| Literature DB >> 30140323 |
P Purkan1, I Ihsanawati2, D Natalia2, Y M Syah2, D S Retnoningrum3, I Siswanto1.
Abstract
Isoniazid (INH) is a drug for the treatment of tuberculosis in patients infected with Mycobacterium tuberculosis. The katG enzyme, or catalase-peroxidase, activates the pro-drug INH that is coded by the katG gene in M. tuberculosis. Mutations of the katG gene in M. tuberculosis are a major INH resistance mechanism. The M. tuberculosis clinical isolate R2 showed INH resistance at a high level of 10 µg/mL. However, the molecular basis for the resistance is unclear. The identification of a mutation in the katG gene of the clinical isolate R2 showed four mutations, i.e., C1061T, G1261 A, G1388T, G2161A, which correspond to the amino acid substitutions T354I, G421S, R463L, and V721M, respectively. The mutant katG gene, along with the wild-type were cloned, expressed and purified. The mutant enzyme showed 86.5% of catalase and 45% of peroxidase activities in comparison to the wild type. The substitutions of T354I and G421S in mutant katG R2 created significant instability in the adduct triad complex (Trp107-Tyr229-Met255), a part of the active site of the catalase-peroxidase enzyme in the model structure analysis. The events could be based on the high resistance of the clinical isolate R2 toward INH as the molecular basis.Entities:
Keywords: Mycobacterium tuberculosis; catalase-peroxidase; isoniazid; katG
Mesh:
Substances:
Year: 2018 PMID: 30140323 PMCID: PMC6101688
Source DB: PubMed Journal: J Med Life ISSN: 1844-122X
The nucleotide of primers
| No | Primer | Number of nucleotides | Nucleotides of primers (5’→3’) |
|---|---|---|---|
| 1 | SP6 promoter | 24 | catacgatttaggtgacactatag |
| 2 | T7 promoter | 20 | taatacgactcactataggg |
| 3 | FG ( | 32 | |
| 4 | RG ( | 32 | |
| 5 | KF | 20 | gcagatggggctgatctacg |
| 6 | FDPRK | 18 | cgacgagttcgccaaggc |
| 7 | 28 | ggtcatatgaaataccccgtcgagggcg | |
| 8 | 30 | cgtctagactcagcgcacgtcgaacctgtc |
The profile of katG of INH resistant M. tuberculosis clinical isolate (R2)
| Gene | Clinical isolate of | Mutation | The level of INH resistance [µg/mL] | |||
|---|---|---|---|---|---|---|
| Σ | Nucletide | Σ | Amino acid | |||
| R2 | 4 | C 1061 T | 4 | T354Ia | 10 | |
new mutations
this mutation was also reported by Brossier et al, 2006 (G1388T & G1481A [
Binding energy between INH and katG both WT and R2
| Energy Component | Energy (kcal/mole) | |
|---|---|---|
| KatG WT | KatG R2 | |
| VDWAALS | -15.8981 ± 1.6596 | -18.7344 ± 1.6055 |
| EEL | -33.0993 ± 3.1106 | -13.3143 ± 2.8692 |
| EGB | 33.3649 ± 1.7621 | 20.2007 ± 2.2141 |
| ESURF | -2.8284 ± 0.0676 | -2.9871 ± 0.0516 |
| DELTA G gas | -48.9975 ± 2.8595 | -32.0487 ± 2.7244 |
| DELTA G solv | 30.5365 ± 1.7874 | 17.2136 ± 2.2118 |
| Total binding free energy | ||
VDWAALS = van der Waals force; EEL = electrostatic energy; EGB = electrostatic contribution to the solvation free energy; ESURF = nonpolar contribution to the solvation free energy