Literature DB >> 30159540

Development and characterization of 43 microsatellite markers for the critically endangered primrose Primula reinii using MiSeq sequencing.

Masaya Yamamoto1, Yoshihiro Handa2, Hiroki Aihara2, Hiroaki Setoguchi1.   

Abstract

Primula reinii (Primulaceae), a perennial herb belonging to the Primula section Reinii, occurs on wet, shaded rocky cliffs in the mountains of Japan. This threatened species comprises four varieties; these plants are very localized and rare in the wild. In this study, 43 microsatellite markers were developed using MiSeq sequencing to facilitate conservation genetics of these critically endangered primroses. We developed novel microsatellite markers for three varieties of P. reinii, and tested its polymorphism and genetic diversity using natural populations. These novel markers displayed relatively high polymorphism; the number of alleles and expected heterozygosities ranged from 2 to 6 (mean = 3.2) and 0.13 to 0.82 (mean = 0.45), respectively. All loci were in Hardy-Weinberg equilibrium. These microsatellite markers will be powerful tools to assess P. reinii genetic diversity and develop effective conservation and management strategies.

Entities:  

Keywords:  Critically endangered plant; MiSeq; Microsatellites; Polymorphism; Primula reinii

Year:  2017        PMID: 30159540      PMCID: PMC6091931          DOI: 10.1016/j.pld.2017.09.003

Source DB:  PubMed          Journal:  Plant Divers        ISSN: 2468-2659


Introduction

Primula reinii Franch. et Sav., a perennial herb belonging to the Primula section Reinii, occurs on wet shaded rocky cliffs in the mountains of Japan (Richards, 2003). The species comprises four narrow endemic varieties (Fig. 1, Yamazaki, 1993): P. reinii var. reinii, P. reinii var. myogiensis Hara, P. reinii var. kitadakensis (Hara) Ohwi, and P. reinii var. rhodotricha (Nakai et Maek.) Yamaz. In addition, P. reinii var. okamotoi (Koidz.) Murata., which is found on the Kii Peninsula, is a synonym of var. reinii (Fig. 1). However, molecular phylogenic analyses using both chloroplast and nuclear DNA have shown distinct sequence divergence between vars. reinii and okamotoi (Yamamoto et al., 2017b).
Fig. 1

Presumed range of Primula sect. Reinii species. Black arrows indicate the populations sampled.

Presumed range of Primula sect. Reinii species. Black arrows indicate the populations sampled. P. reinii is the most attractive representative in sect. Reinii because these primrose plants have a small number of relatively large flowers just above their very dwarf emerging foliage (Richards, 2003). Furthermore, these plants, which are threatened species, are very localized and rare in the wild. Based on their rarity, and reductions in the numbers of individuals and populations, due to anthropogenic activities, all four varieties of P. reinii are listed on the latest Japanese Red List (Ministry of the Environment, 2017), and are assigned to the ‘Critically Endangered’ (vars. rhodotricha and myogiensis) or ‘Vulnerable’ (vars. reinii and kitadakensis) categories. Despite the need for conservation, little is known of the life history, reproductive system, or vegetative characteristics of these plants. Recent ecological and genetic studies have examined P. reinii var. rhodotricha, a typical species in sect. Reinii that faces a risk of extinction (Yamamoto et al., 2013, 2017a). Yamamoto et al. (2017a) reported molecular evidence of population depletion of the critically endangered primrose using 11 microsatellite markers that were originally developed for Primula sieboldii E. Morren. Furthermore, they also revealed a relationship between genetic diversity and the population sizes of Reinii species, and suggested that a purge of recessive detrimental genes to increase homozygosity could prevent additional genetic degradation in their wild habitat (Yamamoto et al., 2017a). However, only six microsatellite loci were used in that study to assess the genetic diversity of these species. Therefore, additional highly polymorphic molecular markers are required to investigate genetic status more reliably and to conduct effective conservation activities for P. reinii. Even in var. rhodotricha, additional microsatellite markers are needed to measure the degree of inbreeding and inbreeding depression (e.g., pedigree analysis) to improve their low fertility (approximately 5% in fruition, Yamamoto et al., 2017a). In this study, we isolated and characterized 43 genomic microsatellite markers for P. reinii, which will be powerful tools aiding assessment of their genetic diversity.

Materials and methods

To develop useful microsatellite markers for P. reinii, which comprises several narrow endemic taxa, genomic DNA from three varieties (vars. reinii, okamotoi, and rhodotricha) was extracted from leaf tissues collected from each population (Fig. 1) using a modified CTAB protocol (Doyle, 1990). Each genomic DNA sample was used for library preparation with the KAPA HyperPlus Kit (Kapa Biosystems, Wilmington, MA, USA). Sequencing analyses was performed on the MiSeq Benchtop Sequencer (Illumina, San Diego, CA, USA) using a 2 × 250-bp read length for each DNA sample. Raw reads of each sample were quality trimmed (Q > 20) using Sickle (https://github.com/najoshi/sickle). High-quality reads from the three samples, vars. reinii, okamotoi, and rhodotricha, were assembled, using Velvet (Zerbino and Birney, 2008), into 246,887, 313,719, and 285,839 contigs, respectively. Potential microsatellite regions with at least five repeats were detected in each assembled draft genome sequence using QDD ver. 2.1 (Meglécz et al., 2010). QDD was the most versatile software for estimating microsatellites based on next generation sequencing datasets in our pipeline. In total, 505, 732, and 562 microsatellite markers were predicted for each taxon, of which 73, 70, and 65 markers were selected as candidate microsatellite markers for vars. reinii, okamotoi, and rhodotricha, respectively. Primers were designed automatically using the Primer3 algorithm (Rozen and Skaletsky, 2000) implemented in QDD. Due possibly to low coverage (attributed to the large genome size of these plants), as well as lineage divergence among taxa (Yamamoto et al., 2017b), common microsatellite regions were not found in this study. To assess amplification and polymorphism at all 208 candidate microsatellite loci, additional leaf tissues from 32 individuals were collected from a natural population for each taxon. PCR amplifications were conducted in 10-μL reaction mixtures containing 1.0 μL of DNA solution (0.1 ng/μL), 0.20 μL of each primer (10 μmol/L), 2.0 μL of 5 × PCR buffer, 0.80 μL of dNTP mixture (each 2.5 mM), 0.20 μL of PrimeSTAR GXL polymerase (0.25 U; Takara Bio, Kusatsu, Shiga, Japan), and 5.6 μL distilled water. Each forward primer was labeled using FAM, VIC, NED, and/or PET. Amplifications consisted of an initial denaturation at 98 °C for 5 min, 39 amplification cycles using a touchdown protocol of 98 °C for 30 s, annealing for 30 s, 68 °C for 40 s, and a final extension at 68 °C for 2 min. The annealing temperatures were 63, 62, and 61 °C for 9 cycles and 59, 58, and 53 °C for 30 cycles. Fragment analysis was performed using the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA). For each locus, the number of alleles (NA), expected heterozygosity (HE), inbreeding coefficient (FIS), and deviations from Hardy–Weinberg equilibrium were calculated using Arlequin 3.5 (Excoffier and Lischer, 2010).

Results and discussion

Of 208 candidate microsatellite markers, 98 (47%), 71 (34%), and 39 (19%) were di-, tri-, and tetranucleotides, respectively. The most common di- and trinucleotide repeats were (AG)n (25%) and (TTA)n (13%), respectively. No common motif was found among the tetranucleotide repeats. The motifs (AG)n, (CT)n, (TC)n, and (AT)n accounted for 35% of the 208 candidate microsatellite markers. Of the 208 candidate primer pairs tested, a total of 43 loci were amplified, displayed a clear polymorphism, and were in Hardy–Weinberg equilibrium (p > 0.05). All sequences were deposited in GenBank/DDBJ/EMBL (Table 1). The 19 loci developed for P. reinii var. reinii displayed relatively high polymorphism; the average values for NA, HE, and FIS were 4.16, 0.56, and 0.05, respectively. Meanwhile, the 10 loci for var. rhodotricha showed relatively low polymorphism, with values of 2.60, 0.39, and 0.08 for NA, HE, and FIS, respectively. Similarly, the 14 loci for var. okamotoi showed low polymorphism, with average values for NA, HE, and FIS of 2.14, 0.35, and 0.03, respectively.
Table 1

Primer specifications for the 43 polymorphic microsatellite markers developed for P. reinii in this study.

LocusPrimer sequence (5′→3′)Repeat motifSize rangeNAHEFISAccession no.
For Primula reinii var. reinii
Pre_2F: TGGCAAATGGGAGCTTAGCA(TA)9228–23650.7560.198LC217340
R: GAGGTTGTTTACGTGCCGTG
Pre_5F: ACACTGCTTTCTGCTAGCTCT(CT)12146–15840.6040.068LC217341
R: CAGACAAATTATAATCAGCTCACCG
Pre_7F: TGACATTTGCATAATTGTTAATTTGGA(TC)11144–16050.6990.240LC217342
R: TGTGGGTATGTAGTCCTGCA
Pre_9F: GGCAACCAAACAAACTCCTATAGT(GA)11202–21230.693−0.173LC217343
R: TCCTGAGCGTTTACCAAACTCA
Pre_10F: CAGTTGAGAAGATCGATCAGACT(AG)11149–16550.696−0.033LC217344
R: ATCATTTGGCTTTCTACAGCTTT
Pre_18F: TTGGACTTTGCGCTCATAAGC(TC)10200–21060.8250.129LC217345
R: CTTGTTCTCTTCAACCCTTTGCT
Pre_28F: AGCCTTGCAGGAAGATCAAGAA(AG)9253–26340.398−0.020LC217346
R: ACTCTAGCACACGTAGAGCA
Pre_31F: ACGGCATGAATTTGAAGAATTGGA(GA)9277–29030.3050.179LC217347
R: CGGCGGATATTCAATAGGAGCT
Pre_33F: TGAGGGACGCCATTGCTTAT(AG)9170–18840.756−0.033LC217348
R: CCATTACTTGCTCTGTTCGCT
Pre_36F: CTAGCGAGCGAACACAATGC(CA)9142–15250.815−0.008LC217349
R: ATTGAGACTGATGGCGGGAC
Pre_38F: AGGCTTTCAACTGAACATAACGG(AG)9218–22660.540−0.041LC217350
R: ATGGTGTTCGTCAGTCCCAC
Pre_40F: AGTACCTGTAGTGGAGAGGG(AG)9202–21250.687−0.047LC217351
R: CCCATTAGGTTAACATTCACGGT
Pre_43F: GGCATTACCTTAAAGTAAGAGGGT(GA)9304–30830.3920.433LC217352
R: GGCATTACCTTAAAGTAAGAGGGT
Pre_47F: AAGCCATCGATGAAGCTGCT(ATT)8284–29030.371−0.262LC217353
R: CACTCTGCTGTGAGACTCTGA
Pre_51F: CCCTGTAATCTACCTCCACGG(TAT)7152–15830.595−0.154LC217354
R: ATCATATCGCATTCCTAAGCATCA
Pre_52F: TTGCAGGGCAAGTGAACTCA(CAG)7242–27250.567−0.047LC217355
R: GGCTGAGAAGGAGCAGTTGA
Pre_57F: TGGCTGTTTGTGGAATTAGCT(TCT)7143–15240.4090.211LC217356
R: GTTTGAGTGAGAGGTGGCTCT
Pre_61F: TGACTGGATGGGAGGACGAT(TTC)6266–27840.4890.148LC217357
R: TTGTGTACCGTACCGCAGAG
Pre_73F: ACGGATCTTTGTGAGGAAGGAG(TATG)5140–14820.125−0.034LC217358
R: TCCGTCTGTCTGAATTTAGGGT
For P. reinii var. okamotoi
Pok_6F: TGGTTCACAATTCACAACCCA(AG)11160–16220.4740.116LC217359
R: CTGGAGCTGGGCATCTCATC
Pok_8F: AAGGCAGTTGAGTCCCTTTCT(CT)11308–31220.4950.088LC217360
R: TGCGAACAAGATCTAAGGATGT
Pok_11F: TGAAGGATAAGTTAGTAATTTGTGCCA(CT)11192–21020.3540.123LC217361
R: ACTCCGTATTTATTACCTGAACAAGT
Pok_15F: ATTTCTATGTTCTTATGCATGAACTCT(TA)10206–21220.497−0.368LC217362
R: TGTTTGGGCCAATTGTACTACG
Pok_24F: ACACCATCATTCGGTTTAGTACCT(GA)10151–15720.382−0.122LC217363
R: AACGGAGAGGCGAATAATACG
Pok_25F: GGTGTTCCATGAGACCAGAACA(GA)10155–16130.3250.181LC217364
R: TGGTCTCTGGTTGCTAAGGC
Pok_27F: ATCCGTCTCGCATCGTCTTC(CT)10156–16020.5420.135LC217365
R: TAGAGGCGCCATTGAAGGTC
Pok_31F: ACCAATTGCAGCCCAATCAAC(AGT)9164–17620.155−0.073LC217366
R: CCACTAGCTCTGCAGTTCTGA
Pok_32F: CGAAACAATATTACCCGACCGG(CCA)8159–16220.222−0.125LC217367
R: CGCTCTTCTGCCTACTCAACA
Pok_39F: CATCAAGATGCCACCAAGGG(GAA)7283–28620.2350.432LC217368
R: CCTTTCCCTAGTTCTGGCCC
Pok_40F: GCAAGCAATGAGACGAGTAACT(TCA)7277–28630.1940.288LC217369
R: TACGTGAGGCGCTTTGTGAA
Pok_45F: GGAAACACCCAAGGCTTTCA(TTA)6167–17120.4870.079LC217370
R: GCTGACAAGGCTCAACTGGA
Pok_58F: GCCTTGTGAAACGCCGTTAA(ATAC)5162–17020.131−0.056LC217371
R: ACAATCCCAGCTGAAAGATCCT
Pok_60F: TGCCAGGTGTATTATCCGACG(TTTA)5189–20120.354−0.267LC217372
R: ACCAGACTAACACAAACCGGA
For P. reinii var. rhodotricha
Prh_1F: AAACGTAGGCAGGAGCAACA(AT)12254–25640.5140.089LC217373
R: TATGAGCGGTGGACTTAGGGT
Prh_5F: GCCGAAAGTGACAAATGAAAGC(AG)11137–16330.5750.076LC217374
R: TCATGGCCAGATTCTTGTTGC
Prh_6F: ACGCAACGGCAAACTTCTTT(CT)11165–16720.146−0.068LC217375
R: ACAGGGACCAAATTGAAACTATTG
Prh_17F: GAGGGTGTATCTGAAGATTACTCT(CT)10212–21820.418−0.078LC217376
R: TCGGATTGGGTTAAATTCTGGGT
Prh_22F: AGGCGGGTGTGATAAACCG(AG)10254–25620.253−0.151LC217377
R: GGGACCTGTTTGAGTAGAGGC
Prh_30F: GAGCCAGGTCATCAACACCC(CCA)7220–22920.2750.296LC217378
R: TGGATTATTCACGCTGTGAGTGA
Prh_35F: TGGTCTGAGGATCAACTGCG(GAT)6158–16730.468−0.002LC217379
R: CACGAATTCCCAGAGGCGAA
Prh_46F: GGCCGATCCACATATTCATCA(GAA)6253–25920.4900.107LC217380
R: CCAACTCGGTTTGATCCAGT
Prh_60F: CGTTGATCTACTGTTTCGGCAG(TGTA)5130–15430.3520.337LC217381
R: TCGATTGGCACACGTATGGA
Prh_64F: TGGGTGAAGAATTGGAGAAACT(TTTG)5261–27030.4540.243LC217382
R: CCCTCGGTCCAGCTTAAAGC

NA, number of alleles; HE, expected heterozygosity; FIS, inbreeding coefficient.

Primer specifications for the 43 polymorphic microsatellite markers developed for P. reinii in this study. NA, number of alleles; HE, expected heterozygosity; FIS, inbreeding coefficient. The genetic status of var. rhodotricha determined using our newly developed microsatellite markers was nearly identical to that determined using previously established markers (Yamamoto et al., 2017a), whereas our results for var. reinii and okamotoi indicated a relatively lower genetic diversity than that in a previous study using only six loci (estimated HE of 0.620 and 0.412 for vars. reinii and okamotoi, respectively) (Yamamoto et al., 2017a). Therefore, our results imply that the genetic diversities of vars. reinii and okamotoi were overestimated in the previous study, possibly due to an insufficient number of loci. In this study, we isolated 1799 microsatellite loci from P. reinii and its relatives. A total of 208 primer pairs were used for wild populations of these critically endangered plants, and 43 microsatellite markers were used to assess the genetic diversity of critically endangered primroses and develop effective conservation and management strategies.
  5 in total

1.  Primer3 on the WWW for general users and for biologist programmers.

Authors:  S Rozen; H Skaletsky
Journal:  Methods Mol Biol       Date:  2000

2.  Velvet: algorithms for de novo short read assembly using de Bruijn graphs.

Authors:  Daniel R Zerbino; Ewan Birney
Journal:  Genome Res       Date:  2008-03-18       Impact factor: 9.043

3.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

4.  Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows.

Authors:  Laurent Excoffier; Heidi E L Lischer
Journal:  Mol Ecol Resour       Date:  2010-03-01       Impact factor: 7.090

5.  Contrasting evolutionary processes during Quaternary climatic changes and historical orogenies: a case study of the Japanese endemic primroses Primula sect. Reinii.

Authors:  Masaya Yamamoto; Masato Ohtani; Kaoruko Kurata; Hiroaki Setoguchi
Journal:  Ann Bot       Date:  2017-11-28       Impact factor: 4.357

  5 in total
  2 in total

1.  Speciation and subsequent secondary contact in two edaphic endemic primroses driven by Pleistocene climatic oscillation.

Authors:  Masaya Yamamoto; Daiki Takahashi; Kiyoshi Horita; Hiroaki Setoguchi
Journal:  Heredity (Edinb)       Date:  2019-06-28       Impact factor: 3.821

2.  Transferability, development of simple sequence repeat (SSR) markers and application to the analysis of genetic diversity and population structure of the African fan palm (Borassus aethiopum Mart.) in Benin.

Authors:  Mariano Joly Kpatènon; Kolawolé Valère Salako; Sylvain Santoni; Leila Zekraoui; Muriel Latreille; Christine Tollon-Cordet; Cédric Mariac; Estelle Jaligot; Thierry Beulé; Kifouli Adéoti
Journal:  BMC Genet       Date:  2020-12-03       Impact factor: 2.797

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.