; Xiulan Zhao; Baocun Sun
Journal:  J Exp Clin Cancer Res       Date:  2010-06-02

8.  Vascular endothelial growth factor receptor 2 (VEGFR-2) plays a key role in vasculogenic mimicry formation, neovascularization and tumor initiation by Glioma stem-like cells.

Authors:  Xiaohong Yao; Yifang Ping; Ying Liu; Kequiang Chen; Teizo Yoshimura; Mingyong Liu; Wanghua Gong; Chong Chen; Qin Niu; Deyu Guo; Xia Zhang; Ji Ming Wang; Xiuwu Bian
Journal:  PLoS One       Date:  2013-03-11       Impact factor: 3.240

9.  Hypoxia-induced Bmi1 promotes renal tubular epithelial cell-mesenchymal transition and renal fibrosis via PI3K/Akt signal.

Authors:  Rui Du; Lin Xia; Xiaoxuan Ning; Limin Liu; Wenjuan Sun; Chen Huang; Hanmin Wang; Shiren Sun
Journal:  Mol Biol Cell       Date:  2014-07-09       Impact factor: 4.138

Review 10.  Epithelial-to-endothelial transition and cancer stem cells: two cornerstones of vasculogenic mimicry in malignant tumors.

Authors:  Baocun Sun; Danfang Zhang; Nan Zhao; Xiulan Zhao
Journal:  Oncotarget       Date:  2017-05-02
View more
  28 in total

1.  CircTBL1XR1/miR-424 axis regulates Smad7 to promote the proliferation and metastasis of colorectal cancer.

Authors:  Na Li
Journal:  J Gastrointest Oncol       Date:  2020-10

2.  Cantharidin Inhibits Proliferation of Liver Cancer by Inducing DNA Damage via KDM4A-Dependent Histone H3K36 Demethylation.

Authors:  Chao Wei; Xiangui Deng; Shudi Gao; Xuemei Wan; Jing Chen
Journal:  Evid Based Complement Alternat Med       Date:  2022-07-11       Impact factor: 2.650

Review 3.  Vascular mimicry: changing the therapeutic paradigms in cancer.

Authors:  Nazila Fathi Maroufi; Sina Taefehshokr; Mohammad-Reza Rashidi; Nima Taefehshokr; Mahdieh Khoshakhlagh; Alireza Isazadeh; Narmin Mokarizadeh; Behzad Baradaran; Mohammad Nouri
Journal:  Mol Biol Rep       Date:  2020-05-18       Impact factor: 2.316

4.  Interaction Of c-Jun And HOTAIR- Increased Expression Of p21 Converge In Polyphyllin I-Inhibited Growth Of Human Lung Cancer Cells.

Authors:  YueYang Zhao; XiaoJuan Tang; Yuhua Huang; Qing Tang; ChangJu Ma; Fang Zheng; WanYin Wu; Swei Sunny Hann
Journal:  Onco Targets Ther       Date:  2019-11-25       Impact factor: 4.147

Review 5.  Molecular Mechanisms and Anticancer Therapeutic Strategies in Vasculogenic Mimicry.

Authors:  Xue Zhang; Jigang Zhang; Heming Zhou; Guorong Fan; Qin Li
Journal:  J Cancer       Date:  2019-10-18       Impact factor: 4.207

6.  Epigallocatechin-3-Gallate Suppresses Vasculogenic Mimicry through Inhibiting the Twist/VE-Cadherin/AKT Pathway in Human Prostate Cancer PC-3 Cells.

Authors:  Changhwan Yeo; Deok-Soo Han; Hyo-Jeong Lee; Eun-Ok Lee
Journal:  Int J Mol Sci       Date:  2020-01-09       Impact factor: 5.923

7.  Integrative analysis of proteomic and metabonomics data for identification of pathways related to Rhizoma Paridis-induced hepatotoxicity.

Authors:  Chongjun Zhao; Mingshuang Wang; Jianmei Huang; Zhe Jia; Xia Zhao; Erwen Li; Ziying Wei; Ying Dong; Wenxue Liu; Ting Han; Ying Liu; Farong Li; Ruichao Lin
Journal:  Sci Rep       Date:  2020-04-16       Impact factor: 4.379

8.  Down-regulating NEAT1 inhibited the viability and vasculogenic mimicry formation of sinonasal squamous cell carcinoma cells via miR-195-5p/VEGFA axis.

Authors:  Honglue Lu; Fei Kang
Journal:  Biosci Rep       Date:  2020-11-27       Impact factor: 3.840

9.  Solanine Inhibits Immune Escape Mediated by Hepatoma Treg Cells via the TGFβ/Smad Signaling Pathway.

Authors:  Juwei Gao; Yinyin Ying; Jue Wang; Yiyi Cui
Journal:  Biomed Res Int       Date:  2020-11-02       Impact factor: 3.411

10.  miR‑367‑3p downregulates Rab23 expression and inhibits Hedgehog signaling resulting in the inhibition of the proliferation, migration, and invasion of prostate cancer cells.

Authors:  Wei Du; Dong Li; Jianhao Xie; Ping Tang
Journal:  Oncol Rep       Date:  2021-07-19       Impact factor: 3.906

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.