Literature DB >> 30159452

Characterization of 24 microsatellite markers in Primula chungensis (Primulaceae), a distylous-homostylous species, using MiSeq sequencing.

Wei Zhou1, Haidong Li2,3, Zhikun Wu4, Spencer C H Barrett5, Dezhu Li1, Hong Wang2.   

Abstract

Primula chungensis is a species with considerable floral and mating-system variation, including distylous (outcrossing), homostylous (selfing) and mixed populations that contain both outcrossing and selfing forms. We isolated 24 microsatellite markers from P. chungensis using Illumina MiSeq sequencing. Polymorphism and genetic diversity were then measured based on a sample of 24 individuals from a natural population in southern Tibet. All loci were polymorphic with the number of alleles per locus ranging from 2 to 4. The observed and expected heterozygosity ranged from 0 to 1 and 0.219 to 0.708, respectively. The microsatellite markers we have identified will serve as valuable tools for the investigation of the population genetic structure and phylogeography of P. chungensis and will inform models of the evolutionary history of mating systems in the species.

Entities:  

Keywords:  Distyly; Homostyly; Microsatellites; Polymorphism; Primula chungensis

Year:  2016        PMID: 30159452      PMCID: PMC6112135          DOI: 10.1016/j.pld.2015.12.002

Source DB:  PubMed          Journal:  Plant Divers        ISSN: 2468-2659


Introduction

Primula chungensis I. B. Balfour & Kingdon-Ward is a herbaceous, insect-pollinated, perennial species belonging to sect. Prolifera (Primulaceae) and restricted to the mountainous regions of Yunnan, Sichuan and Tibet of China (Hu and Kelso, 1996, Richards, 2002). It commonly occurs in wet meadows, forest edges, open slopes, and roadsides at altitudes between 2900 and 3200 m. The species flowers from May to June and produces one to three inflorescences composed of pale orange flowers (about 20 flowers per inflorescence) that last for up to 6 days. Our field investigations indicate that P. chungensis exhibits considerable variation in floral biology across its geographical range. Most populations are composed of a single self-pollinating floral phenotype with anthers and stigmas at equivalent height (homostyly). In contrast, other populations contain outcrossing long-styled and short-styled floral morphs typical of the floral polymorphism distyly. Populations containing both homostylous and heterostylous morphs also occur, and finally some populations are monomorphic for heterostylous morphs, especially the long-styled morph. Primula is a well-known model system for studies of the evolution, function and breakdown of heterostyly (Crosby, 1949, Ornduff, 1979, Piper et al., 1984, Richards, 2002, Mast and Conti, 2006, Mast et al., 2006, de Vos et al., 2014, Keller et al., 2014), and more recently for investigations of the molecular genetics of the heterostyly linkage group (McCubbin et al., 2006, Li et al., 2011, Nowak et al., 2015). The occurrence of polymorphism for floral morphology and mating system in P. chungensis provides outstanding opportunities for investigating a range of questions associated with the evolutionary maintenance and breakdown of heterostyly. Development of genetic markers to investigate the patterns of genetic diversity in populations of contrasting mating systems (outcrossing vs. selfing), and to determine the evolutionary relationships between populations containing different floral phenotypes is a necessary first step for evolutionary studies of P. chungensis. Here, we report the isolation and characterization of 24 polymorphic microsatellite markers from P. chungensis, which will be valuable for furthering our understanding of the evolutionary genetics of this species.

Materials and methods

We isolated total genomic DNA from leaf tissue of one P. chungensis individual from the Muli population (28°54.604′ N, 100°47.268′ E; 3489 m a.s.l.) in Sichuan using DNeasy Plant Mini Kit (QIAGEN, Irvine, USA) following the manufacturer's protocol. Extracted DNA was used for a library preparation with a Nextera XT Library Prep Kit for Illumina. We performed sequencing on the MiSeq Benchtop sequencer (Illumina, Inc., San Diego, California, USA) using the 2 × 250 bp read length. Raw Illumina reads (679,708 reads) were analyzed and assembled using Geneious version 6.0 (Biomatters, Auckland, New Zealand) into 56,092 contigs. The contigs were BLASTed against NCBI GenBank using BLASTx to identify and exclude contigs with chloroplast genome hits. Microsatellites with at least 5 repeats were then detected using QDD version 2.1 Beta (Meglécz et al., 2010). A total of 2341 contigs contained at least one microsatellite, of which 127 loci were selected for primer design using the software PRIMER version 5.0 (Clarke and Gorley, 2001). These primers were initially tested and optimized using a Veriti 96-well Thermal Cycler Gradient PCR Machine (Applied Biosystems, Foster City, California, USA). A total of 24 primer pairs amplified consistently, and were used for further screening (Table 1). We assessed polymorphism at these loci on 24 individuals obtained from a distylous population located in southern Tibet (29°46.616′N, 94°44.545′E; 3305 m a.s.l.).
Table 1

Primer sequences and characterization of 24 microsatellite loci isolated from Primula chungensis.

Locus namePrimer sequence (5′–3′)Repeat motifSize (bp)Ta (°C)GenBank accession no.
PC109F:ACGGGTCATTGCGTTTAAGTCG(CGA)519054KT033877
R:TTGTCGTTTGTCGGAGTGTTCG
PC4007F:ATGGTGCTAAACGCCTTGTG(CT)1030854KT033878
R:TTTGAAGTAGGGGTGAGGTG
PC4198F:CTACACCTCTCCTCCTCTTC(TC)915356KT033879
R:CCCTAGCCGTCCAACTTA
PC9123F:CAAAAGAGCGTTAGGAGTGA(TG)733848KT033880
R:GATGGTTGTCGTTGTCGGT
PC11592F:TACCCTAACCTATTTTTCCC(AG)1516556KT033881
R:CGCTACCTTACCTCTCTTCT
PC14297F:ACTTACTGGTCTTTCGGTGA(AG)1624652KT033882
R:CTCTCGCTTTATGTGCCTG
PC15519F:ACTCGTGTTCCGTTTGTTCTAA(GTTTT)824050KT033883
R:AGTAACTGTTTGTTTGGCTATTGA
PC15877F:CGGTTTATTTGGTTGAAGTC(CT)622850KT033884
R:CTCCTTGTTCTTTGTTTGAC
PC20540F:CTCATCGTCTTTCCTATTTC(TTTTTG)521348KT033885
R:AAGGCAATCTGTTCTGAC
PC21731F:ATGTGTCCTTGTTTTATGTG(GA)617348KT033886
R:ATGGTGTTTATCAATGTAGG
PC29976F:CAATGATTTCTCTCTCGTCC(TC)618450KT033887
R:AGATGGTTGAAGATGGTGAT
PC30591F:GGAAATCGCAGCCTCATAAC(TG)722052KT033888
R:GAGAGCGGAGTGTTCACCTA
PC30882F:GCACAAACCCTAACTAAAGT(AG)824548KT033889
R:GCACAATCAAGCCAATG
PC32026F:CTTTTCACCAGACGCTACCC(CT)622156KT033890
R:GCGGAACATCATTGAACCA
PC33802F:ACTAAACATAACAAGCATCG(AG)913452KT033891
R:CAACTGTAATCTGAGCCAAT
PC33837F:GTAGACACCTTGAATCATAACAAGTAAC(GAT)526652KT033892
R:TTGAAACCAAATTGCCACCT
PC34870F:AATCAGCATAGGGTTCTCAA(AG)811352KT033893
R:CCTCTCTTCTCCTCCCTTTC
PC37139F:GATGGCTCTCGTTTTTTTAC(TC)612650KT033894
R:TCAGAGTAGAACCACATCAG
PC39361F:GCATTCCACGTCTTTTGTTG(TG)713452KT033895
R:GGTAATCCCCTCGCATGACT
PC39450F:CGTGGCAATTTCTCGTAG(AAGA)917752KT033896
R:ATGGCATTTGTCCTGTCTT
PC46911F:GCAAAAGAAACTCCCGCAAT(AG)825552KT033897
R:CTAAGCACAATGTTGAGGCA
PC47381F:GAGGGAGACCGAAAGAGGA(CTC)718954KT033898
R:GCGGTAGGCACAGGAGAGTA
PC50689F:GGGTTTTTGTTCATCTTAGC(AAC)1018348KT033899
R:TCTTCGGTATGTGTCTCGTG
PC52377F:TCTCTCTCTTTTCTTTGTTC(TC)911148KT033900
R:TAGAGGAAATGGAGGAAG

Note: Ta = annealing temperature.

Primer sequences and characterization of 24 microsatellite loci isolated from Primula chungensis. Note: Ta = annealing temperature. We performed PCR amplification using the following protocol: 20 μL reaction volume containing 25–50 ng of genomic DNA, 0.6 μM of each primer, 10 μL 2 × Taq PCR MasterMix [Tiangen (Tiangen Biotech, Beijing, China); 3 mM MgCl2, 100 mM KCl, 0.5 mM of each dNTP, 20 mM Tris-HCl (PH 8.3), 0.1 U Taq polymerase] and 10 × PCR buffer. We conducted PCR amplifications under the following conditions: 95 °C for 4 min followed by 30–35 cycles at 94 °C for 45 s, at the annealing temperature for each specific primer (optimized for each locus; Table 1) for 45 s, 72 °C for 1.5 min for extension, and a final extension step at 72 °C for 10 min. PCR products were separated and visualized using a QIAxcel capillary gel electrophoresis system (QIAGEN, Irvine, USA) with an internal 10–300 bp size standard.

Results and discussion

Of 127 primer pairs tested, 24 primer pairs amplified microsatellite loci displaying polymorphism, whereas the remaining 103 pairs were monomorphic. All sequences were deposited in GenBank (Table 1). We calculated basic population genetic parameters of diversity, including the number of alleles (Na), observed and expected heterozygosities (HO, HE), Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) between pairs of loci using the package GENEPOP version 4.0 (Raymond and Rousset, 1995). The number of alleles per locus (Na) ranged from 2 to 4, with a mean of 2.458. In the population investigated, the observed (HO) and expected (HE) heterozygosities ranged from 0 to 1.000 and from 0.219 to 0.708, with averages of 0.516 and 0.469, respectively (Table 2). Nine loci (PC9123, PC11592, PC20540, PC30882, PC33837, PC37139, PC39361, PC47381, PC50689; see Table 2) deviated significantly from Hardy–Weinberg equilibrium indicating the possibility of null alleles, the Wahlund effect and disassortative mating in this distylous population. After Bonferroni correction, no significant pairwise linkage disequilibrium was observed for any pair of loci.
Table 2

Genetic diversity parameters of the 24 microsatellite loci developed for Primula chungensis based on 24 individuals sampled from a distylous population located in southern Tibet.

LocusNaHOHE
PC10920.6670.444
PC400720.2500.219
PC419820.3330.278
PC9123a20.9170.497
PC11592a20.7500.469
PC1429720.2500.219
PC1551941.0000.653
PC1587731.0000.611
PC20540a20.0000.500
PC2173130.7920.598
PC2997631.0000.625
PC3059130.7780.512
PC30882a20.1110.494
PC3202620.2500.219
PC3380220.5000.375
PC33837a20.0000.444
PC3487030.8750.539
PC37139a20.0000.500
PC39361a30.8330.559
PC3945040.8330.708
PC4691130.7500.531
PC47381a20.0000.375
PC50689a20.0000.500
PC5237720.5000.375

Note: Na = the number of allele; HO = observed heterozygosity; HE = expected heterozygosity.

Geographic coordinate of the population: 29°46.616′N, 94°44.545′E.

Indicates significant departure from Hardy–Weinberg equilibrium (P < 0.01).

Genetic diversity parameters of the 24 microsatellite loci developed for Primula chungensis based on 24 individuals sampled from a distylous population located in southern Tibet. Note: Na = the number of allele; HO = observed heterozygosity; HE = expected heterozygosity. Geographic coordinate of the population: 29°46.616′N, 94°44.545′E. Indicates significant departure from Hardy–Weinberg equilibrium (P < 0.01). In this study, we isolated 2341 microsatellite loci from P. chungensis. Primer pairs were designed to test 127 of these loci for polymorphism in 24 individual plants from a distylous population. Among the loci we tested, 24 microsatellite markers were polymorphic. These 24 polymorphic microsatellite markers will be powerful molecular tools for analyzing population structure and mating systems of P. chungensis, particularly the evolutionary relationship between distylous and homostylous populations. The high discriminatory power of these microsatellite loci will also be useful for parentage analysis in floral polymorphic populations of this species, which may provide an opportunity to evaluate the potential influence of ecological and reproductive factors on mating patterns (Zhou et al., 2015).
  8 in total

1.  The primrose path to heterostyly.

Authors:  Austin R Mast; Elena Conti
Journal:  New Phytol       Date:  2006       Impact factor: 10.151

2.  Are any primroses (Primula) primitively monomorphic?

Authors:  Austin R Mast; Sylvia Kelso; Elena Conti
Journal:  New Phytol       Date:  2006       Impact factor: 10.151

3.  Selection of an unfavourable gene-complex.

Authors:  J L CROSBY
Journal:  Evolution       Date:  1949-09       Impact factor: 3.694

4.  QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

Authors:  Emese Meglécz; Caroline Costedoat; Vincent Dubut; André Gilles; Thibaut Malausa; Nicolas Pech; Jean-François Martin
Journal:  Bioinformatics       Date:  2009-12-10       Impact factor: 6.937

5.  Heterostyly accelerates diversification via reduced extinction in primroses.

Authors:  Jurriaan M de Vos; Colin E Hughes; Gerald M Schneeweiss; Brian R Moore; Elena Conti
Journal:  Proc Biol Sci       Date:  2014-04-23       Impact factor: 5.349

6.  Reciprocal herkogamy promotes disassortative mating in a distylous species with intramorph compatibility.

Authors:  Wei Zhou; Spencer C H Barrett; Hong Wang; De-Zhu Li
Journal:  New Phytol       Date:  2015-02-09       Impact factor: 10.151

7.  Floral heteromorphy in Primula vulgaris: progress towards isolation and characterization of the S locus.

Authors:  Jinhong Li; Margaret A Webster; Matthew C Smith; Philip M Gilmartin
Journal:  Ann Bot       Date:  2011-07-28       Impact factor: 4.357

8.  The draft genome of Primula veris yields insights into the molecular basis of heterostyly.

Authors:  Michael D Nowak; Giancarlo Russo; Ralph Schlapbach; Cuong Nguyen Huu; Michael Lenhard; Elena Conti
Journal:  Genome Biol       Date:  2015-01-24       Impact factor: 13.583

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.