Literature DB >> 30150771

Malaria parasite translocon structure and mechanism of effector export.

Chi-Min Ho1,2,3, Josh R Beck4,5,6, Mason Lai2, Yanxiang Cui7, Daniel E Goldberg4,5, Pascal F Egea8,9, Z Hong Zhou10,11,12.   

Abstract

The putative Plasmodium translocon of exported proteins (PTEX) is essential for transport of malarial effector proteins across a parasite-encasing vacuolar membrane into host erythrocytes, but the mechanism of this process remains unknown. Here we show that PTEX is a bona fide translocon by determining structures of the PTEX core complex at near-atomic resolution using cryo-electron microscopy. We isolated the endogenous PTEX core complex containing EXP2, PTEX150 and HSP101 from Plasmodium falciparum in the 'engaged' and 'resetting' states of endogenous cargo translocation using epitope tags inserted using the CRISPR-Cas9 system. In the structures, EXP2 and PTEX150 interdigitate to form a static, funnel-shaped pseudo-seven-fold-symmetric protein-conducting channel spanning the vacuolar membrane. The spiral-shaped AAA+ HSP101 hexamer is tethered above this funnel, and undergoes pronounced compaction that allows three of six tyrosine-bearing pore loops lining the HSP101 channel to dissociate from the cargo, resetting the translocon for the next threading cycle. Our work reveals the mechanism of P. falciparum effector export, and will inform structure-based design of drugs targeting this unique translocon.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30150771      PMCID: PMC6555636          DOI: 10.1038/s41586-018-0469-4

Source DB:  PubMed          Journal:  Nature        ISSN: 0028-0836            Impact factor:   49.962


Malaria has devastated major civilizations since the dawn of humanity and remains a significant burden to our society, responsible for nearly half a million deaths annually[1]. This infectious disease is caused by Plasmodium parasites, which invade and reproduce within human erythrocytes, inducing the clinical symptoms of malaria[2,3]. These parasites export hundreds of effector proteins to extensively remodel host erythrocytes, which have limited capacity for biosynthesis[4-6]. Collectively known as the exportome, these proteins create the infrastructure necessary to import nutrients, export waste, and evade splenic clearance of infected erythrocytes[7]. Most of these proteins bear a 5-residue motif, the Plasmodium Export Element (PEXEL)[8-10]. The malaria parasite conceals itself inside a parasitophorous vacuole (PV) derived from invagination of the host cell plasma membrane during invasion[11] (Fig. 1a). Following secretion into the PV, proteins destined for export are unfolded and transported across the PV membrane (PVM) into the host cell in an ATP-dependent process[12,13]. To accomplish this, it was proposed that the parasite has evolved a unique membrane protein complex, the Plasmodium Translocon of Exported Proteins (PTEX)[14]. PTEX is the only known point of entry to the host cell for exported proteins and an attractive drug target, as disrupting PTEX blocks delivery of key virulence determinants, inducing parasite death[15,16].
Figure 1

Global architecture of the PTEX core complex in two cargo-bound states.

a, Schematic of parasite-infected human erythrocyte. PPM: parasite plasma membrane. b-e, CryoEM maps (b-c) and atomic models (d-e) of the PTEX core complex. Horizontal lines represent the PVM bilayer, estimated based on the detergent belt density, visible at lower thresholds (see Extended Data Fig. 7). f-k, Top and side views of the HSP101 (f-g), PTEX150 (h-i), and EXP2 (j-k) cryoEM maps, coloured by protomer. l-n, Pore radius (l) and protein-conducting channel (m-n) calculated using HOLE[60].

PTEX was suggested to be a >1.2MDa membrane protein complex with a core composed of the HSP101 ATPase and two novel proteins, PTEX150 and EXP2 (Fig. 1a)[14,17]. HSP101 belongs to the Class 1 Clp/HSP100 family of AAA+ ATPases, PTEX150 has no known homologs beyond the Plasmodium genus, and EXP2 is a PVM protein[14,18] conserved among vacuole-dwelling apicomplexans[19]. All three core components are essential for protein export and parasite survival[15,16,20]. A model of PTEX-mediated translocation was proposed in which HSP101 unfolds and threads proteins through an oligomeric EXP2 transmembrane channel spanning the PVM, with PTEX150 playing a structural role between EXP2 and HSP101[14-17]. However, without structural information, the global architecture of PTEX, the stoichiometry of its components, and direct evidence for the proposed molecular mechanism have proven elusive. In this study, we purify PTEX directly from the human malaria parasite P. falciparum and determine near-atomic resolution cryoEM structures of the complex in multiple functional states. Our atomic models reveal the architecture and mechanism of this unique translocon and pave the way for development of novel therapeutics against this promising new malarial drug target.

Architecture of the PTEX core complex

To purify PTEX from P. falciparum, we used CRISPR/Cas9 editing to introduce a 3xFLAG epitope tag on the endogenous HSP101 C-terminus (Extended Data Fig. 1a–c) and purified the endogenously assembled PTEX core complex directly from parasites cultured in human erythrocytes (Extended Data Fig. 1d–f). CryoEM analysis yielded two distinct conformations of PTEX particles, one extended (195Å) and the other compact (175Å) (Fig. 1b-c). Endogenous cargo polypeptide densities are visible in the central pore of HSP101 in both structures (Fig. 1b-c, Extended Data Fig. 2–3). Based on differences in the arrangement of HSP101 subunits relative to the cargo between the two conformations, we designated them as the engaged and resetting states, respectively. Both maps are at near-atomic resolution, varying from 3–3.6Å in the transmembrane (TM) and core regions to 5–8Å in the periphery (Fig. 1b-c, Extended Data Fig. 4). Clear sidechain densities throughout most regions of both maps (Fig. 1b-c, Extended Data Fig. 5, Supplementary Videos 1–2) enabled us to build de novo atomic models of the three constituent proteins for both conformational states (Fig. 1d-e), each containing 20 subunits with 6,898 amino acid residues modeled. All subunits were built independently, as conformations varied between subunits.
Extended Data Figure 1

Generation of HSP101–3xFLAG parasites and analysis of purified PTEX .

a, Schematic showing strategy for endogenous tagging of P. falciparum hsp101 with 3xFLAG using CRISPR/Cas9 editing. Diagnostic PCR primers and expected amplicon following successful integration are shown. sgRNA, single guide RNA; UTR, untranslated region; CAM, calmodulin promoter; PfU6, P. falciparum U6 promoter; hDHFR, human dihydrofolate reductase. b, Diagnostic PCR with genomic DNA template from NF54attB parent or two independent populations of HSP101–3xFLAG parasites. kb, kilobase pairs. The experiment was performed one time. c, Western blot of NF54attB and HSP101–3xFLAG parasites probed with mouse-anti-FLAG M2 antibody (Sigma) and goat-anti-mouse IRDye 680 secondary (Li-cor). Arrowhead indicates full-length HSP101–3xFLAG (predicted molecular weight 102.9 kDa after signal peptide cleavage). kDa, kilodaltons. Data represent two independent experiments. d, Giemsa staining of parasite-infected human erythrocytes from which PTEX was purified. Scale bar: 5um. For source data, see Supplementary Figure 3. e, Silver stained SDS-PAGE gel of the FLAG-purified PTEX sample. Identities of the bands labeled EXP2, PTEX150, and HSP101 were confirmed by tryptic digest LC-MS. f, Tryptic digest liquid chromatography-mass spectrometry (LC-MS) analysis of the FLAG-purified PTEX sample. The PTEX core components are among the five most abundant species detected in the purified sample. For gel and blot source data, see Supplementary Figure 1.

Extended Data Figure 2

Detailed views of the PTEX protein-conducting channel and symmetry mismatch in the engaged state.

CryoEM densities and atomic models of cargo and pore loops from the near-atomic resolution structures of Clp/HSP100 ATPases YME1[61] (a), PTEX HSP101 (b), and HSP104[31] (c). Tyrosine sidechain densities are clearly visible intercalating with the cargo densities. The modeled engaged state PTEX cargo has a calculated RMSD of 1.09Å and 1.25Å to the published YME1 and HSP104 cargo models, respectively. Pore loops are labeled by NBD and protomer (e. g., D2PL,P1: NBD2 Pore Loop, Protomer 1). d, Side view of the bisected engaged state PTEX cryoEM map. The protein-conducting channel, calculated using HOLE[60], is shown superimposed over the bisected map in translucent white with a navy outline. The HSP101 NBD2 pore loop densities are colored by HSP101 protomer, and the cargo density is colored pink. e-j, The transition from the assymetric HSP101 spiral to the C7 pseudosymmetric PTEX150(668–823)-EXP2 heptamer is depicted using a series of cross sections taken perpendicular to the central axis of the translocon, spanning the area of symmetry mismatch. The section of the translocon corresponding to each cross-sectional image is indicated with a brackets in (d).

Extended Data Figure 3

Detailed comparisons of the engaged and resetting states.

a, Side and top views of the EXP2 heptamer in the engaged state. Symmetric portions that remain constant between protomers are colored in mint. Portions that vary between protomers are colored and labeled by protomer. b-c, Superposition of the seven EXP2 protomers, labeled A-G, in the engaged (b) and resetting (c) states, colored as in (a). Ribbon diagrams of the resetting state (a) and engaged state (b) nucleotide binding pockets are shown for each protomer. d-e, Top view of HSP101 NBD1 (d) and NBD2 (e) in the engaged and resetting states, shown in simplified surface representation. The hinge point at the interface between HSP101 protomers 3 and 4 is indicated. f-g, Ribbon diagrams of the resetting state (f) and engaged state (g) nucleotide binding pockets are shown for each protomer. ATPγS in each pocket is shown with corresponding cryoEM density (mesh). The R859 arginine finger (sidechain shown in red-orange) is positioned ~3–5.5Å from the phosphorous atom in the γ-phosphate of the ATPγS in the binding pocket of the neighboring protomer in all protomers except R859 in protomer 3 in the resetting state (sidechain shown in gold), where the ATPγS bound in the protomer 4 NBD2 nucleotide pocket has shifted ~7.5Å away from the protomer 3 R859 arginine finger. h-i, Enlarged side view of the atomic models of the HSP101 NBD2 pore loops and unfolded cargo polypeptide backbone in the engaged (h) and resetting (i) states, shown with corresponding cryoEM densities. Tyrosine sidechain densities are clearly visible intercalating with the cargo densities. The modeled PTEX cargo has a calculated RMSD of 1.09Å and 1.25Å to the published YME1 and HSP104 cargo models, respectively. Pore loops are labeled by NBD and protomer (e. g., D2PL,P1: NBD2 Pore Loop, Protomer 1).

Extended Data Figure 4

Resolution assessments of the two PTEX states.

a-c,e-f Local resolution evaluations of the full PTEX map (a) and the focus-refined maps of the upper/hexameric (b) and lower/heptameric (c) halves of PTEX in the engaged state, and the full PTEX map (e) and the focus-refined map of the lower/heptameric (f) half of PTEX in the resetting state, calculated by Resmap[57] and colored according to resolution. Maps are displayed at higher thresholds where the detergent belt is not visible for clarity, to avoid obscuring details of the transmembrane helices. d, Global resolution assessment of the engaged and resetting state maps as measured using the “Gold-standard” Fourier shell correlation (FSC) curves generated by RELION[43,44] by comparison of two independently refined “half-maps”. g, Map-to-model FSC curves demonstrating the degree of correlation between the refined PTEX models and the experimental cryoEM maps for the engaged and resetting states.

Extended Data Figure 5

Representative regions of cryoEM density and atomic models.

Additional cryoEM densities (mesh) superposed with our atomic models for HSP101 (a), PTEX150(668–823) (b), and EXP2 (c). Displayed regions correspond to areas circled in magenta on guide figures (inset, upper right), and are colored as in guide figure: HSP101 (cornflower blue), PTEX150(668–823) (salmon), EXP2 (mint). Terminal residues for each segment are labeled with the amino acid, residue number, protomer, and state.

Both structures reveal PTEX to be a tripartite membrane protein complex with a 6:7:7 stoichiometry and a calculated mass of 1.6MDa, composed of a hexameric HSP101 protein-unfolding motor tethered to a PVM-spanning, pseudosymmetric funnel formed by seven protomers of EXP2 interdigitating with seven protomers of PTEX150 (Fig. 1d–k, Supplementary Video 3). Two transiently associated[21] accessory proteins, PTEX88 and TRX2[14], are not observed in our structures. At the PVM, each EXP2 monomer contributes a single TM helix to form a sevenfold (C7)-symmetric protein-conducting channel spanning the membrane (Fig. 1j-k). Six HSP101 protomers are tethered atop the PTEX150/EXP2 funnel in a hexameric right-handed spiral, with a gap between the bottom-most and top-most protomers (Fig. 1f-g, Supplementary Video 4). The HSP101 hexamer is oriented such that a single unbroken channel extends from the top of the HSP101 hexamer to the bottom of the heptameric EXP2 transmembrane pore (Fig. 1l–n, Extended Data Fig. 2d). The most constricted point along the channel occurs in HSP101, measuring 4Å and 10Å in diameter, in the engaged and resetting states, respectively (Fig. 1l). The seventh EXP2 and PTEX150 protomers are situated beneath the gap between HSP101 protomers 1 and 6, accommodating the remarkable symmetry mismatch between the asymmetric HSP101 hexamer and the pseudo-sevenfold-symmetric PTEX150/EXP2 tetradecamer (Fig. 1f-k, Extended Data Fig. 2e–j). Analyses of our PTEX150 and EXP2 structures with four commonly used structural similarity search programs[22-25] revealed no consistent structural similarities to any known proteins, including the pore-forming toxin Hemolysin E (HlyE), with which EXP2 was previously speculated to share structural homology[14]. Below, we describe the structural details of the individual proteins in the engaged state, followed by a comparison of the two states that suggests a mechanism of translocation.

EXP2 forms a heptameric protein-conducting channel across the PVM

Residues G27-S234 of EXP2 are well resolved in our structure, accounting for 80% of the mature protein (Extended Data Fig. 6a). EXP2 is a single-pass transmembrane protein consisting of a kinked 60Å-long N-terminal TM helix followed by a globular body domain and ending in an assembly domain composed of a linker helix followed by the assembly strand (Fig. 2a-b). The body domain contains five helices (B1–5), stabilized by an intraprotomer C113-C140 disulfide bond (Fig. 2c).
Extended Data Figure 6

Experimentally determined secondary structure elements and detected mass-spec fragments mapped to the primary sequences of the three PTEX proteins.

For EXP2 (a), PTEX150 (b), and HSP101 (c), secondary structure elements are shown as tubes (helices), lines (loops), and arrows (strands) above the corresponding sequence and are colored as in Fig. 2a, 3a, and 4a. In the sequences shown below, residues resolved in our structures are colored according to protein colors in Fig. 1c–f: EXP2 (mint), PTEX150 (salmon) and HSP101 (cornflower). Signal peptide residues are colored gold. All residues in the mature proteins that are not resolved in our structures are shown in grey. The 3xFLAG residues at the C-terminus of HSP101 are colored green. Peptides detected in tryptic digest LC-MS/MS analysis of the purified PTEX sample are shown as black lines below the corresponding sequences. Arrowheads above the EXP2 sequence indicate truncations sites described in this work and in Garten et al.[20] immediately before (∆222–287, red arrowhead) and after (∆234–287, green arrowhead) the assembly strand. Arrowheads above PTEX150 sequence indicate previously described truncation sites[37] (∆847–993, red arrowhead; ∆869–993, green arrowhead).

Figure 2

EXP2 forms a heptameric pseudo-symmetric PVM-spanning pore.

a,b Linear schematic (a) and ribbon diagram (b) of the EXP2 monomer in the engaged state. Dashed gray boxes represent unmodeled regions. Inset: one EXP2 monomer (coloured) within the PTEX complex. c, Density (mesh) and model of C113-C140 disulfide bond. d, EXP2 heptamer, coloured as in (b). e, Cutaway of the EXP2 transmembrane channel with hydrophilic residues (pink) lining the inner protein-conducting pore and hydrophobic residues (yellow) on the outer, membrane-facing surface.

Seven EXP2 protomers (labeled A-G) oligomerize to form a funnel-shaped C7-pseudosymmetric 216kDa heptamer spanning the PVM (Fig. 2d–e). The TMD and body helices B1–3 are symmetric throughout all seven protomers (Extended Data Fig. 3a-b). This symmetry is broken by inter-protomer conformational variations in body helices B4–5 and the assembly domain, which stretch upwards in some protomers to maintain contacts with the asymmetric HSP101 hexamer situated above the EXP2 funnel. This variation is most pronounced in EXP2 protomers F and G (Extended Data Fig. 3a-b). In the EXP2 heptamer, the amphipathic TM helices twist slightly around each other, creating a 37Å-long C7-symmetric protein-conducting channel that spans the PVM and forms the stem of the funnel (Fig. 2d-e). The membrane-facing surface of the EXP2 channel is coated with hydrophobic residues, while the inner surface is lined with charged and polar residues, creating an aqueous pore (Fig. 2e). The body domains, positioned in a wider ring atop the transmembrane channel on the vacuolar face of the PVM, form the mouth of the funnel. This orientation is consistent with previous analyses of EXP2 topology[14,20]. Furthermore, a detergent belt is clearly visible in 2D class averages and density maps (Extended Data Fig. 7–8), defining the residues in the TMD that would be buried in the PVM. A ring of positively charged residues where the stem meets the mouth of the funnel is positioned to interact with the negatively charged phosphates of the membrane surface (Extended Data Fig. 8a).
Extended Data Figure 7

EM of the PTEX core complex.

a-c Representative negative stain micrograph (a), enlarged portion of micrograph (b), and two-dimensional class averages (c) of the PTEX core complex in multiple orientations. d,e Representative cryoEM micrograph (d) and two-dimensional class averages (e) of the PTEX core complex in multiple orientations. Arrow in upper left panel of (e) indicates the detergent belt, which is visible as a less-dense (dimmer) halo surrounding the denser (brighter) densities of the alpha helices visible in the TMD in side views. Scale bars are 700Å, 700Å, 100Å, 200Å and 100Å, respectively.

Extended Data Figure 8

Detergent belt, amino-terminal domain, and claw densities visible in maps at lower thresholds.

a, The engaged state PTEX150/EXP2 heptamer, displayed in surface representation and colored by electrostatic potential. The bottom half of the full engaged state density map is superimposed, showing the location of the detergent belt in relation with the EXP2 TMD. A ring of positively charged residues is clearly visible directly above where the PVM surface would normally lie. b,c Engaged state (b) and resetting state (c) maps were low-pass filtered to 6Å to improve clarity of low resolution details, and are shown overlaid, at two different thresholds to improve visibility of the detergent belt and the poorly-resolved N-terminal domains of HSP101 (teal, higher threshold; peach, lower threshold). d, Resetting state map of PTEX displayed at a lower threshold to show the strong claw-shaped densities extending from the PTEX150(668–823) shaft up to the HSP101 MD. e, Enlarged view of the interaction between HSP101 Y488 and Y491 and the three-turn helix, shown with corresponding cryoEM density (mesh).

The PTEX150(S668-D823) heptamer acts as an adaptor between HSP101 and EXP2

Of the 993 residues in PTEX150, S668-D823 are well resolved in our structure and form a hook with a shaft (Fig. 3a-b). The hook domain consists of three short helices (H1–3) joined by several long loops. Directly N-terminal and C-terminal to the hook domain, the shaft is composed of proximal and distal shaft domains (Fig. 3a-b). The remaining 80% of PTEX150, not visible in our structures, is predicted to be intrinsically disordered (average disorder tendency of 0.83 in IUPred[26,27], with scores above 0.5 indicating disorder), unlike the rigid structured core of PTEX150 (S668-D823) (average disorder tendency score of 0.42, indicating ordered structure), suggesting that this 80% of the protein is too mobile to be observed and may be flexibly arranged outside the stable PTEX core.
Figure 3

PTEX150 forms a heptameric flange-shaped adaptor between EXP2 and HSP101.

a,b Linear schematic (a) and ribbon diagram (b) of the PTEX150(668–823) monomer in the engaged state. Dashed gray boxes represent unmodeled regions. Inset: one PTEX150(668–823) monomer (coloured) within the PTEX complex. PS, proximal shaft; DS, distal shaft. c, The PTEX150(668–823) heptamer, colored as in (b). d, Views showing how one PTEX150(668–823) monomer hooks into the top of the EXP2 funnel.

Seven PTEX150(S668-D823) hooks (labeled a-g) oligomerize, forming a flange-shaped C7-pseudosymmetric heptamer (Fig. 3c) that fits into the mouth of the EXP2 channel. Each hook lies in the groove between adjacent EXP2 body domains, and the tip of the hook curls down into the mouth of the EXP2 pore (Fig. 3d). A vertical, heptameric ring of H2 helices sits in the mouth of the EXP2 funnel, forming a conduit between the hexameric HSP101 and heptameric EXP2 central pores (Extended Data Fig. 2g–j). In this way, PTEX150(S668-D823) serves as an adaptor between HSP101 and EXP2, providing a continuous protected path for unfolded cargo.

Endogenous cargo is observed bound in the channel of the HSP101 protein unfoldase

Class 1 Clp/HSP100 AAA+ ATPases are highly conserved hexameric protein unfoldases associated with diverse functions, which are known to thread polymeric substrates through a central pore[28,29]. HSP101 is a 598kDa hexamer exemplifying the canonical Class 1 Clp/HSP100 domain architecture[30,31], with a substrate-binding N-terminal domain (NTD)[32] followed by two AAA+ nucleotide-binding domains (NBD1 and NBD2), each containing a cargo-binding pore loop (L1 and L2, respectively) that extends into the central pore (Fig. 4a-b). Additionally, HSP101 contains a C-terminal domain (CTD), and a coiled-coil middle domain (MD) insertion in the C-terminal end of NBD1 (Fig. 4a-b).
Figure 4

Endogenous cargo bound in the channel of the HSP101 hexamer.

a,b Linear schematic (a) and ribbon diagram (b) of the HSP101 monomer in the engaged state. c, Side view of the full (left) and bisected (right) HSP101 hexamer cryoEM map. NBD1 and NBD2 rings are coloured with light (NBD1) and dark (NBD2) blue gradients to emphasize the right-handed spiral shape of the hexamer. In the bisected map, NBD2 pore loop densities are coloured by protomer, ATPγS is colored magenta, and the cargo density is colored light pink. d, Enlarged side view of the atomic models of the HSP101 NBD2 pore loops and unfolded cargo polypeptide backbone, shown with densities. NBD2 pore loops are colored as in (c) and labeled by protomer (e. g., D2PL,P1: NBD2 Pore Loop, Protomer 1). Vertical distances between pore loop tyrosines in D2PL,P1–6 are 6.52Å, 6.28Å, 6.38Å, 6.96Å and 6.12Å, respectively.

Unlike Class 2 HSP100s [Ref 33], Class 1 HSP100s form three-tiered hexamers, where the NTDs, NBD1s and NBD2s form the top, middle, and bottom tiers, respectively[30,31]. In our engaged state structure, the NBD1 and NBD2 tiers are arranged in a right-handed ascending spiral[30,31,34] (Fig. 4c). A layer of weaker density above the NBD1 tier may correspond to the NTDs, which are likely dynamic (Extended Data Fig. 8b). The MDs encircle the upper NBD1 tier. The central pore of the spiral is lined with pore loops bearing tyrosines in a spiral staircase pattern. The tyrosine sidechain densities intercalate with a 45Å-long density clearly visible in the middle of the chaperone pore (Fig. 4c-d, Supplementary Video 5), which closely resembles unfolded cargo polypeptide densities reported in recently published cryoEM structures of homologous HSP100s bound to cargo[31,33] (Extended Data Fig. 2a–d). The unfolded PTEX cargo polypeptide chain modeled into this 45Å-long density matches very closely (RMSD of 1.09–1.25Å) with the unfolded cargo polypeptides in these cargo-bound homolog structures (Extended Data Fig. 2a–c).

Key interactions for PTEX assembly and a potential mechanism for regulation

While the three PTEX components share extensive binding interfaces, we describe only the two most intriguing interactions here. In EXP2 protomers A-F, the assembly strand augments the CTD β-sheet in the HSP101 protomer situated directly above (Fig. 5a-b). Protomer G occupies the space beneath the gap between HSP101 protomers 1 and 6 (Fig. 1f–k). This hydrogen bond-mediated interaction tethers the HSP101 hexamer to the transmembrane funnel, positioning the central pore exit directly above the entrance to the PTEX150/EXP2 pore. We hypothesized that this interaction is essential for assembly of the PTEX core complex, and that the complex must be stably assembled to be active. We tested this using genetic functional complementation in live parasites.
Figure 5

Interactions essential to PTEX function.

a,b Ribbon (a) and stick (b) models of the HSP101 CTD β-sheet augmented by the EXP2 assembly strand, shown with corresponding cryoEM density (mesh). Segment outlined in red was truncated in functional complementation assays. c, Western blot of EXP2apt parasites complemented with EXP2∆222–287-3xMYC (predicted molecular weight: 27.8 kDa after signal peptide cleavage). For blot source data, see Supplementary Fig. 1. d, Growth analysis of EXP2apt::∆222–287-3xMYC. Parasites were grown with or without aTc to maintain or knockdown endogenous EXP2 expression, respectively. One experiment performed with three technical replicates is shown. Bar graph shows mean exponential growth rate constant (hr−1) determined from the fit of the two independent experiments and error bars indicate s.d. e, Immunofluorescence assay (IFA) detecting exported protein SBP1 and HSP101–3xFLAG (as a PV marker) in EXP2apt::∆222–287-3xMYC parasites allowed to develop with or without aTc to 24 hr post invasion. Dashed line indicates the traced boundary of the RBC. DIC, differential interference contrast. f, Quantification of SBP1 export IFA assays. Data are pooled from two independent experiments, n is the number of individual parasite-infected RBCs. Boxes and whiskers delineate 25th-75th and 10th-90th percentiles, respectively. All P values determined by an unpaired, two-sided t-test. All data shown represent two independent experiments.

Knockdown of EXP2 produces a lethal defect in parasite growth and export that can be rescued by a mutant version of EXP2 lacking the last 54 residues[20]. Thus, the amino acids immediately following the assembly strand are not essential for PTEX function. However, complementation with a version of EXP2 lacking an additional 12 residues, removing the assembly strand, failed to rescue these phenotypes (Fig. 5c–f). These results demonstrate that the EXP2 assembly strand is critical to PTEX function, consistent with an essential role in docking the HSP101 unfoldase to the EXP2 membrane channel to facilitate translocation. A strong, albeit lower resolution claw-shaped density extends from the end of each modeled PTEX150(S668-D832) shaft to the HSP101 MD above, terminating in a three-turn helix resting atop the midpoint of the MD. This helix forms a strong interaction with HSP101 Y488 and Y491 in claws a-e (Extended Data Fig. 8d-e) but is not visible in claw f in the engaged state. Claw g appears to form an additional interaction with the N-terminal end of the HSP101 protomer 1 MD (Extended Data Fig. 8d). The MD is known to play a critical role in regulating ATPase and unfoldase activities in related HSP100s [Ref 35,36], suggesting the importance of this interaction.

Atomic details of the two observed states suggest a mechanism for translocation

In addition to the above-described engaged (195Å) state, a more compact (175Å) resetting state of PTEX was also observed. Much of PTEX150(S668-D823) and EXP2 remain unchanged between the engaged and resetting states, with a dramatic hinge-like swinging motion in the HSP101 hexamer accounting for the 20Å height difference. The TMD and B1–3 helices of EXP2 exhibit C7-symmetry, remaining identical between states (Supplementary Video 6). The deviation from C7-symmetry in the B4–5 helices and assembly domain is less pronounced in the resetting state (Extended Data Fig. 3b-c), likely due to the more planar arrangement of HSP101 protomers. As in the engaged state, slight inter-protomer variations in the PTEX150(S668-D823) H2–3 region bridge the gap between EXP2 and HSP101, maintaining a continuous protected path for unfolded cargo proteins. The spiral staircase of HSP101 tyrosine pore loops in the engaged state collapses into a planar “C” shape in the resetting state (Supplementary Video 7), with a freedom of movement possibly conferred by the gap between HSP101 protomers 1 and 6[30,31]. Originating at the interface between the NBD2 domains of HSP101 protomers 3 and 4, HSP101 protomers 4–6 swing downwards and outwards, creating a deep vertical cleft through the central pore of the hexamer. This motion pulls the NBD2 loops in protomers 4–6 away from the unfolded cargo (Extended Data Fig. 3d-e,h-i, Supplementary Video 6–7). A shorter (19Å vs 45Å), unfolded cargo density remains visible, bound to the NBD2 loops in protomers 1–3, while no peptide density is visible in protomers 4–6 (Fig. 6a, Extended Data Fig. 3h-i). Furthermore, the NBD1 domain of protomer 3 rotates outward, such that the R361 arginine finger remains within 5.2Å of the ATPγS in the protomer 4 NBD1, while the nucleotide in the protomer 4 NBD2 shifts 7.5Å away from the R859 arginine finger in protomer 3 (Extended Data Fig. 3f-g).
Figure 6

Mechanism of translocation.

a, Side views of the HSP101 pore loops with the unfolded cargo peptide backbone models (pink) built into the cryoEM densities (pink). Vertical distances between pore loop tyrosines in consecutive loops are: engaged D1PL,P1–6: 9.41Å, 8.61Å, 1.40Å, 3.34Å, 2.28Å; engaged D2PL,P1–6: 6.52Å, 6.28Å, 6.38Å, 6.96Å, 6.12Å; resetting D1PL,P1–6: 1.75Å, −2.70Å, −1.65Å, −0.78Å, 1.81Å; resetting D2PL,P1–6: 5.88Å, 4.56Å, −6.80Å, 2.25Å, 7.88Å. b, Proposed stepwise feeding mechanism of translocation by PTEX. NBD1 and NBD2 pore loops and cargo are colored as in (a).

Discussion

We propose a PTEX-mediated mechanism of protein translocation via a cyclic process involving at least two discrete states (Fig. 6b, Supplementary Video 6–7), which we have captured by purifying PTEX complexes directly from parasites actively translocating cargo. The pore loops in HSP101 NBD2 form two hands which work together to thread the cargo protein through the central pore. NBD2 loops from HSP101 protomers 1–3 form the passive hand, located closest to the PTEX150(S668-D823)/EXP2 funnel, which stays fixed between states (Fig. 6a-b). NBD2 loops from HSP101 protomers 4–6 form the active hand, which moves along the channel axis (above the passive hand), grasping the unfolding peptide and feeding it through the passive hand. In the engaged state, all six NBD2 pore loops grip the unfolded peptide in the spiral staircase formation (Fig. 6a-b). As the HSP101 hexamer collapses into the resetting state, the active hand moves downwards, feeding the newly unfolded peptide through the passive hand, into the PTEX150(S668-D823)/EXP2 funnel below. The passive hand then grips the unfolded peptide, preventing it from slipping back toward the HSP101 apical entrance while the active hand swings outward, releasing the cargo (Fig. 6a-b). Finally, the active hand moves upwards to grasp the unfolding protein further upstream, transitioning back into the engaged state. With this elegant cyclic feeding mechanism, the unfolded cargo protein is threaded through the translocon, across the PVM and into the host cell cytosol. The states captured here may be two of several states in the processive phase of translocation. Additional states likely exist for cargo-recognition. Although we did not observe PTEX-free HSP101 oligomers as suggested by Elsworth et al.[37], we did observe additional, seemingly cargo-free PTEX complexes (Extended Data Fig. 9) which did not refine to better than 7Å, suggesting conformational heterogeneity in the absence of stabilizing cargo interactions. Cargo-PTEX interactions during cargo-recognition may be transient, possibly explaining why we did not observe the HSP101 NTDs or other components potentially required for cargo-recognition. Without these details, the mechanisms for cargo-recognition and subsequent refolding after translocation remain unclear, although some evidence suggests involvement of exported parasite chaperones[38] or co-opted host chaperonins[39]. Interestingly, based on secondary structure prediction and PTEX150 truncation experiments[37], PTEX150 residues D838-F912 may occupy the claw (PTEX150 D838-E873) and three-turn helix (PTEX150 S884-F912) densities that remain unassigned in our structures.
Extended Data Figure 9

Data processing workflow.

Illustration of workflow for 3D classification, and focused classification and refinement. Maps are displayed at higher thresholds where the detergent belt is not visible for clarity, to avoid obscuring details of the transmembrane helices.

Our work demonstrates the advantages of obtaining structures of challenging protein complexes in functionally relevant states by imaging samples purified directly from endogenous sources. Direct observation of the native PTEX core provides compelling evidence that this complex, comprising EXP2, PTEX150 and HSP101, is a bona fide translocon embedded in the PVM that serves as the gateway for the malaria parasite exportome. In addition to establishing the role of EXP2 as the membrane-spanning pore of PTEX and providing insight into the mechanism of this essential protein translocating machine, our structures reveal a unique interaction between the EXP2 assembly domain and the HSP101 C-terminal domain which is indispensable for PTEX function. These highly sought-after atomic structures of PTEX provide exciting possibilities for designing a new class of drugs inhibiting this essential gatekeeper of the malarial exportome.

Materials and Methods

Cells

P. falciparum strain NF54attB [Ref 40] was used exclusively in the study. De-identified, IRB-exempt expired RBCs were obtained from the blood bank at the St. Louis Children’s Hospital. PCR amplified regions from the NF54attB genome were found to match the genome sequence for 3D7, a sub clone of NF54. The prescence of the cg6 localized attB sequence was verified by successful Bxb1-mediated integration at that site.

Parasite culture and genetic modification for PTEX purification

P. falciparum culture was performed as described with the exception that RPMI was supplemented with 0.5% Albumax I [41]. All plasmid construction was carried out by Infusion cloning (Clontech) unless otherwise noted. Integration of a 3xFLAG fusion at the endogenous HSP101 C-terminus was accomplished with CRISPR/Cas9 editing. A Cas9 target site was chosen just upstream of the hsp101 stop codon (TAATAGTAAAGCTAAAAACT) and the guide RNA seed sequence was synthesized as a sense and anti-sense primer pair (sense shown) 5’- TAAGTATATAATATTTAATAGTAAAGCTAAAAACTGTTTTAGAGCT AGAA −3’, annealed and inserted into the BtgZI site of the plasmid pAIO [42], resulting in the plasmid pAIO-HSP101-CT-gRNA1. A 5’ homology flank (up to but not including the stop codon) was amplified from P. falciparum NF54attB genomic DNA using primers 5’-GACGCGAGGAAAATTAGCATGCATCCTTAAGGAGATTCTGGTATGCCACTTGGTTC-3’ and 5’- CTGCACCTGGCCTAGGGGTCTTAGATAAGTTTATAACTAAGTT TTTAGCTTTACTATT-3’, incorporating a synonymous shield mutation in the protospacer adjustment motif of the gRNA target site within the hsp101 coding sequence. A 3’ homology flank (beginning 3 bp downstream of the stop codon) was amplified using primers 5’- CACTATAGAACTCGAGAATTACGCATATATATATATATATATATATATAACATGGGTTG-3’ and 5’- GAACCAAGTGGCATACCAGAATCTCCTTAAGGATGCATGCTAATTTTCCTCGCGTC-3’F. The flank amplicons were assembled in a second PCR reaction using primers 5’- CACTATAGAACTCGAGAATTACGCATATATATATATATATATATATATAACATGGGTTG-3’ and 5’- CTGCACCTGGCCTAGGGGTCTTAGATAAGTTTATAACTAAGTTTTTAGCTTTACTATT-3’ and inserted between XhoI and AvrII in pPM2GT[41]. The GFP tag between AvrII and EagI in this vector was then replaced with sequence encoding a 3xFLAG tag using the primer 5’- CTTAGTTATAAACTTATCTAAGACCCCTAGGGACTACAAGGACGACGACGACAAGGATTATAAAGATGATGATGATAAAGATTATAAAGATGATGATGATAAATGACGGCCGCGTCGAGTTATATAATATATTTATG-3’ and a QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), resulting in the plasmid pPM2GT-HSP101–3xFLAG. This plasmid was linearized at the AflII site between the 3’ and 5’ homology flanks and co-transfected with pAIO-HSP101-CT-gRNA1 into P. falciparum NF54attB parasites[40]. Selection with 10 nM WR99210 was applied 24 hours after transfection. Once parasites returned from selection, integration at the intended site was confirmed by PCR with primers 5’-CGAAAACTTTTATGGTATTAATATAACAG-3’ and 5’-CCTTGTCGTCGTCGTCCTTG-3’ and a clonal line was isolated by limiting dilution. For PTEX purification, HSP101–3xFLAG parasites were synchronized by serial treatment with 5% w/v D-sorbitol and then expanded while shaking to increase singlet invasion events and maintain synchrony. For each preparation, ~2×1010 parasite-infected erythrocytes were collected at the ring stage (typically ~500 mls of 2% hematocrit culture at ~20% parasitemia). Erythrocytes were lysed in 10x pellet volume of cold phosphate buffered saline (PBS) containing 0.0125% saponin (Sigma, sapogenin content ≥10%) and EDTA-free protease inhibitory cocktail (Roche or Pierce). Released parasites were washed in cold PBS containing EDTA-free protease inhibitory cocktail and washed cell pellets were frozen in liquid nitrogen and stored at −80°C.

Affinity purification of PTEX core complex from parasite pellets

Frozen parasite pellets were resuspended in Lysis Buffer (25mM HEPES pH 7.4, 10mM MgCl2, 150mM KCl, 10% Glycerol) and homogenized using a glass Dounce tissue homogenizer. The membrane fraction was isolated from the homogenized lysate by centrifugation at 100,000g for one hour. The membrane pellet was solubilized in Solubilization Buffer (25mM HEPES pH 7.4, 10mM MgCl2, 150mM KCl, 10% Glycerol, 0.4% Triton X-100) and the solubilized membranes were then applied to anti-FLAG M2 Affinity Gel resin (Sigma). The resin was washed extensively in Wash Buffer (25mM HEPES pH 7.4, 10mM MgCl2, 150mM KCl, 10% Glycerol, 0.015% Triton X-100), after which the protein was eluted from the affinity resin with Elution Buffer (25mM HEPES pH 7.4, 10mM MgCl2, 150mM KCl, 2mM ATPγS, 0.015% Triton X-100, 500µg/ml FLAG peptide). The presence and relative abundance of the three PTEX core components were verified by silver stained SDS-PAGE and tryptic digest liquid chromatography-mass spectrometry (Extended Data Fig. 1d-e). The extremely low yields achievable when purifying PTEX directly from P. falciparum parasites prohibited the conventional approach of evaluating sample quality by size exclusion chromatography. Thus, during the iterative process of screening for optimal purification conditions, sample quality was assessed by negative stain (uranyl acetate) transmission electron microscopy in an FEI TF20 microscope equipped with a TVIPS 16 mega-pixel CCD camera. Briefly, small datasets of ~100,000 particles were collected and 2D class averages were generated in RELION[43,44] to assess the presence of sufficient numbers of intact PTEX particles yielding “good” class averages exhibiting distinct features. For example, C7 symmetry could be recognized in top views, and the characteristic Clp/HSP100 layers were visible in side views (Extended Data Fig. 6a–c).

Cryo Electron Microscopy

3µl aliquots of purified PTEX core complex were applied to glow-discharged lacey carbon grids with a supporting ultrathin carbon film (Ted Pella). Grids were then blotted with filter paper and vitrified in liquid ethane using an FEI Vitrobot Mark IV or a home-made manual plunger. CryoEM grids were screened in an FEI Tecnai TF20 transmission electron microscope while optimizing freezing conditions. Higher resolution cryoEM images were collected on a Gatan K2-Summit direct electron detector in counting mode on an FEI Titan Krios at 300kV equipped with a Gatan Quantum energy filter set at a 20 eV slit width. Fifty frames were recorded for each movie at a pixel size of 1.04Å at the specimen scale, with a 200 ms exposure time and an average dose rate of 1.2 electrons per Å2 per frame, resulting in a total dose of 60 electrons per Å2 per movie. The final dataset consists of a total of 25,000 movies recorded in four separate sessions.

Image processing and 3D reconstruction

Frames in each movie were aligned, gain reference-corrected and dose-weighted to generate a micrograph using MotionCor2 [Ref [45]]. Aligned and un-dose-weighted micrographs were also generated and used for contrast transfer function (CTF) estimation using CTFFIND4 [Ref [46]] and PTEX particle picking by hand and using Gautomatch[47]. 1,508,462 particles were extracted from 19,752 micrographs and initially binned by a factor of 2. After two rounds of reference-free two-dimensional (2D) classification in RELION, 422,713 particles were selected as “good” particles from distinct 2D class averages representing different views of the PTEX core complex. These particles were then used in a one-class ab initio reconstruction followed by homogeneous refinement in CryoSPARC[48], yielding a 4.8Å ab initio 3D map. The original 422,713 “good” particles were then aligned in a 3D refinement in RELION using the 4.8Å CryoSPARC map as an initial reference. All subsequent image-processing steps were performed using RELION. After this refinement, the particles were unbinned, their centers recalculated and used to re-extract particles from the original micrographs without binning. The newly extracted, unbinned particles were then aligned with a second 3D refinement yielding a ~4.5Å reconstruction. An exhaustive, iterative search of classification and refinement conditions was used to sort out different conformations and further improve resolution (Extended Data Fig. 9). Briefly, upon further sorting using 3D-classification without alignment, we identified two homogenous particle subsets corresponding to the engaged and resetting states (Extended Data Fig. 9). Particles in the two subsets were refined separately, yielding full maps with overall resolutions of 4.16Å and 4.23Å, respectively. Focused 3D classification without alignment followed by focused refinement was used to further improve the resolution of mobile regions of the structure in both states. C7 symmetry was applied in the focused 3D classification and refinement steps of the heptameric halves, comprising EXP2 and PTEX150, yielding a 3.4Å engaged state map and a 3.5Å resetting state map (Extended Data Fig. 3,9). The same procedure, except with C1 symmetry, was applied to the hexameric half of the engaged state, yielding a 4.09Å map (Extended Data Fig. 3,9). This last step was also applied to the hexameric half of the resetting state, but did not yield improvements in resolution. Further efforts of focused 3D classification and refinement of individual HSP101 protomers, individual claws, and HSP101 N-terminal domain densities in the two states did not ultimately yield improvements in resolution in either state.

Model Building and Refinement

Map interpretation was performed with UCSF Chimera[49] and COOT[50]. P. falciparum protein sequences were obtained from the National Center for Biotechnology Information (NCBI)[51] and the PlasmoDB[52] protein databases. PHYRE2 [Ref [53]] secondary structure predictions were used as an aid for initial manual sequence registration. Models for a single monomer of HSP101, PTEX150, and EXP2 in the engaged state were all built de novo. This first model for each protein monomer was then placed into the density maps of other protomers to aid de novo modeling of subsequent protomers. Individual protomers in the complex were then manually remodeled to ensure a close fit between densities and models. The same process was repeated for the resetting state. Manual refinement targeting protein geometry alone was done primarily along the periphery and flexible regions of the complex (e.g., the MDs of HSP101). While their densities and backbone traces were visible, we were unable to model the claw with its connected three-turn helix, nor one of the 12 MD loops in the resetting state (Fig. 5g,h). The three-turn helix displayed a few bulky side chains interacting with the MD of HSP101, however the lack of backbone connection to our atomic model of the complex and the limited visibility of smaller side chains in this region have made sequence assignment challenging. Manual refinement targeting both protein geometry and fit with the density map was used primarily in the core regions where resolution was higher and noise was minimal. Rotamers were fit manually in COOT and improved using the ‘Back-rub Rotamers’ setting. The resulting models for the complexes were subjected to the phenix.real_space_refine program in PHENIX[54]. Following this step, Molprobity[55] reported less than ideal clash scores and map-to-model cross-correlation. To improve the geometry and fit, manual adjustments were made to protein geometry and density map fit, with the additional step of using Molprobity[55] clash dots and sphere-refinement in COOT. The complex was then broken into three portions: (1) symmetric regions of EXP2 and PTEX150, (2) HSP101, and (3) the full PTEX complex. These model segments were fed back to phenix.geometry_minimization in PHENIX and then to phenix.real_space_refine using simulated annealing and global minimization applying Emsley’s Ramachandran restraints[50]. Following another round of manual checks and improvements, all models were subjected to phenix.real_space_refine with default settings one last time. All figures and videos were prepared with UCSF Chimera, Pymol[56], and Resmap[57]. Molprobity was used to validate the stereochemistry of the final models.

Genetic complementation

For expression of a complementing second copy of truncated EXP2, the exp2 coding sequence up to codon position 221 was amplified with primers 5’- CGAATAAACACGATTTTTTCTCGAGATGAAAGTCAGTTATATATTT TCCTTTTTTTTGTTATTCTTCG-3’ and 5’-AATCAACTTTTGTTCGCTAGCTTTCTTTG ATTCCATAGATTTCAATTTCTCTTCC-3’ and inserted into the plasmid pyEOE-attP-EXP2–3xMYC[20] between XhoI and NheI, resulting in the plasmid pyEOE-attP-EXP2∆222–287-3xMYC. This plasmid was co-transfected with pINT[40] into EXP2apt::HSP101–3xFLAG conditional knockdown parasites[20] at the mature schizont stage using a Nucleofector 2b and Basic Parasite Nucleofector kit 2 (Lonza). Selection with 2µM DSM1 [Ref [58]] was applied 24 h post transfection (in addition to 2.5 µg/ml Blasticidin S and 1 µM anhydrotetracycline (aTc) for maintenance of endogenous EXP2 translational control by the aptamer system) to facilitate integration into the attP site engineered in the benign cg6 locus through integrase mediated attB x attP recombination. Following return from selection, parasites were cloned by limiting dilution, and expression of EXP2∆222–287-3xMYC was confirmed by western blot.

Parasite growth assays

EXP2apt::∆222–287 parasites were extensively washed to remove aTc and plated with or without 1µM aTc in triplicate at an initial parasitemia of 1%. Media was changed every 48 h and 1:1 subculture was performed every other day beginning on day 4 to avoid culture overgrowth. Parasitemia (percent of total red blood cells (RBCs) infected) was measured every 24 h by flow cytometry on a FACSCanto (BD Biosciences) by nucleic acid staining of cultured RBCs with PBS containing 0.8 µg/ml acridine orange. Cumulative parasitemias were back calculated based on the subculture schedule and data were fit to an exponential growth equation to determine rate constants using Prism (Graphpad).

Quantification of protein export

For evaluation of protein export by immunofluorescence assay (IFA), mature schizonts were purified on a magnetic column and allowed to invade fresh, uninfected RBCs with shaking for 3 hours before treatment with 5% w/v D-sorbitol to destroy unruptured schizonts. Pulse invaded cells were plated with or without 1 µM aTc and allowed to develop 24 h post invasion. Thin smears of infected RBCs were briefly air dried and immediately fixed in ice cold acetone for 2 minutes. After fixation, samples were blocked for 30 minutes in PBS+3% BSA followed by incubation for one hour with primary antibody solutions containing mouse anti-FLAG M2 mAb (detecting HSP101–3xFLAG to mark the PVM) and rabbit anti-SBP1. After washing, secondary antibody incubation was carried out for one hour with Alexa Fluor anti-mouse 488 and anti-rabbit 594 IgG antibodies (Life Technologies), each diluted 1:2000. After final washing, coverslips were mounted over each sample using Pro-long antifade Gold with DAPI (Life Technologies). Images were collected with an ORCA-ER CCD camera (Hamamatsu) using AxioVision software on an Axio Imager.M1 microscope (Zeiss) with a 100x oil immersion objective using the same exposure times for each image (300 ms for SBP1–594, 150 ms for FLAG-488). Ten images were acquired for each condition using the DAPI channel for field selection to avoid bias. Images were then analyzed using Volocity 6.3 (PerkinElmer). The border of each single-infected erythrocyte was traced using the DIC channel as a guide to define a region of interest (ROI). The PVM was marked using the “find objects” measurement tool for the HSP101–3xFLAG-488 channel (automatic threshold setting with threshold offset set to −30% and minimum object size set to 0.5 µm2). Individual Maurer’s clefts were identified using the “find spots” measurement tool for the SBP1–594 channel (offset minimum spot intensity set to 40% and brightest spot within radius set to 0.5 µm). All spots within the PVM object boundary were then removed using the “subtract” measurement tool and the number and fluorescent intensity of the remaining spots in each ROI were collected. Data were pooled from two independent experiments and plotted with Prism.

Antibodies

The following primary antibodies were used for IFA and western blot: mouse anti-FLAG mAb clone M2 (Sigma) (IFA: 1:500, WB 1:500); rabbit polyclonal anti-SBP1 [Ref 59] (IFA: 1:500); mouse anti-cMYC mAb 9E10 (ThermoFisher) (WB: 1:300).

Generation of HSP101–3xFLAG parasites and analysis of purified PTEX .

a, Schematic showing strategy for endogenous tagging of P. falciparum hsp101 with 3xFLAG using CRISPR/Cas9 editing. Diagnostic PCR primers and expected amplicon following successful integration are shown. sgRNA, single guide RNA; UTR, untranslated region; CAM, calmodulin promoter; PfU6, P. falciparum U6 promoter; hDHFR, human dihydrofolate reductase. b, Diagnostic PCR with genomic DNA template from NF54attB parent or two independent populations of HSP101–3xFLAG parasites. kb, kilobase pairs. The experiment was performed one time. c, Western blot of NF54attB and HSP101–3xFLAG parasites probed with mouse-anti-FLAG M2 antibody (Sigma) and goat-anti-mouse IRDye 680 secondary (Li-cor). Arrowhead indicates full-length HSP101–3xFLAG (predicted molecular weight 102.9 kDa after signal peptide cleavage). kDa, kilodaltons. Data represent two independent experiments. d, Giemsa staining of parasite-infected human erythrocytes from which PTEX was purified. Scale bar: 5um. For source data, see Supplementary Figure 3. e, Silver stained SDS-PAGE gel of the FLAG-purified PTEX sample. Identities of the bands labeled EXP2, PTEX150, and HSP101 were confirmed by tryptic digest LC-MS. f, Tryptic digest liquid chromatography-mass spectrometry (LC-MS) analysis of the FLAG-purified PTEX sample. The PTEX core components are among the five most abundant species detected in the purified sample. For gel and blot source data, see Supplementary Figure 1.

Detailed views of the PTEX protein-conducting channel and symmetry mismatch in the engaged state.

CryoEM densities and atomic models of cargo and pore loops from the near-atomic resolution structures of Clp/HSP100 ATPases YME1[61] (a), PTEX HSP101 (b), and HSP104[31] (c). Tyrosine sidechain densities are clearly visible intercalating with the cargo densities. The modeled engaged state PTEX cargo has a calculated RMSD of 1.09Å and 1.25Å to the published YME1 and HSP104 cargo models, respectively. Pore loops are labeled by NBD and protomer (e. g., D2PL,P1: NBD2 Pore Loop, Protomer 1). d, Side view of the bisected engaged state PTEX cryoEM map. The protein-conducting channel, calculated using HOLE[60], is shown superimposed over the bisected map in translucent white with a navy outline. The HSP101 NBD2 pore loop densities are colored by HSP101 protomer, and the cargo density is colored pink. e-j, The transition from the assymetric HSP101 spiral to the C7 pseudosymmetric PTEX150(668–823)-EXP2 heptamer is depicted using a series of cross sections taken perpendicular to the central axis of the translocon, spanning the area of symmetry mismatch. The section of the translocon corresponding to each cross-sectional image is indicated with a brackets in (d).

Detailed comparisons of the engaged and resetting states.

a, Side and top views of the EXP2 heptamer in the engaged state. Symmetric portions that remain constant between protomers are colored in mint. Portions that vary between protomers are colored and labeled by protomer. b-c, Superposition of the seven EXP2 protomers, labeled A-G, in the engaged (b) and resetting (c) states, colored as in (a). Ribbon diagrams of the resetting state (a) and engaged state (b) nucleotide binding pockets are shown for each protomer. d-e, Top view of HSP101 NBD1 (d) and NBD2 (e) in the engaged and resetting states, shown in simplified surface representation. The hinge point at the interface between HSP101 protomers 3 and 4 is indicated. f-g, Ribbon diagrams of the resetting state (f) and engaged state (g) nucleotide binding pockets are shown for each protomer. ATPγS in each pocket is shown with corresponding cryoEM density (mesh). The R859 arginine finger (sidechain shown in red-orange) is positioned ~3–5.5Å from the phosphorous atom in the γ-phosphate of the ATPγS in the binding pocket of the neighboring protomer in all protomers except R859 in protomer 3 in the resetting state (sidechain shown in gold), where the ATPγS bound in the protomer 4 NBD2 nucleotide pocket has shifted ~7.5Å away from the protomer 3 R859 arginine finger. h-i, Enlarged side view of the atomic models of the HSP101 NBD2 pore loops and unfolded cargo polypeptide backbone in the engaged (h) and resetting (i) states, shown with corresponding cryoEM densities. Tyrosine sidechain densities are clearly visible intercalating with the cargo densities. The modeled PTEX cargo has a calculated RMSD of 1.09Å and 1.25Å to the published YME1 and HSP104 cargo models, respectively. Pore loops are labeled by NBD and protomer (e. g., D2PL,P1: NBD2 Pore Loop, Protomer 1).

Resolution assessments of the two PTEX states.

a-c,e-f Local resolution evaluations of the full PTEX map (a) and the focus-refined maps of the upper/hexameric (b) and lower/heptameric (c) halves of PTEX in the engaged state, and the full PTEX map (e) and the focus-refined map of the lower/heptameric (f) half of PTEX in the resetting state, calculated by Resmap[57] and colored according to resolution. Maps are displayed at higher thresholds where the detergent belt is not visible for clarity, to avoid obscuring details of the transmembrane helices. d, Global resolution assessment of the engaged and resetting state maps as measured using the “Gold-standard” Fourier shell correlation (FSC) curves generated by RELION[43,44] by comparison of two independently refined “half-maps”. g, Map-to-model FSC curves demonstrating the degree of correlation between the refined PTEX models and the experimental cryoEM maps for the engaged and resetting states.

Representative regions of cryoEM density and atomic models.

Additional cryoEM densities (mesh) superposed with our atomic models for HSP101 (a), PTEX150(668–823) (b), and EXP2 (c). Displayed regions correspond to areas circled in magenta on guide figures (inset, upper right), and are colored as in guide figure: HSP101 (cornflower blue), PTEX150(668–823) (salmon), EXP2 (mint). Terminal residues for each segment are labeled with the amino acid, residue number, protomer, and state.

Experimentally determined secondary structure elements and detected mass-spec fragments mapped to the primary sequences of the three PTEX proteins.

For EXP2 (a), PTEX150 (b), and HSP101 (c), secondary structure elements are shown as tubes (helices), lines (loops), and arrows (strands) above the corresponding sequence and are colored as in Fig. 2a, 3a, and 4a. In the sequences shown below, residues resolved in our structures are colored according to protein colors in Fig. 1c–f: EXP2 (mint), PTEX150 (salmon) and HSP101 (cornflower). Signal peptide residues are colored gold. All residues in the mature proteins that are not resolved in our structures are shown in grey. The 3xFLAG residues at the C-terminus of HSP101 are colored green. Peptides detected in tryptic digest LC-MS/MS analysis of the purified PTEX sample are shown as black lines below the corresponding sequences. Arrowheads above the EXP2 sequence indicate truncations sites described in this work and in Garten et al.[20] immediately before (∆222–287, red arrowhead) and after (∆234–287, green arrowhead) the assembly strand. Arrowheads above PTEX150 sequence indicate previously described truncation sites[37] (∆847–993, red arrowhead; ∆869–993, green arrowhead).

EM of the PTEX core complex.

a-c Representative negative stain micrograph (a), enlarged portion of micrograph (b), and two-dimensional class averages (c) of the PTEX core complex in multiple orientations. d,e Representative cryoEM micrograph (d) and two-dimensional class averages (e) of the PTEX core complex in multiple orientations. Arrow in upper left panel of (e) indicates the detergent belt, which is visible as a less-dense (dimmer) halo surrounding the denser (brighter) densities of the alpha helices visible in the TMD in side views. Scale bars are 700Å, 700Å, 100Å, 200Å and 100Å, respectively.

Detergent belt, amino-terminal domain, and claw densities visible in maps at lower thresholds.

a, The engaged state PTEX150/EXP2 heptamer, displayed in surface representation and colored by electrostatic potential. The bottom half of the full engaged state density map is superimposed, showing the location of the detergent belt in relation with the EXP2 TMD. A ring of positively charged residues is clearly visible directly above where the PVM surface would normally lie. b,c Engaged state (b) and resetting state (c) maps were low-pass filtered to 6Å to improve clarity of low resolution details, and are shown overlaid, at two different thresholds to improve visibility of the detergent belt and the poorly-resolved N-terminal domains of HSP101 (teal, higher threshold; peach, lower threshold). d, Resetting state map of PTEX displayed at a lower threshold to show the strong claw-shaped densities extending from the PTEX150(668–823) shaft up to the HSP101 MD. e, Enlarged view of the interaction between HSP101 Y488 and Y491 and the three-turn helix, shown with corresponding cryoEM density (mesh).

Data processing workflow.

Illustration of workflow for 3D classification, and focused classification and refinement. Maps are displayed at higher thresholds where the detergent belt is not visible for clarity, to avoid obscuring details of the transmembrane helices. Cryo-EM data collection, refinement and validation statistics.
Extended Data Table 1

Cryo-EM data collection, refinement and validation statistics.

PTEX Engaged Full (EMDB-8951) (PDB 6E10)PTEX Engaged Top (EMDB-8951) (PDB 6E10)PTEX Engaged BoCoen (EMDB-8951) (PDB 6EI0)PTEX Resetting Fun (EMDB-8952) (PDB 6E11)PTEX Resetting Top (EMDB-8952) (PDB 6E11)PTEX Resetting Bottom (EMDB-8952) (PDB 6E11)
Data collection and processing
Magnification×105,000×105,000×105,000×105,000n/a×105,000
Voltage (kV)300300300300n/a300
Electron exposure (e-/Å2)60606060n/a60
Defocus range (μm)−1 5 to – 40−1 5 to – 40−1 5 to – 40−1 5 to – 40n/a−1 5 to – 40
Pixel size (Å)1.041.041.041 04n/a1.04
Symmetry nrcanlClClC7Cln/aC7
Initial particle traces (no)1,508,4621,508,4621,508,4621,508,462n/a1,508,462
Final purticle images (no)  72,966  53,531  39,437  78,499n/a48,425
Map resolution (Å)  FSC threshold4.090.1434 160.1433.50.1434.230.143n/a3.40.143
Map resolution range (Å)3.2–7.53.0–7.02.8–3.63.2–7.5n/a2. 8–3.4
Refinement
Initial model wed (PDB cock)n/an/an/an/an/an/a
Model resolution (Å)  FSC threshold4.580.54.230.53.590.54.840.5n/a3.670.5
Model resoluion range (Å)4.584.233.594.84n/a3.67
Map sharpening B factor (Å2)−180−180−170−180n/a−160
Model compoution Non-hydrogen atoms Protein residues Legand57,3526,8381257,3526,8381257,3526,8381257,4016,8261257,4016,8261257,4016,82612
B factor (Å2) Protein Legandn/an/an/an/an/an/a
R.m.s. deviation Bond lengths (Å) Bond angles (°)0.0081.3110.0091.2620.0080.9250.0081.3000.0071.3320.0060.895
Validation MolProhety score (Clashscore Poor rotamers(%)1.959.741.041.817.350.131.534.010.452.0310.440.471.967.460.051.645.480.33
Ramachandran plot Favored (%) Allowed (%) Disallolwed (%)93.965.530 5194.015.760.2394.994.690.3391.917.650.4489.989.580.4494.985.010.00
  56 in total

1.  Quantitative assessment of Plasmodium falciparum sexual development reveals potent transmission-blocking activity by methylene blue.

Authors:  Sophie H Adjalley; Geoffrey L Johnston; Tao Li; Richard T Eastman; Eric H Ekland; Abraham G Eappen; Adam Richman; B Kim Lee Sim; Marcus C S Lee; Stephen L Hoffman; David A Fidock
Journal:  Proc Natl Acad Sci U S A       Date:  2011-10-31       Impact factor: 11.205

2.  Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions.

Authors:  E Krissinel; K Henrick
Journal:  Acta Crystallogr D Biol Crystallogr       Date:  2004-11-26

3.  Protein unfolding is an essential requirement for transport across the parasitophorous vacuolar membrane of Plasmodium falciparum.

Authors:  Nina Gehde; Corinna Hinrichs; Irine Montilla; Stefan Charpian; Klaus Lingelbach; Jude M Przyborski
Journal:  Mol Microbiol       Date:  2008-11-24       Impact factor: 3.501

Review 4.  Surprising similarities in structure comparison.

Authors:  J F Gibrat; T Madej; S H Bryant
Journal:  Curr Opin Struct Biol       Date:  1996-06       Impact factor: 6.809

5.  MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy.

Authors:  Shawn Q Zheng; Eugene Palovcak; Jean-Paul Armache; Kliment A Verba; Yifan Cheng; David A Agard
Journal:  Nat Methods       Date:  2017-02-27       Impact factor: 28.547

6.  The Toxoplasma Dense Granule Proteins GRA17 and GRA23 Mediate the Movement of Small Molecules between the Host and the Parasitophorous Vacuole.

Authors:  Daniel A Gold; Aaron D Kaplan; Agnieszka Lis; Glenna C L Bett; Emily E Rosowski; Kimberly M Cirelli; Alexandre Bougdour; Saima M Sidik; Josh R Beck; Sebastian Lourido; Pascal F Egea; Peter J Bradley; Mohamed-Ali Hakimi; Randall L Rasmusson; Jeroen P J Saeij
Journal:  Cell Host Microbe       Date:  2015-05-13       Impact factor: 21.023

7.  Hsp70 proteins bind Hsp100 regulatory M domains to activate AAA+ disaggregase at aggregate surfaces.

Authors:  Fabian Seyffer; Eva Kummer; Yuki Oguchi; Juliane Winkler; Mohit Kumar; Regina Zahn; Victor Sourjik; Bernd Bukau; Axel Mogk
Journal:  Nat Struct Mol Biol       Date:  2012-11-18       Impact factor: 15.369

8.  Yeast dihydroorotate dehydrogenase as a new selectable marker for Plasmodium falciparum transfection.

Authors:  Suresh M Ganesan; Joanne M Morrisey; Hangjun Ke; Heather J Painter; Kamal Laroiya; Margaret A Phillips; Pradipsinh K Rathod; Michael W Mather; Akhil B Vaidya
Journal:  Mol Biochem Parasitol       Date:  2011-01-18       Impact factor: 1.759

9.  Targeting malaria virulence and remodeling proteins to the host erythrocyte.

Authors:  Matthias Marti; Robert T Good; Melanie Rug; Ellen Knuepfer; Alan F Cowman
Journal:  Science       Date:  2004-12-10       Impact factor: 47.728

10.  RELION: implementation of a Bayesian approach to cryo-EM structure determination.

Authors:  Sjors H W Scheres
Journal:  J Struct Biol       Date:  2012-09-19       Impact factor: 2.867

View more
  58 in total

1.  Atomic Structures of Anthrax Prechannel Bound with Full-Length Lethal and Edema Factors.

Authors:  Kang Zhou; Shiheng Liu; Nathan J Hardenbrook; Yanxiang Cui; Bryan A Krantz; Z Hong Zhou
Journal:  Structure       Date:  2020-06-09       Impact factor: 5.006

2.  Effects and Mechanism of Action of Artemisinin on Mitochondria of Plasmodium berghei.

Authors:  Hong-Ping Hou; Guang-Ping Zhang; Li-Na Ma; Ping Su; Zhong-Xiu Zhang; Bao-Qiang Dai; Zu-Guang Ye
Journal:  Chin J Integr Med       Date:  2019-06-21       Impact factor: 1.978

Review 3.  Challenges and opportunities in cryo-EM single-particle analysis.

Authors:  Dmitry Lyumkis
Journal:  J Biol Chem       Date:  2019-02-25       Impact factor: 5.157

4.  Protein translocation by the SecA ATPase occurs by a power-stroke mechanism.

Authors:  Marco A Catipovic; Benedikt W Bauer; Joseph J Loparo; Tom A Rapoport
Journal:  EMBO J       Date:  2019-03-15       Impact factor: 11.598

Review 5.  Malaria parasite plasmepsins: More than just plain old degradative pepsins.

Authors:  Armiyaw S Nasamu; Alexander J Polino; Eva S Istvan; Daniel E Goldberg
Journal:  J Biol Chem       Date:  2020-05-04       Impact factor: 5.157

6.  EXP1 is critical for nutrient uptake across the parasitophorous vacuole membrane of malaria parasites.

Authors:  Paolo Mesén-Ramírez; Bärbel Bergmann; Thuy Tuyen Tran; Matthias Garten; Jan Stäcker; Isabel Naranjo-Prado; Katharina Höhn; Joshua Zimmerberg; Tobias Spielmann
Journal:  PLoS Biol       Date:  2019-09-30       Impact factor: 8.029

Review 7.  Translocation of effector proteins into host cells by Toxoplasma gondii.

Authors:  Suchita Rastogi; Alicja M Cygan; John C Boothroyd
Journal:  Curr Opin Microbiol       Date:  2019-08-23       Impact factor: 7.934

8.  Kinetic Analysis of AAA+ Translocases by Combined Fluorescence and Anisotropy Methods.

Authors:  Nathaniel W Scull; Aaron L Lucius
Journal:  Biophys J       Date:  2020-08-24       Impact factor: 4.033

Review 9.  Stairway to translocation: AAA+ motor structures reveal the mechanisms of ATP-dependent substrate translocation.

Authors:  Stephanie N Gates; Andreas Martin
Journal:  Protein Sci       Date:  2019-10-17       Impact factor: 6.725

10.  Therapeutic genetic variation revealed in diverse Hsp104 homologs.

Authors:  Katelyn Sweeney; Hanna Kim; Xiaohui Yan; Zachary M March; Laura M Castellano; Meredith E Jackrel; JiaBei Lin; Edward Chuang; Edward Gomes; Corey W Willicott; Karolina Michalska; Robert P Jedrzejczak; Andrzej Joachimiak; Kim A Caldwell; Guy A Caldwell; Ophir Shalem; James Shorter
Journal:  Elife       Date:  2020-12-15       Impact factor: 8.140

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.