Analysis of structural properties which possibly are characteristic for the 3'-terminal sequence of the genome RNA of flaviviruses.

Recently we have shown that an open reading frame comprising 10290 nucleotides is present on the infectious, single-stranded genome RNA of the West Nile flavivirus. We have now isolated cloned cDNA representing the 3'-terminal untranslated region of this molecule. The sequence of this region which comprises 571 nucleotides is given in this report. Recently, the nucleotide sequence of the genome RNA of the yellow fever flavivirus has been described. A comparative analysis of the 3'-terminal untranslated nucleotide sequences present in each genome suggests that in flaviviruses this region probably has the following properties. It has a heteropolymeric sequence at the 3' terminus. It contains one or more oligonucleotide sequences that are repeated. An extensive stem and loop structure can be folded from the nucleotide sequences present at the 3' terminus. The stem of this structure contains a conserved region introducing a defined mismatch into the stem. The loop of this structure probably contains short conserved oligonucleotide sequences in analogous positions. In both viruses the oligonucleotide CAUAUUGAC (AG)CC(UA) GGGA(UA) AGAC lies closely in front of the sequence which can be folded into the stem of the 3'-terminal stem and loop structure and the oligonucleotide CUAGAGGUUAGAGGAGACCC is strictly conserved between both viruses. The analyses indicate that the 3'-terminal untranslated region of the genome of flaviviruses probably has rather unique characteristics of primary and secondary structure. Possible implications of these findings are discussed.