Literature DB >> 30127627

Antibiotic resistance pattern and molecular characterization of extended-spectrum β-lactamase producing enteroaggregative Escherichia coli isolates in children from southwest Iran.

Mansour Amin1,2, Mehrandokht Sirous2, Hazhir Javaherizadeh3,4,5, Mohammad Motamedifar6,7, Morteza Saki2,8, Hojat Veisi2, Saeedeh Ebrahimi1,9, Sakineh Seyed-Mohammadi2,8, Mohammad Hashemzadeh1,2.   

Abstract

INTRODUCTION: Enteroaggregative Escherichia coli (EAEC) has been implicated as an emerging cause of traveler's diarrhea, persistent diarrhea among children, and immunocompromised patients. The present study aimed to investigate the prevalence of antibiotic resistance, extendedspectrum β-lactamase (ESBL) production, and virulence factors of EAEC isolates obtained from Iranian children suffered from diarrhea.
MATERIALS AND METHODS: In this cross-sectional study, from March 2015 to February 2016, 32 EAEC isolates were collected from fecal samples of children aged <12 years with diarrhea in southwest of Iran. All EAEC isolates identified using phenotypic and molecular methods and the cell line adhesion assay. Antimicrobial susceptibility testing was determined using disk diffusion method. The presence of virulence factors and ESBL resistance genes were determined by polymerase chain reaction.
RESULTS: Overall, 28.1% (9/32) of the isolates were positive for at least one of virulence genes. The most frequent gene was aap with a frequency of 96.9%. Neither aafA nor aggA gene was detected among all of the EAEC isolates. Antimicrobial susceptibility testing revealed the highest resistance rate to ampicillin (100%) and co-trimoxazole (100%), followed by ceftriaxone (81.3%). Further analysis revealed that the rate of ESBLs-producing isolates was 71.9% (23/32). Polymerase chain reaction screening revealed that 87.5% and 65.5% of EAEC isolates were positive for blaTEM and blaCTX-M genes, respectively, and 17 (53.1%) of isolates contained both blaTEM and blaCTX-M genes.
CONCLUSION: The high detection rate of ESBL-producing EAEC isolates accompanied with virulence genes highlights a need to restrict infection control policies in order to prevent further dissemination of the resistant and virulent EAEC strains.

Entities:  

Keywords:  ESBLs; Iran; adherence; antibiotic resistance; diarrhea; enteroaggregative Escherichia coli

Year:  2018        PMID: 30127627      PMCID: PMC6089113          DOI: 10.2147/IDR.S167271

Source DB:  PubMed          Journal:  Infect Drug Resist        ISSN: 1178-6973            Impact factor:   4.003


Introduction

Acute diarrheal diseases are an important health problem among children and are among the commonest causes of death among infants and children in developing countries.1 About 70% of cases of acute diarrheal illness occurs in the first 5 years of life. Pathogenic bacteria and viruses are responsible for ~20% of the episodes of acute gastroenteritis in children.2,3 Among the bacterial pathogens, diarrheagenic Escherichia coli (DEC) is a common cause of acute infectious diarrhea.4 DECs are classified into six groups based on clinical associations, phenotypic assays, and virulence factors: enteroaggregative E. coli (EAEC), diffusely adherent E. coli, enteroinvasive E. coli, enteropathogenic E. coli, enterohemorrhagic E. coli, and enterotoxigenic E. coli.4 EAEC has been implicated as an emerging cause of traveler’s diarrhea and persistent diarrhea among children and immunocompromised patients in both developing and developed countries.5 EAEC has also been associated with chronic intestinal inflammation, leading to malnutrition and growth retardation in infants.6 The pathogenesis of EAEC infection involves the adherence of the bacterium to the intestinal mucosa, forming a mucoid biofilm, and induces toxic effects on the intestinal mucosa, which result in diarrhea.7 The identification of EAEC depends on the HEp-2 adherence test, in which EAEC strains exhibit a “stacked-brick” appearance in a characteristic aggregative adherence (AA) pattern.7 The majority of EAEC strains carry a large (100-kb) plasmid, which encodes most putative EAEC virulence factors, including fimbrial adhesins, designated AA fimbria I (AAF/I, encoded by aggA gene), and AA fimbria II (AAF/II; encoded by aafA gene), which are responsible for the AA phenotype.8 The other plasmid-borne virulence factors include the enteroaggregative heat stable toxin (EAST; encoded by astA gene), dispersin secretory protein (encoded by aap gene), and plasmid-encoded toxin (Pet).8 In general, the first-choice agents for the treatment of EAEC infections are β-lactams, sulfonamides, and quinolones.9 However, in the recent years, therapeutic options are limited due to the emergence of E. coli strains resistant to third-generation cephalosporins, associated with the production of extended-spectrum β-lactamases (ESBLs).10 Bacterial strains producing ESBLs enzymes (TEM-1, SHV- 1, and CTX-M-type) inactivate the drugs by hydrolyzing the b-lactam ring.10 The ESBL encoding genes are located on large plasmids, which can carry the genes for resistance to numerous other groups of antimicrobials. Thus, worldwide dissemination of plasmid-borne ESBLs among E. coli isolates is a global problem.10 The objectives of the present study was to investigate the prevalence of EAEC strains, virulence factors, antibiotic resistance, and ESBL production in children suffering from diarrhea in Ahvaz, southwest Iran.

Materials and methods

Ethics

The study was approved by the Research Ethics Committee of the Ahvaz Jundishapur University of Medical Sciences (No: IR.AJUMS.REC.1395.462), Ahvaz, Iran. Written informed consent was obtained from all the children’s parents.

Study design and bacterial samples

In this cross-sectional study, from March 2015 to February 2016, 255 fecal samples were collected from children aged <12 years with diarrhea attending two teaching hospitals Golestan and Abuzar Children’s Hospital, affiliated to Ahvaz Jundishapur University of Medical Sciences, southwest of Iran. The specimens were cultured on MacConkey agar and incubated at 37°C for 24 h. Subsequently, E. coli isolates were identified using standard microbiologic methods including Gram-staining, colony characteristics and reaction on Triple Sugar Iron agar, Simmons’ citrate agar, Christensen’s urea agar, Indole test, Methyl red, and Voges-Proskauer tests. The strains that confirmed as E. coli were stored in tripticase soy broth with 15% glycerol at −70°C for long preservation. E. coli strains were then screened for EAEC identification using molecular method and cell line adhesion assay.

DNA extraction and molecular assay

Genomic DNA was extracted from all E. coli isolates by boiling method as described previously11 and subjected to polymerase chain reaction (PCR) after evaluating concentration and quality by measuring the absorbance of A260 and A280 nm with spectrophotometer and agarose gel electrophoresis, respectively. E. coli isolates were confirmed as EAEC by the amplification of aggR gene as previously described.12 Subsequently, the presence of five virulence factors were determined by assessing the presence of pCVD, aggA, ast, aap, and aafA genes.13 Moreover, the presence of ESBL resistance genes, blaTEM, blaER, blaCTX-M, and blaSHV were determined by specific primers.14 Gene control strains were prepared from National E. coli Reference Laboratory, Pasteur Inestitute of Iran. The targeted genes and nucleotide sequences of the oligonucleotide primers used in this study were chosen as described in Table 1. PCR amplifications of the study genes were carried out in the following condition: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 60 s, annealing for 45 s (temperature was depending on the sequence of primers), extension at 72°C for 50 s and final extension at 72°C for 5 min. PCR amplifications for studied genes were carried out on a thermal cycler 5530 (Eppendorf master, Germany). The amplicons were separated on 1.5% agarose gel prepared in 1× TAE (Tris/Acetate/EDTA) buffer and visualized using ultraviolet light after staining with ethidium bromide (CinnaGen Co., Tehran, Iran).
Table 1

List of used primers in the present study

PrimerOligonucleotide sequence (5′ to 3′)GeneProduct sizeAnnealingReference
pCVD-FCTGGCGAAAGACTGTATCATpCVD4326305713
pCVD-RAATGTATAGAAATCCGCTGTT
aggR-FGTATACACAAAAGAAGGAAGCaggR2545713
aggR-RACAGAATCGTCAGCATCAGC
aggA-FTTAGTCTTCTATCTAGGGaggA4574913
aggA-RAAATTAATTCCGGCATGG
aafA-FTGCGATTGCTACTTTATTATaafA2425613
aafA-RATTGACCGTGATTGGCTTCC
aap-FCTTGGGTATCAGCCTGAATGaap3105813
aap-RAACCCATTCGGTTAGAGCAC
astA-FCCATCAACACAGTATATCCGAastA1115813
astA-RGGTCGCGAGTGACGGCTTTGT
TEM-FGAGTATTCAACATTTCCGTGTCblaTEM8006014
TEM-RTAATCAGTGAGGCACCTATCTC
PER-FAATTTGGGCTTAGGGCAGAABlaPER9254814
PER-RATGAATGTCATTATAAAAGC
CTX-M-FCGCTTTGCGATGTGCAGBlaCTX-M5506014
CTX-M-RACCGCGATATCGTTGGT
SHV-FCGCCTGTGTATTATCTCCCTGTTAGCCBlaSHV8436214
SHV-RTTGCCAGTGCTCGATCAGCG

Adhesion to HEp-2 cells

All of the E. coli isolates positive for the presence of aggR gene were confirmed as EAEC by aggregative adhesion to HEp-2 cells by a method described previously.15 Briefly, an overnight culture of E. coli was prepared, and then, a concentration of 107 bacteria was incubated with monolayers of HEp-2 cells grown to 50% confluence on circular cover slips in wells of 24-well tissue culture plates. After 0.5-1 h of incubation at 37°C in 5% CO2, the wells were gently washed three times with phosphate-buffered saline, and then, 200 µL of Dulbecco’s minimum essential medium was added to each well, and the cultures were incubated at 37°C for 3 h in 5% CO2. Fixation was done by 70% ethanol and stained with Giemsa stain. The aggregative adhesion was examined under the oil immersion lens of a light microscope. The HEp-2 cell lines were purchased from Razi Vaccine and Serum Research Institute, Karaj, Iran.

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing was carried out on all EAEC isolates to 14 antibiotics by standard disk diffusion method on Mueller-Hinton agar medium (EMD Millipore, Billerica, MA, USA) as described by the Clinical and Laboratory Standards Institute (CLSI) guidelines.16 The antimicrobial agents used were gentamicin (10 µg), amikacin (30 µg), ciprofloxacin (5 µg), cefoxitin (30 µg), ceftazidime (30 µg), cefotaxime (30 µg), cefpodoxime (10 µg), ampicillin (10 µg), meropenem (10 µg), imipenem (10 µg), tetracycline (30 µg), cefteriaxone (30 µg), trimethoprim/sulfamethoxazole (25 µg), and azithromycin (15 µg). E. coli ATCC 25922 strain was used for quality control purposes. Multiple-drug-resistant (MDR) isolates (resistant to three or more of antimicrobials) were estimated according to previously described definitions.17 All isolates were tested for ESBL production using the combined-disk test using ceftazidime (30 µg) and cefotaxime (30 µg) disks and combination with clavulanic acid (10 µg) disk as described by CLSI guidelines.16 E. coli ATCC 25922 and Klebsiella pneumoniae ATCC 700603 were used as negative and positive control strains for ESBL production, respectively.

Statistical analysis

The analysis was performed by using SPSS™ software, version 21.0 (IBM Corporation, Armonk, NY, USA). The results are presented as descriptive statistics in terms of relative frequency. Values are expressed as the percentages of the group (categorical variables). Chi-square or Fisher’s exact tests were used to determine the significance of differences. A difference was considered statistically significant if the p-value was <0.05.

Results

Virulance gene patterns and HEp-2 cell assay

Thirty-two EAEC isolated from 17 (53.1%) males and 15 (46.9%) females aged from 5 months to 11 years showed an overall prevalence of EAEC of 12.5% (32/255) in our region. All isolates were positive for aggR gene and adhered in a HEp-2 cell adherence assay in the AA pattern (Figure 1). The frequency of the detected virulence genes among EAEC isolates is shown in Table 2. The data revealed that 21 (65.6%), 7 (21.9%), and 31 (96.9%) of strains were positive for the pCVD, astA, and aap genes, respectively. The most frequent gene was aap with a frequency of 96.9%. Neither aafA nor aggA genes were detected among all of the EAEC isolates. Regarding to the coexistence of the virulence genes, our isolates showed three distinct virulence patterns (Table 2). The most prevalent combination was pCVD-aap, found in 21 (65.6%) strains. In 32 strains analyzed, six (18.7%) isolates were positive for astA-aap and four (12.5%) isolates were positive for pCVD-astA-aap genes.
Figure 1

The AA pattern of EAEC to HEp-2 cells after 3 h of incubation.

Abbreviations: EAEC, enteroaggregative Escherichia coli; AA, aggregative adherence.

Table 2

The distribution of virulence and extended-spectrum β-lactamase (ESBL) genes

Virulence genesPositive, N (%)Negative, N (%)
pCVD21 (65.6)11 (34.4)
aggA032 (100)
astA7 (21.9)25 (78.1)
aap31 (96.9)1 (3.1)
aafA032 (100)

Coexistence of virulence genesN (%)

astA-aap6 (18.7)
pCVD-aap21 (65.6)
pCVD-astA-aap4 (12.5)

ESBL genesPositive, N (%)Negative, N (%)

blaTEM28 (87.5)4 (12.5)
blaCTX-M21 (65.6)11 (34.4)
blaPER032 (100)
blaSHV032 (100)
blaTEM,blaCTX-M17 (53.1)15 (46.9)

Antibiotic resistance patterns and ESBL genes

The results of antimicrobial susceptibility testing of the 32 EAEC isolates to 14 antibiotics are summarized in Table 3.
Table 3

The antibiotic susceptibility testing results of 32 EAEC isolates

AntibioticTotal EAEC, N (%)
ESBL producing EAEC, N (%)
RISRIS
Gentamicin10 (31.2)022 (68.8)6 (26.1)017 (73.9)
Amikacin4 (12.5)1 (3.1)27 (84.4)3 (13)1 (4.3)19 (82.6)
Ciprofloxacin6 (18.8)1 (3.1)25 (78.1)5 (21.7)1 (4.3)17 (73.9)
Cefoxitin5 (15.6)027 (84.4)0023 (100)
Ceftazidime17 (53.1)4 (12.5)11 (34.4)12 (52.2)3 (13)8 (34.8)
Cefotaxime26 (81.3)06 (18.8)20 (87)03 (13)
Cefpodoxime26 (81.3)06 (18.8)20 (87)03 (13)
Cefteriaxon26 (81.3)1 (3.1)5 (15.6)21 (91.3)02 (8.7)
Ampicillin32 (100)0023 (100)00
Meropenem3 (9.4)3 (9.4)26 (81.3)1 (4.3)2 (8.7)20 (87)
Imipenem0032 (100)0023 (100)
Tetracycline15 (46.9)017 (53.1)7 (30.4)016 (69.6)
Trimethoprim/sulfamethoxazole32 (100)0023 (100)00
Azithromycin25 (78.1)07 (21.9)18 (78.3)05 (21.7)

Abbreviations: EAEC, enteroaggregative Escherichia coli, ESBL, extended-spectrum β-lactamase.

From 32 confirmed EAEC isolates, all of them (100%) were resistant to ampicillin and trimethoprim/sulfamethoxazole, followed by 26 (81.3%) to cefteriaxon, cefotaxime, and cefpodoxime, 25 (78.1%) to azithromycin, 17 (53.1%) to ceftazidime, 15 (46.9%) to tetracycline, 10 (31.2%) to gentamicin, 6 (18.8%) to ciprofloxacin, 5 (15.6%) to cefoxitin, 4 (12.5%) to amikacin, and 3 (9.4%) to meropenem. The results disclosed that the most effective antibiotic against EAEC isolates was imipenem with 100% susceptibility.

MDR profiles

According to the antimicrobial susceptibility testing, all 32 EAEC isolates were resistant to at least two antibiotics, and the majority of isolates (n=31, 96.9%) were MDR with 21 different patterns (Table 4). The most prevalent resistance profile was XII (12.5%) (cefotaxime-cefpodoxime-ampicillin-ceftriaxone-trimethoprim/sulfamethoxazole-azithromycin).
Table 4

Antibiotic resistance phenotypic patterns of EAEC isolates

Resistance patternPhenotypic resistanceNumber of resistant EAEC isolates (%)
IAMP-SXT1 (3.1%)
IIAMP-TET-SXT2 (6.2%)
IIIAMP-TET-SXT-AZM1 (3.1%)
IVGEN-CTX-CPDX-AMP-CRO-SXT-AZM1 (3.1%)
VGEN-CTX-CPDX-AMP-TET-SXT-AZM1 (3.1%)
VIGEN-AN-CIP-AMP-CRO-SXT-AZM1 (3.1%)
VIIGEN-CAZ-CTX-CPDX-AMP-CRO-SXT-AZM3 (9.3%)
VIIIGEN-CIP-CAZ-CTX-CPDX-AMP-CRO-SXT-AZM1 (3.1%)
IXGEN-FOX-CAZ-CTX-CPDX-AMP-CRO-TET-SXT-AZM1 (3.1%)
XGEN-FOX-CAZ-CTX-CPDX-MEM-AMP-CRO-TET-SXT-AZM2 (6.2%)
XICTX-CPDX-AMP-CRO-SXT1 (3.1%)
XIICTX-CPDX-AMP-CRO-SXT-AZM4 (12.5%)
XIIICTX-CPDX-AMP-CRO-TET-SXT-AZM2 (6.2%)
XIVAN-AMP-TET-SXT-AZM1 (3.1%)
XVAN-CAZ-CTX-CPDX-MEM-AMP-CRO-SXT1 (3.1%)
XVIAN-CAZ-CTX-CPDX-AMP-CRO-SXT-AZM1 (3.1%)
XVIICIP-CAZ-CTX-CPDX-AMP-CRO-SXT-AZM3 (9.3%)
XVIIICIP-FOX-CAZ-CTX-CPDX-AMP-CRO-TET-SXT-AZM1 (3.1%)
XIXCAZ-CTX-CPDX-AMP-CRO-TET-SXT2 (6.2%)
XXCAZ-CTX-CPDX-AMP-CRO-TET-SXT-AZM1 (3.1%)
XXIFOX-CAZ-CTX-CPDX-AMP-CRO-TET-SXT-AZM1 (3.1%)

Abbreviations: EAEC, enteroaggregative Escherichia coli; AMP, ampicillin; AN, amikacin; AZM, azithromycin; CTX, cefotaxime; CRO, ceftriaxone; CAZ, ceftazidime; CPDX, cefpodoxime; CIP, ciprofloxacin; FOX, cefoxitin; GEN, gentamicin; MEM, meropenem; SXT, trimethoprimsulfamethoxazole; TET, tetracycline.

Phenotypic results for ESBLs

The overall occurrence of ESBL-producing isolates was 71.9% (23/32) of EAEC. All isolates that were tested positive for ESBLs were also MDR. The results of antimicrobial susceptibility testing of the ESBL-producing EAEC isolates are summarized in Table 3.

Molecular assay of ESBL genes

PCR screening for the presence of ESBL genes showed that 28 (87.5%) and 21 (65.5%) of EAEC isolates were positive for blaTEM and blaCTX-M genes, respectively, and 17 (53.1%) of isolates contained both blaTEM and blaCTX- M genes. Neither blaSHV nor blaPER genes were detected among all of the EAEC isolates (Table 2). The detailed characteristics of all 32 studied EAEC isolates including virulence profile, MDR pattern, and ESBL production are summarized in Table 5.
Table 5

The detailed results of virulence genes, MDR, and ESBL gene patterns in the 32 EAEC isolates

EAEC No.Virulance gene profileMDR patternESBL phenotypeESBL gene patter
1pCVD-astA-aapIIPOSTEM, CTX-M
2pCVD-aapIVPOSTEM, CTX-M
3pCVD-aapIINEGTEM, CTX-M
4astAIXNEGTEM
5pCVD-aapXIIPOSCTX-M
6pCVD-aapXIVNEGTEM
7pCVD-aapXIPOSTEM, CTX-M
8pCVD-astA-aapXVPOSTEM, CTX-M
9astA -aapVNEGTEM
10pCVD-aapXVIIPOSCTX-M
11pCVD-aapI (not MDR)NEGTEM, CTX-M
12pCVD-aapXIXPOSTEM, CTX-M
13pCVD-aapXVIIPOSTEM, CTX-M
14pCVD-aapIIIPOSTEM
15aapXNEGTEM
16pCVD-aapXXPOSTEM, CTX-M
17pCVD-aapVIPOSTEM, CTX-M
18pCVD-aapVIIPOSTEM, CTX-M
19pCVD-aapVIIIPOSTEM
20aapXVIIINEGCTX-M
21pCVD-aapXVIIPOSTEM
22pCVD-astA-aapXIIIPOSTEM
23aapXXINEGTEM, CTX-M
24aapXIXPOSTEM, CTX-M
25aapXNEGTEM
26aapXIIPOSCTX-M
27astA -aapXIIPOSTEM, CTX-M
28aapXIIPOSTEM, CTX-M
29pCVD-astA-aapXIIIPOSTEM
30aapVIIPOSTEM, CTX-M
31pCVD-aapVIIPOSTEM
32pCVD-aapXVIPOSTEM,CTX-M

Abbreviations: EAEC, enteroaggregative Escherichia coli; ESBL, extended-spectrum β-lactamase; MDR, multiple-drug resistant.

Discussion

During the past decade, EAEC E. coli have been shown to cause persistent diarrhea and have received increasing attention globally.13 In addition to persistent diarrhea, EAEC have been isolated from acute sporadic cases and outbreaks worldwide, affecting children and adults.13,18 Previous studies have shown that EAEC strains are one of the most important agents of diarrhea in Iranian children.13,19 Our study also revealed EAEC as a cause of sporadic diarrhea. In this study, a total of 32 EAEC were isolated from 255 fecal specimens. The PCR results for the aggR gene disclosed good agreement with the HEp-2 cell adhesion assay, as 100% of aggR-positive isolates were confirmed as EAEC. Nowadays, different genes are used to recognize EAEC in molecular studies. One of them that is commonly used to detect EAEC by PCR includes aggR. In our research, the aggR PCR method compared to the HEp-2 cell culture assay indicated 100% sensitivity and 100% specificity. In the present study, three diverse combinations of the virulence genes were found among the EAEC isolates and 31 (96.9%) of them were positive for app gene (Table 2). Neither aafA nor aggA genes were found in our study. In this regard, Aslani et al in the west of Iran reported 11 different patterns of the virulence markers in EAEC isolates.13 However, in contrast to our results, Aslani et al showed the prevalence of aggA and aafA in EAEC isolates. 13 This might be due to epidemiologic differences between studied regions. A limitation of our study is that we only tried to search for the most common types of fimbriae. Our PCR targeted only AAFI and AAFII, but all isolates in this study were negative for these two fimbrial types indicating that the EAEC isolates in our region have fimbrial adhesins belonging to the other three established types or have novel types. In a study by Bouzari et al in the north of Iran, the prevalence of astA, aggA, and aafA among EAEC isolates obtained from children were reported as 8%, 38.8%, and 25%, respectively.19 Bafandeh et al in the north-west of Iran showed the prevalence of aap (88.6%), astA (83.5%), aggR (79.4%), aafA (46.4%), and aggA (5.1%) virulence determinants in EAEC isolates obtained from adult patients with diarrhea.21 As a general concept from Iranian results and reports from other parts of the world, EAEC are heterogeneous, and no virulence factor has been identified as common to all EAEC strains.8,13,19–25 Antimicrobial agents belonging to β-lactams family, particularly ampicillin and cephalosporins, and sulfonamides are widely used for the treatment of severe or persistent diarrhea in developing countries.9 However, the frequent use of these antimicrobial agents and the emergence of resistant strains have become a serious public health concern.25 In our results, similar to previous reports from developing countries, the majority of isolates were resistant to ampicillin, cephalosporins, and co-trimoxazole.3,13,26,27 In Iran, cephalosporins are widely used due to their low degree of side effects. The high incidence of resistance to these agents may be due to the inappropriate and widespread use of antibiotics. Hopefully, based on our results, carbapenems, aminoglycosides, and fluoroquinolones can be used as an alternative for the treatment of EAEC-associated diarrhea in our area. The emergence of MDR strains, particularly ESBL-producing Enterobacteriaceae is a global challenge for clinicians.28 In the present study, we observed a high frequency of MDR (96.9%) and ESBL (71.9%) EAEC isolates which were resistance to the most tested antimicrobial agents. This high level of resistance is justified by the availability of medications without doctors’ prescription from pharmacies in developing countries. Aslani et al closest to our findings showed the high rate of MDR EACE (71.4%) in Iranian children.13 Reports from other parts of the country showed the prevalence of ESBLs producing clinical isolates of E. coli ranging from 22% to 74%. The ESBL production in EAEC strains from two Asian countries China and Bangladesh was reported as 50% and 49.1%, respectively.23,29 The differences in the prevalence of ESBLs producing isolates can be due to dissimilarities in geographical distribution, sample types, studied population, and hospital or community origin of isolates. One of the major concern is the spread of ESBL-positive bacteria, which may mainly be due to the transfer of resistance genes via mobile genetic elements.10 ESBLs are enzymes most commonly derived from blaTEM or blaSHV, but the prevalence of bla types has risen recently.30 In our results, the genotype TEM was predominant with the prevalence of 87.5% followed by CTX-M type with 65.5%. The mechanisms of ESBL resistance in EAEC in Iran are poorly understood, and no similar study can be found. However, in agreement with our findings, several authors in our region showed the prevalence of blaCTX-M, blaSHV, and blaTEM as the main mechanisms responsible for ESBL production in clinical isolates of E. coli among Iranian patients.31–34 Meanwhile, some authors showed the global spread of bla, bla, and bla harboring DEC strains same as Iran.24,27,35,36

Conclusion

In this study, the high detection rate of MDR and ESBL producing EAEC isolates accompanied with virulence genes highlights a need to restrict infection control policies to prevent further dissemination of the resistant and virulent EAEC strains. Hopefully, several locally available antibiotics still have promising effects against MDR isolates in our region. These findings provide experimental evidence for safe and effective management of EAEC associated infections.
  34 in total

1.  Distribution of virulence related genes among enteroaggregative Escherichia coli isolates: using multiplex PCR and hybridization.

Authors:  S Bouzari; A Jafari; M Zarepour
Journal:  Infect Genet Evol       Date:  2005-01       Impact factor: 3.342

2.  Characterization of CTX-M-type extended-spectrum beta-lactamase-producing diarrheagenic Escherichia coli isolates in the Republic of Korea during 2008-2011.

Authors:  Jin Seok Kim; Junyoung Kim; Soo-Jin Kim; Se-Eun Jeon; Kyung Hwan Oh; Seung-Hak Cho; Yeon-Ho Kang; Soon Young Han; Gyung Tae Chung
Journal:  J Microbiol Biotechnol       Date:  2014-03-28       Impact factor: 2.351

3.  Characterization of enteroaggregative Escherichia coli (EAEC) clinical isolates and their antibiotic resistance pattern.

Authors:  Mohammad Mehdi Aslani; Mohammad Yousef Alikhani; Ali Zavari; Rasol Yousefi; Ali Reza Zamani
Journal:  Int J Infect Dis       Date:  2010-12-03       Impact factor: 3.623

4.  Antibiotic resistance in diarrheagenic Escherichia coli and Shigella strains isolated from children in Hanoi, Vietnam.

Authors:  Trung Vu Nguyen; Phung Van Le; Chinh Huy Le; Andrej Weintraub
Journal:  Antimicrob Agents Chemother       Date:  2005-02       Impact factor: 5.191

5.  CTX-M-15-producing multidrug-resistant enteroaggregative Escherichia coli in the United Arab Emirates.

Authors:  A Sonnevend; K Al Dhaheri; T Mag; M Herpay; J Kolodziejek; N Nowotny; A Usmani; F A Sheikh; T Pál
Journal:  Clin Microbiol Infect       Date:  2006-06       Impact factor: 8.067

Review 6.  Enteroaggregative Escherichia coli: an emerging enteric pathogen.

Authors:  David B Huang; Pablo C Okhuysen; Zhi-Dong Jiang; Herbert L DuPont
Journal:  Am J Gastroenterol       Date:  2004-02       Impact factor: 10.864

7.  Occurrence of SHV, TEM and CTX-M β-Lactamase Genes Among Enteropathogenic Escherichia coli Strains Isolated From Children With Diarrhea.

Authors:  Mojtaba Memariani; Shahin Najar Peerayeh; Taghi Zahraei Salehi; Seyyed Khalil Shokouhi Mostafavi
Journal:  Jundishapur J Microbiol       Date:  2015-04-18       Impact factor: 0.747

8.  Multidrug resistance in Escherichia coli strains isolated from infections in dogs and cats in Poland (2007-2013).

Authors:  Magdalena Rzewuska; Michał Czopowicz; Magdalena Kizerwetter-Świda; Dorota Chrobak; Borys Błaszczak; Marian Binek
Journal:  ScientificWorldJournal       Date:  2015-01-15

9.  Clonality, virulence and antimicrobial resistance of enteroaggregative Escherichia coli from Mirzapur, Bangladesh.

Authors:  Marie Anne Chattaway; Michaela Day; Julia Mtwale; Emma White; James Rogers; Martin Day; David Powell; Marwa Ahmad; Ross Harris; Kaisar Ali Talukder; John Wain; Claire Jenkins; Alejandro Cravioto
Journal:  J Med Microbiol       Date:  2017-09-25       Impact factor: 2.472

Review 10.  Management strategies in the treatment of neonatal and pediatric gastroenteritis.

Authors:  Simona Ciccarelli; Ilaria Stolfi; Giuseppe Caramia
Journal:  Infect Drug Resist       Date:  2013-10-29       Impact factor: 4.003

View more
  11 in total

1.  Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Drinking Water Samples From a Forcibly Displaced, Densely Populated Community Setting in Bangladesh.

Authors:  Zahid Hayat Mahmud; Mir Himayet Kabir; Sobur Ali; M Moniruzzaman; Khan Mohammad Imran; Tanvir Noor Nafiz; Md Shafiqul Islam; Arif Hussain; Syed Adnan Ibna Hakim; Martin Worth; Dilruba Ahmed; Dara Johnston; Niyaz Ahmed
Journal:  Front Public Health       Date:  2020-06-18

2.  Prevalence of Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae Causing Bloodstream Infections in Cancer Patients from Southwest of Iran.

Authors:  Effat Abbasi Montazeri; Azar Dokht Khosravi; Morteza Saki; Mehrandokht Sirous; Bijan Keikhaei; Sakineh Seyed-Mohammadi
Journal:  Infect Drug Resist       Date:  2020-05-06       Impact factor: 4.003

3.  Preliminary survey of extended-spectrum β-lactamases (ESBLs) in nosocomial uropathogen Klebsiella pneumoniae in north-central Iran.

Authors:  Sajjad Yazdansetad; Miaad K Alkhudhairy; Reza Najafpour; Elika Farajtabrizi; Reham M Al-Mosawi; Morteza Saki; Elham Jafarzadeh; Farokh Izadpour; Atefeh Ameri
Journal:  Heliyon       Date:  2019-09-17

4.  Multi-Drug-Resistant Diarrheagenic Escherichia coli Pathotypes in Pediatric Patients with Gastroenteritis from Central Iran.

Authors:  Elnaz Abbasi; Mahdieh Mondanizadeh; Alex van Belkum; Ehsanollah Ghaznavi-Rad
Journal:  Infect Drug Resist       Date:  2020-05-13       Impact factor: 4.003

5.  Investigation of SCCmec types I-IV in clinical isolates of methicillin-resistant coagulase-negative staphylococci in Ahvaz, Southwest Iran.

Authors:  Effat Abbasi Montazeri; Sakineh Seyed-Mohammadi; Aram Asarehzadegan Dezfuli; Azar Dokht Khosravi; Maryam Dastoorpoor; Mitra Roointan; Morteza Saki
Journal:  Biosci Rep       Date:  2020-05-29       Impact factor: 3.840

6.  ESBL Producing Escherichia coli in Faecal Sludge Treatment Plants: An Invisible Threat to Public Health in Rohingya Camps, Cox's Bazar, Bangladesh.

Authors:  Md Sakib Hossain; Sobur Ali; Monir Hossain; Salman Zahir Uddin; M Moniruzzaman; Mohammad Rafiqul Islam; Abdullah Mohammad Shohael; Md Shafiqul Islam; Tazrina Habib Ananya; Md Mominur Rahman; Mohammad Ashfaqur Rahman; Martin Worth; Dinesh Mondal; Zahid Hayat Mahmud
Journal:  Front Public Health       Date:  2021-12-15

7.  Prevalence of Antibiotic Resistance of ESKAPE Pathogens Over Five Years in an Infectious Diseases Hospital from South-East of Romania.

Authors:  Manuela Arbune; Gabriela Gurau; Elena Niculet; Alina Viorica Iancu; Silvia Fotea; Gabriela Lupasteanu; Mihaela Camelia Vasile; Alin Laurentiu Tatu
Journal:  Infect Drug Resist       Date:  2021-06-24       Impact factor: 4.003

Review 8.  Understanding the Epidemiology of Multi-Drug Resistant Gram-Negative Bacilli in the Middle East Using a One Health Approach.

Authors:  Iman Dandachi; Amer Chaddad; Jason Hanna; Jessika Matta; Ziad Daoud
Journal:  Front Microbiol       Date:  2019-08-23       Impact factor: 5.640

Review 9.  Extended-spectrum beta-lactamase-producing strains among diarrhoeagenic Escherichia coli-prospective traveller study with literature review.

Authors:  Anu Kantele; Tinja Lääveri
Journal:  J Travel Med       Date:  2022-01-17       Impact factor: 8.490

10.  Conjugative transfer of plasmid p_8N_qac(MN687830.1) carrying qacA gene from Staphylococcus aureus to Escherichia coli C600: potential mechanism for spreading chlorhexidine resistance.

Authors:  Taniela Marli Bes; Debora Satie Nagano; Ana Paula Marchi; Gaspar Camilo; Lauro Vieira Perdigão-Neto; Roberta Ruedas Martins; Anna Sara Levin; Silvia Figueiredo Costa
Journal:  Rev Inst Med Trop Sao Paulo       Date:  2021-12-06       Impact factor: 1.846

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.