Development and characterization of polymorphic EST-SSR markers for Paphiopedilum henryanum (Orchidaceae).

PREMISE OF THE STUDY: Microsatellite primers were developed for Paphiopedilum henryanum (Orchidaceae), a species threatened with extinction, to assess genetic diversity and population genetic structure. METHODS AND
RESULTS: Based on the transcriptome data of P. henryanum, 34 novel polymorphic microsatellite expressed sequence tag-simple sequence repeat markers were developed and characterized in 33 individuals from two P. henryanum populations. The results showed the number of alleles per locus ranged from two to four, and levels of observed and expected heterozygosity per locus ranged from 0.000 to 1.000 and from 0.000 to 0.7333, respectively. Of these markers, some primers showed good amplification results in seven other Paphiopedilum species.
CONCLUSIONS: The developed microsatellite markers will be useful in exploring the genetic diversity and structure of P. henryanum. Furthermore, most loci were successfully cross-amplified in seven other species of Paphiopedilum, indicating that they will be of great value for genetic study across this genus.

Orchidaceae is a diverse family of flowering plants that is widely known among botanists and horticulturalists for its often showy, fragrant flowers with varied morphologies. One genus within Orchidaceae, Paphiopedilum Pfitzer (subfamily Cypripedioideae), are characterized as lady’s slipper orchids because of their floral morphology, with 96 accepted species (Cox et al., 1997; Guo et al., 2015). Paphiopedilum has attracted attention from hobbyists and biologists because of its specialized floral traits and the mode of pollination by deceit. Recently, populations of Paphiopedilum have faced a rapid decline, becoming endangered as a result of its narrow distribution, climate change, habitat loss, and overcollection for their beautiful, unique flowers (Zhang et al., 2016). All species within this genus are listed in Appendix I of the Convention on International Trade in Endangered Species (CITES, https://cites.org/; Sun et al., 2011), thus these species cannot be traded internationally for primarily commercial purposes (Zeng et al., 2012). Paphiopedilum henryanum Braem is distributed in crevices of shady cliffs or rocks and well‐drained habitats in the mountains along the Sino‐Vietnamese border. The natural range of P. henryanum, a popular ornamental, has declined significantly as a result of habitat destruction and excessive collection. Therefore, genetic information, such as genetic diversity and population structure, is important for the conservation of this species.

Microsatellites or simple sequence repeat (SSR) markers can be identified using genomes or transcriptomes; they have become one of the most important genetic markers in plant genetic analyses because of their hypervariability, multiallelic nature, codominant inheritance, and reproducibility (Powell et al., 1996). Expressed sequence tag (EST)–SSRs are a part of genes, and may help to predict candidate functional genes (Varshney et al., 2005). Li et al. (2010) isolated 10 polymorphic microsatellite loci from genomes in P. concolor (Bateman) Pfitzer (Paphiopedilum subgen. Brachypetalum). We verified that only two markers can be successfully amplified in P. henryanum (subgen. Paphiopedilum). This poor amplification could be the result of the large genetic distance between P. henryanum and P. concolor, as the species are not in the same subgenus. Moreover, microsatellite markers have not yet been developed from transcriptomes for Paphiopedilum or for the identification and assessment of the genetic diversity of P. henryanum. In this study, we developed 34 novel microsatellite markers for P. henryanum. These 34 polymorphic markers were tested on 33 individuals from two populations of P. henryanum, and their transferability was tested in seven other Paphiopedilum species, which were selected according to the infrageneric classification (Lang et al., 2006) and the DNA barcoding of Paphiopedilum (Guo et al., 2016).

METHODS AND RESULTS

Floral organs of P. henryanum were gathered from the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences (Appendix 1), immediately frozen in liquid nitrogen, and then stored at −80°C. Complete floral organs were sent to the Novogene Technology Co. (Beijing, China) to extract RNA and construct a cDNA library. Transcriptome sequencing was conducted using an Illumina HiSeq 2000 (Illumina, San Diego, California, USA). The raw data were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRP131426, PRJNA431671). Then, the MIcroSAtellite identification tool (MISA; Thiel et al., 2003) was used to screen for SSR motifs from all unigenes, and the minimum numbers of repeats were set as seven, five, five, five, and five for di‐, tri‐, tetra‐, penta‐, and hexanucleotide repeats, respectively. MISA recovered a total of 25,255 SSR motifs, with mononucleotide repeats (15,543, 61.54%) being the most common, followed by dinucleotide (6238, 24.70%), trinucleotide (2313, 9.16%), complex repetitive type (1039, 4.11%), tetranucleotide (97, 0.38%), hexanucleotide (16, 0.06%), and pentanucleotide (9, 0.04%) repeats. Primer3 software (Untergasser et al., 2012) was used to design primer pairs with lengths of 17–24 bases, PCR product size ranging from 100–350 bp, and annealing temperatures of 55–62°C; 906 primer pairs were designed. We then initially screened 129 pairs using two P. henryanum individuals (Appendix 1).

Paphiopedilum henryanum is distributed in Malipo and Maguan counties in Yunnan Province, China (Lang et al., 2006). During our field investigation, we found only two wild populations in Malipo County: Danong (DN) and Taiyangchong (TYC). Paphiopedilum henryanum has become locally extinct in locations recorded in previous literature, including Dulong and Shanche in Maguan County, Tusicheng in Wenshan County, and Liangzicun in Xichou County. Harvesting leaves can minimize damage to plants, thus we collected leaf tissue from 25 individuals from the DN population and eight individuals from the TYC population (Appendix 1). Genomic DNA was extracted using the cetyltrimethylammonium bromide (CTAB) method (Allen et al., 2006). PCR amplifications were performed in 20‐μL reaction mixtures containing 0.5 units of Taq polymerase (TaKaRa Biotechnology Co., Dalian, China), 2 μL of 10× PCR buffer (200 mM Tris‐HCl [pH 8.8], 100 mM (NH4)2SO4, 100 mM KCl, 1% Triton X‐100, 20 mM MgSO4), 1.6 μL of dNTPs (2.5 mM each), 0.5 μL of each primer (10 μM), and 1 μL of genomic DNA (~30–50 ng/μL). PCR conditions comprised an initial denaturing step at 94°C for 5 min; followed by 10 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 40 s; 15 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 40 s; 10 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 40 s; and a final extension at 72°C for 7 min. PCR products were electrophoresed on 8% polyacrylamide denaturing gel and visualized using silver staining. Polymorphisms of these 129 loci were evaluated using the 33 P. henryanum individuals from the DN and TYC populations; we obtained 34 polymorphic EST‐SSR markers (Table 1), and the other 95 loci did not amplify well. The efficiency of the 34 polymorphic markers in cross‐species amplification was tested.

Table 1

Characteristics of 34 polymorphic microsatellite loci developed for Paphiopedilum henryanum

Locus	Primer sequences (5′–3′)	T a (°C)	Repeat motif	Allele size range (bp)	GenBank accession no.	Putative function [organism] (BLAST)	E‐value
PH_SSR011	F: CGAAGCACGGGTCTCTTTCT	60	(TTC)7	107	MG333695	—	—
	R: ACCACCGACATTACCTGCAG
PH_SSR025	F: AATTTCTTCCAGGAGGGCGG	60	(GACA)5	101	MG333696	—	—
	R: TCGGCTGTCCATGCTTGTAG
PH_SSR026	F: TCATCCCTTCATCCCGAGGT	60	(ACG)6	248	MG333697	PREDICTED: uncharacterized LOC110115938 [Dendrobium catenatum]	2E‐37
	R: TCCCCATGCTCGAAGCTTTT
PH_SSR041	F: CTGCTAGCCTGAGGAGAACG	60	(CTC)7	101	MG333698	PREDICTED: uncharacterized LOC110098091 [Dendrobium catenatum]	0
	R: CAAGAAACCCCCACCTCCTC
PH_SSR060	F: TACCTCCATCACTCTCGCCT	60	(AC)10	127	MG333699	—	—
	R: TTGCTCGCCTTTTTGACAGC
PH_SSR172	F: GGCCAAGTACATGCACCCAT	60	(GCC)6	278	MG333700	PREDICTED: nuclear transcription factor Y subunit B‐1‐like LOC110037676 [Phalaenopsis equestris]	8E‐95
	R: TTCCCACCTCGGTTATGCAC
PH_SSR272	F: GCAAATCCATTCAGCCCTGC	60	(CAG)6	193	MG333701	PREDICTED: probable WRKY transcription factor 21 LOC110107315 [Dendrobium catenatum]	0
	R: CGACATGGTCTGAGAGGAGC
PH_SSR334	F: CACTGGGGGATCTTCGAAGG	60	(GCG)7	185	MG333702	PREDICTED: protein LURP‐one‐related 8‐like LOC110034281 [Phalaenopsis equestris]	1E‐56
	R: CAGCACCTCTTCGCGTAAGA
PH_SSR343	F: CTTGGGACTCTTTCCTCGGC	60	(AGA)6	250	MG333703	PREDICTED: uncharacterized LOC110096658 [Dendrobium catenatum]	3E‐71
	R: CCAGGAGGCTCTCAGCTTTC
PH_SSR351	F: CTCCCAATCTCCACCGACAA	60	(CGG)6	259	MG333704	PREDICTED: scarecrow‐like protein 15 LOC110024574 [Phalaenopsis equestris]	3E‐33
	R: TGGATCCCAGGGAAGGTAGG
PH_SSR356	F: TGCAGATGAGCCCATGCATT	60	(GAA)6	260	MG333705	PREDICTED: uncharacterized LOC110100801 [Dendrobium catenatum]	0
	R: TCACGCCTGTATTTCTGCGT
PH_SSR372	F: TTGATTGGCGCAGTGAAAGC	60	(GGC)6	266	MG333706	PREDICTED: uncharacterized LOC110101380 [Dendrobium catenatum]	5E‐141
	R: CCACTGATCGCAGACCATCA
PH_SSR376	F: GGCACTTACAGCAAGGCTCT	60	(CTG)6	102	MG333707	PREDICTED: uncharacterized LOC110109757 [Dendrobium catenatum]	4E‐80
	R: GAGACCTGGGCCCATCAAAA
PH_SSR383	F: ACGCGGCAAAAATGATGAGG	59	(TCA)6	100	MG333708	PREDICTED: ras GTPase‐activating protein‐binding protein 1‐like LOC110103447 [Dendrobium catenatum]	7E‐40
	R: AGGAGGGTTCATGCAGTAGT
PH_SSR413	F: CAGGCTCCAAAACAAGGCAC	60	(CAG)7	263	MG333709	PREDICTED: uncharacterized LOC110096393 [Dendrobium catenatum]	1E‐98
	R: GGGACTGGGGAGTAAAAGGC
PH_SSR416	F: CAGGTTGACAGCAATGTCGC	60	(CCG)6	188	MG333710	PREDICTED: G‐type lectin S‐receptor‐like serine/threonine‐protein kinase SD2‐2 LOC110111128 [Dendrobium catenatum]	0
	R: GCCGCAGCTTTTCGGATAAG
PH_SSR425	F: AGTAGAGGATCTGGTCAACGGA	60	(CAT)7	240	MG333711	—	—
	R: TGCAAGGTTCTAGAGTGCATGA
PH_SSR426	F: AGCGTGTTTGGACTAGAGCA	60	(AAAC)5	239	MG333712	—	—
	R: TCGGGGATGCACATGGAAAA
PH_SSR430	F: GCTCCATAGCTGGCGATCAT	60	(GA)9	157	MG333713	PREDICTED: phosphoribosylformylglycinamidine cyclo‐ligase, chloroplastic/mitochondrial LOC110097203 [Dendrobium catenatum]	0
	R: TCTTTCTGACGGCGCAAGAT
PH_SSR447	F: GGGTGGGGAGAGTAGGAGTT	60	(CGG)6	219	MG333714	PREDICTED: probable serine/threonine‐protein kinase PBL21 LOC110111545 [Dendrobium catenatum]	7E‐128
	R: GCCACAACTTGTTTTCCCGG
PH_SSR535	F: TTCGTCCTCACTTCTTCGCC	60	(CCT)6	157	MG333715	PREDICTED: uncharacterized LOC110108101 [Dendrobium catenatum]	3E‐177
	R: GAAGAGGAGATGGCTCGTGG
PH_SSR547	F: CCACGTGTGACAGAATCCCA	60	(CGT)6	235	MG333716	PREDICTED: probable aspartyl protease At4g16563 LOC110106324 [Dendrobium catenatum]	0
	R: GGCTCCCGACGAGGAATTAC
PH_SSR548	F: TCAACAAGGACGGGTTGGTC	60	(ATC)6	176	MG333717	—	—
	R: TTGATGTGGCACAAGCACAC
PH_SSR592	F: AGAGAAGGAGCACCAATGGC	60	(GCT)6	230	MG333718	PREDICTED: scarecrow‐like protein 27 LOC110031666 [Phalaenopsis equestris]	2E‐76
	R: CTTCGATGGATCATGGGCGA
PH_SSR645	F: CCACCAGCTTTCATATCCTCCA	60	(ATC)6	231	MG333719	PREDICTED: uncharacterized LOC110103522 [Dendrobium catenatum]	9E‐06
	R: GCCCATGCTGTGCAAAAAGA
PH_SSR651	F: AAGAAGTGGCTTCCATGGCA	60	(TCT)6	215	MG333720	PREDICTED: NAC domain‐containing protein 92‐like LOC110029752 [Phalaenopsis equestris]	4E‐59
	R: GCAAAACCAAGGTGTCGTCC
PH_SSR658	F: AGCCAACACAGCCACGATAA	60	(GCT)7	190	MG333721	—	—
	R: AAGAACCATCACCACCACCC
PH_SSR669	F: CAAACCTCGCTCGGAAGACT	60	(TCGAC)6	259	MG333722	PREDICTED: RNA polymerase II C‐terminal domain phosphatase‐like 3 LOC110024905 [Phalaenopsis equestris]	0
	R: AGGGTTTCTATCGCTTGGCC
PH_SSR687	F: GCTGCCAATTCGAATGGAGG	60	(GGC)6	203	MG333723	—	—
	R: GCTGCCGATTCTCCTTCCTT
PH_SSR698	F: GAAAACCGATTGGCGTCGAG	60	(GA)9	192	MG333724	PREDICTED: protein SCO1 homolog 1, mitochondrial LOC110110179 [Dendrobium catenatum]	0
	R: TTCCCTTCTCCCATTTCCGG
PH_SSR716	F: AGCTATGAGGAACTGCGCTG	60	(GGC)6	182	MG333725	PREDICTED: calcium uniporter protein 2, mitochondrial‐like LOC110093017 [Dendrobium catenatum]	2E‐118
	R: TGTTGACATGATCCGTGGCA
PH_SSR800	F: AGCTTGAAGTACTTGGGGGC	60	(TGG)8	146	MG333726	PREDICTED: uncharacterized LOC110021639 [Phalaenopsis equestris]	0
	R: TCCACCTTCTCCTCCTCACT
PH_SSR809	F: CCTTCCTCATGATCCGTCCG	60	(CGC)6	159	MG333727	PREDICTED: nuclear transcription factor Y subunit B‐1‐like LOC110036525 [Phalaenopsis equestris]	4E‐70
	R: TTAGCTCTCTCCCCTCCGAG
PH_SSR877	F: GGCGATTGACCTCTGCTGAT	60	(CGC)6	217	MG333728	PREDICTED: probable WRKY transcription factor 27 LOC110105927 [Dendrobium catenatum]	8E‐96
	R: TCGGCTTTGGTTGCTGAGAT

— = not found (E‐value >10−6); T a = annealing temperature.

The 34 polymorphic SSR markers were analyzed using the software POPGENE 32 (version 1.32; Yeh, 1997) to calculate the average number of alleles, observed heterozygosity, expected heterozygosity, and likelihood ratio test for Hardy–Weinberg equilibrium. The number of alleles per locus ranged from two to four alleles, with a mean of 2.32 alleles per locus. The levels of observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.000 to 0.7333, with averages of 0.3808 and 0.3636, respectively. Nine loci in the DN population and six loci in the TYC population showed significant deviation from Hardy–Weinberg equilibrium (Table 2). Cross‐species amplification of the 34 polymorphic markers was tested in seven related species (five individuals for each population; Appendix 1), and some markers were successfully cross‐amplified in P. villosum (Lindl.) Stein (29, 85.29%), P. hirsutissimum (Lindl. ex Hook. f.) Stein (28; 82.35%), P. venustum (Sims) Pfitzer (28, 82.35%), P. wardii Summerh. (25, 73.53%), P. dianthum Tang & F. T. Wang (23, 67.65%), P. concolor (19, 55.88%), and P. micranthum Tang & F. T. Wang (19, 55.88%; Table 3).

Table 2

Polymorphism of the 34 EST‐SSRs in two populations of Paphiopedilum henryanum.a

	Danong population (N = 25)			Taiyangchong population (N = 8)
Locus	A	H o	H e b	A	H o	H e b
PA_SSR011	2	0.160	0.150	2	0.250	0.500
PA_SSR025	1	0.000	0.000	3	0.500	0.433
PA_SSR026	3	0.160	0.222*	2	0.125	0.458*
PA_SSR041	3	0.560	0.448	2	0.125	0.125
PA_SSR060	3	1.000	0.637	3	1.000	0.633*
PA_SSR172	2	0.160	0.327*	3	0.375	0.425
PA_SSR272	2	0.480	0.372	3	0.250	0.242
PA_SSR334	3	0.174	0.165	2	0.500	0.400
PA_SSR343	2	0.640	0.509	2	0.375	0.325
PA_SSR351	3	0.160	0.571**	1	0.000	0.000
PA_SSR356	2	0.280	0.246	2	0.250	0.233
PA_SSR372	1	0.000	0.000	2	0.125	0.525*
PA_SSR376	2	0.800	0.490**	2	0.125	0.525*
PA_SSR383	3	0.625	0.592	3	0.625	0.508
PA_SSR413	2	0.040	0.040	2	0.625	0.458
PA_SSR416	2	0.320	0.274	2	0.500	0.400
PA_SSR425	2	0.440	0.393	3	0.125	0.342
PA_SSR426	2	0.400	0.327	2	0.250	0.233
PA_SSR430	2	0.640	0.444**	2	0.500	0.400
PA_SSR447	2	0.080	0.078	1	0.000	0.000
PA_SSR535	3	0.280	0.365	3	1.000	0.675
PA_SSR547	2	0.240	0.216	2	0.500	0.400
PA_SSR548	2	0.440	0.350	3	0.750	0.575
PA_SSR592	2	0.120	0.115	2	0.125	0.125
PA_SSR645	1	0.000	0.000	2	0.500	0.400
PA_SSR651	3	0.640	0.456	3	0.500	0.425
PA_SSR658	2	0.160	0.150	4	0.750	0.733*
PA_SSR669	2	0.200	0.184	2	0.125	0.125
PA_SSR687	2	0.360	0.301	2	0.375	0.325
PA_SSR698	3	0.958	0.627**	3	0.625	0.542
PA_SSR716	3	0.520	0.438	1	0.000	0.000
PA_SSR800	4	0.640	0.693**	4	0.375	0.592
PA_SSR809	3	0.320	0.610**	3	0.500	0.625*
PA_SSR877	3	0.800	0.505**	3	0.500	0.508

A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; N = total number of samples analyzed.

Voucher and locality information are provided in Appendix 1.

Likelihood ratio test for Hardy–Weinberg equilibrium: *P < 0.05, **P < 0.01.

Table 3

Cross‐amplification of the 34 polymorphic EST‐SSR markers developed for Paphiopedilum henryanum in seven other species of Paphiopedilum.a

Locus	P. villosum	P. hirsutissimum	P. venustum	P. wardii	P. dianthum	P. concolor	P. micranthum
PH_SSR011	+	+	+	+	+	+	—
PH_SSR025	+	—	+	—	—	—	—
PH_SSR026	—	+	+	+	—	—	—
PH_SSR041	+	+	+	—	—	—	+
PH_SSR060	+	—	+	—	—	—	—
PH_SSR172	+	—	+	—	+	+	—
PH_SSR272	—	+	+	+	+	+	+
PH_SSR334	+	+	+	+	+	+	—
PH_SSR343	+	+	—	+	+	+	—
PH_SSR351	+	—	+	+	—	—	+
PH_SSR356	—	+	+	+	—	+	+
PH_SSR372	+	+	+	+	+	—	+
PH_SSR376	+	+	+	+	+	—	—
PH_SSR383	+	+	+	+	—	+	+
PH_SSR413	+	+	+	+	—	—	+
PH_SSR416	+	+	+	+	+	+	—
PH_SSR425	+	+	—	—	—	—	+
PH_SSR426	+	+	—	+	—	—	+
PH_SSR430	+	—	+	+	+	+	—
PH_SSR447	+	+	+	+	+	—	—
PH_SSR535	+	+	+	+	+	+	+
PH_SSR547	+	+	+	—	+	+	+
PH_SSR548	+	+	+	—	+	+	—
PH_SSR592	+	+	+	+	+	+	+
PH_SSR645	+	+	+	+	+	—	+
PH_SSR651	+	+	+	+	+	+	+
PH_SSR658	+	+	+	+	+	+	—
PH_SSR669	—	+	—	+	+	—	—
PH_SSR687	+	+	—	+	—	—	+
PH_SSR698	+	—	—	—	+	+	—
PH_SSR716	+	+	+	+	+	+	+
PH_SSR800	—	+	+	—	+	+	+
PH_SSR809	+	+	+	+	+	—	+
PH_SSR877	+	+	+	+	+	+	+

+ = successful amplification in all individuals; — = unsuccessful amplification.

Locality and voucher information are provided in Appendix 1.

CONCLUSIONS

The 34 microsatellite markers described here are the first developed from the P. henryanum transcriptome. These newly described markers are likely to be useful for evaluating the genetic diversity and population structure, as well as for facilitating the development of a conservation strategy for P. henryanum, a species that is increasingly threatened by habitat destruction. In addition, the cross‐amplification of these microsatellite loci in seven other species suggests that these 34 markers have good transferability among other Paphiopedilum species, especially in Paphiopedilum subgen. Paphiopedilum. Therefore, the effective amplification ratio of EST‐SSR markers increases with decreased genetic distance.

Species	Population	Voucher no.	Collection locality	Geographic coordinates	N
P. henryanum Braema	Cultivated	Zhou IVF151008PH	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	1
P. henryanum b	Cultivated	Xu IVF170513PH	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	8
P. henryanum b	DY	Jia and Zhou DY130901PH	Danong, Yunnan, China	—	25
P. henryanum b	TYC	Jia and Zhou TYC130903PH	Taiyangchong, Yunnan, China	—	8
P. concolor (Bateman) Pfitzerc	Cultivated	Xu IVF171009PC	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5
P. dianthum Tang & F. T. Wangc	Cultivated	Xu IVF171009PD	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5
P. hirsutissimum (Lindl. ex Hook. f.) Stein	Cultivated	Xu IVF171009PVe	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5
P. micranthum Tang & F. T. Wangc	Cultivated	Xu IVF171009PM	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5
P. venustum (Sims) Pfitzerc	Cultivated	Xu IVF171009PVe	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5
P. villosum (Lindl.) Steinc	Cultivated	Xu IVF171009PVi	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5
P. wardii Summerh.c	Cultivated	Xu IVF171009PW	CAAS, Beijing, China	39°57′43.94″N,116°19′35.65″E	5

CAAS = Chinese Academy of Agricultural Sciences; N = number of individuals sampled.

Samples used for cDNA library construction.

Samples used for initial PCR amplification trials and detailed evaluation for polymorphisms.

Samples used for transferability test.