Literature DB >> 30111290

Development of a quadruple qRT-PCR assay for simultaneous identification of highly and low pathogenic H7N9 avian influenza viruses and characterization against oseltamivir resistance.

Yang Yang1,2, Shanqin Li1,2, Gary Wong1,2, Sufang Ma2, Zhixiang Xu1, Xiaonan Zhao3, Hong Li3, Wen Xu3, Haixia Zheng1, Jingyan Lin1, Qi Zhao1, Wenjun Liu2, Yingxia Liu1,4, George F Gao1,2,5,4, Yuhai Bi6,7.   

Abstract

BACKGROUND: During the fifth wave of human H7N9 infections, a novel highly pathogenic (HP) H7N9 variant emerged with an insertion of multiple basic amino acids in the HA cleavage site. Moreover, a neuraminidase inhibitor (NAI) resistance (R292K in NA) mutation was found in H7N9 isolates from humans, poultry and the environment. In this study, we set out to develop and validate a multiplex quantitative reverse transcript polymerase chain reaction (qRT-PCR) to simultaneously detect the presence of H7N9 and further identify the HP and NAI-resistance mutations.
METHODS: A quadruple qRT-PCR to simultaneously detect the presence of H7N9 and further identify the HP and NAI-resistance mutations was designed based on the analyses of the HA and NA genes of H7N9. This assay was further tested for specificity and sensitivity, and validated using clinical samples.
RESULTS: The assay was highly specific and able to detect low pathogenic (LP)- or HP-H7N9 with/without the NAI-resistance mutation. The detection limit of the assay was determined to be 50 genome-equivalent copies and 2.8 × 10- 3 50% tissue culture infectious doses (TCID50) of live H7N9 per reaction. Clinical validation was confirmed by commercial kits and Sanger sequencing with ten clinical samples.
CONCLUSIONS: We developed and validated a rapid, single-reaction, one-step, quadruple real-time qRT-PCR to simultaneously detect the presence of H7N9 and further identify the HP- and NAI-resistance strains with excellent performance in specificity and sensitivity. This assay could be used to monitor the evolution of H7N9 viruses in the laboratory, field and the clinic for early-warning and the prevention of H7N9 infections.

Entities:  

Keywords:  H7N9; Highly/low pathogenic avian influenza virus; Molecular diagnostics; NAI-resistance; Oseltamivir; Quadruple qRT-PCR

Mesh:

Substances:

Year:  2018        PMID: 30111290      PMCID: PMC6094886          DOI: 10.1186/s12879-018-3302-7

Source DB:  PubMed          Journal:  BMC Infect Dis        ISSN: 1471-2334            Impact factor:   3.090


Background

Since human H7N9 infection was first identified in 2013 [1], mainland China has experienced five waves of human infections [2, 3]. H7N9 virus infection caused acute respiratory distress syndrome and resulted in high morbidity and mortality [1, 4]. As of March 27, 2018, a total of 1567 cases of laboratory-confirmed H7N9 virus infections were identified with a case fatality rate of ~ 39% (615 deaths) [5]. During the first four waves, the H7N9 viruses circulating in China were classified as low pathogenic (LP) avian influenza virus (AIV) carrying amino acid residues PKGR/G at the HA cleavage site, causing asymptomatic infection in poultry [4, 6]. However, a highly pathogenic (HP) H7N9 AIV variant emerged during the fifth wave in 2017, and has since been identified in 28 human infections [7-10]. These HP-H7N9 isolates contained polybasic amino acids with a PKGKRTAR/G, PKGKRIAR/G, PKRKRAAR/G or PKRKRTAR/G in the cleavage site of HA proteins [2], which are associated with enhanced virulence in chickens [2, 11]. Antivirals play an important role in the management of influenza virus infections [12]. Neuraminidase inhibitors (NAIs) have been used as front-line therapeutic options since the novel H7N9 viruses contain the S31N mutation in the M2 protein, which confers resistance to the M2 ion channel blockers such as amantadine [1, 13]. However, studies have shown that the NA R292K (N2 numbering) mutation in H3N2 and H7N9 viruses [13-16], H274Y (N2 numbering) mutation in the seasonal H1N1, H1N1pdm09 and H5N1 viruses [17-21], emerged during the treatments or through spontaneous changes [14, 22, 23], resulted in a high level of resistance to oseltamivir and other NAIs. Furthermore, H7N9 viruses with the NA R292K mutation were frequently reported in the infected patients, and were usually accompanied by prolonged virus shedding and adverse clinical outcomes [7, 16, 24]. The continuous emergence of NAI-resistant viruses increases the potential threat of the H7N9 viruses to public [25]. Sensitive molecular techniques are needed for the rapid detection of HP-H7N9 variants and NAI-resistance to monitor its circulation, transmission and guide antiviral treatments in clinic. Currently, two qRT-PCR assays have been reported to identify HP-H7 or NAI-resistance mutation of H7N9 virus [26, 27]. However, the application may be restricted by the limit of detection and the circumscribed detection targets. To this end, we developed and validated a multiplex qRT-PCR to simultaneously detect H7N9 and further identify the HP and NAI-resistance strains, and the results are presented herein.

Methods

Viruses and RNA extraction

The strains of influenza A and B were previously isolated, and preserved by our group. Viral stocks were prepared in embryonated chicken eggs (Xinxing Dahuanong Biotechnology, Guangzhou, China) with the approval of Animal Ethics Committees from Shenzhen Third People’s Hospital. Viral RNA was extracted from stocks using the QIAamp RNA Viral Kit (Qiagen, Heiden, Germany) according to the manufacturer’s instruction. Viral RNA was eluted in 50 μL of RNA-free buffer and stored at − 80 °C for subsequent use.

Viral stock titration by TCID50

MDCK cells (ATCC, Manassas, USA) in 96-well plates were grown to 90% confluence and infected with 10-fold serial dilutions of the H7N9 chicken embryo allantoic fluid for 1 h at 37 °C. Then the cells were overlaid with fresh DMEM plus TPCK-treated trypsin (2 μg/ml). At 3 days post infection (dpi), plates were assessed for the lowest dilution in which 50% of the wells exhibited cytopathology and HA titer. The 50% tissue culture infectious dose (TCID50) values were calculated according to the Reed-Muench method [28].

Primer and probe design

All the HA and NA sequences of H7N9 used in the present study were downloaded from the NCBI (National Center for Biotechnology Information) and GISAID (Global Initiative on Sharing All Influenza Data), and aligned using the MEGA 7.0 software. Regions covering the insertion mutation in HA cleavage site and the NAI-resistance mutation (R292K) in NA were chosen as the targets for the primer design. The primers and probes were designed using the Primer Premier 5 software. The probes were labeled with four different fluorescent reporter dyes including FAM, VIC, CY5, and ROX at the 5′-end. The FAM and VIC were labeled with the fluorescent quencher dye NFQ-MGB at the 3′-end, while CY5 and ROX were labeled with BHQ. The sequences and genome positions of the primer and probe set are shown in Table 1.
Table 1

Primers and probes used in the multiplex qRT-PCR assay

Primers/probesSequences (5′-3′)aGenome positionsbFinal concentration (nM)
H7-FGGRAAATGYCCRAGATATGTTAA934–956600
H7-RAATTAGKCCTTCCCATCCATTT1062–1083600
H7-P-WROX-TTGGTGCYATAGCDGGTTTCATTGA-BHQ21037–1061600
H7-P-MFAM-AGRGAAAACGGRYTGCGA-MGB1010–1027800
N9-FGAAGAATGCTCATGTTACGG832–851400
N9-RTGACTAGTGTGTGTCATTGCTA929–950400
N9-P-WCy5-ATTGGCAGGGCTCAAATAGACCAGT-BHQ3887–911400
N9-P-MVIC-GCACATGCAAGGACA-MGB872–886400

aFAM, 6-carboxyfluorescein; Cy5, cyanine 5; ROX, 6-carboxy-X-rhodamine; MGB, minor groove binding; BHQ, Black Hole Quencher; Y = T or C, R = A or G, K = G or T, D = A or T or G

bNucleotide position is based on the ORF of HA and NA genes of A/Anhui/1/2013(H7N9) (GISAID accession: EPI_ISL_138739) except the probe H7-P-M, which is based on the HA gene of A/Guangdong/Th005/2017(H7N9) (GISAID accession: EPI_ISL_250424)

Primers and probes used in the multiplex qRT-PCR assay aFAM, 6-carboxyfluorescein; Cy5, cyanine 5; ROX, 6-carboxy-X-rhodamine; MGB, minor groove binding; BHQ, Black Hole Quencher; Y = T or C, R = A or G, K = G or T, D = A or T or G bNucleotide position is based on the ORF of HA and NA genes of A/Anhui/1/2013(H7N9) (GISAID accession: EPI_ISL_138739) except the probe H7-P-M, which is based on the HA gene of A/Guangdong/Th005/2017(H7N9) (GISAID accession: EPI_ISL_250424)

Generation of DNA standards

A section of the HP-H7 and N9-K292 genes were amplified with the primers H7-F/H7-R and N9-F/N9-R, respectively. The PCR products were purified using the Gene JET PCR Purification Kit (Thermo, MA, USA) and ligated to the pGEM-T vector (Promega, Madison, USA). Plasmids were quantified using the Nanodrop 2000 Spectrophotometer (Thermo, MA, USA). The copy number (molecules/mL) was calculated using the following equation: [C × A / 660 × L], in which C represents the concentration of plasmid (g/mL) assessed by the optical density measurement; A is the Avogadro number (6.023 × 1023); L is the length of the plasmid (number of nucleotides); and 660 is an approximation of the molecular weight of a nucleotide (g/mol).

Quantitative reverse transcription polymerase chain reaction

The samples (both clinical and cultured) were tested by a one-step multiplex qRT-PCR in an ABI QuantStudio Dx Real-Time cycler (Applied Biosystems, Foster City, USA). The One Step PrimeScript™ RT-PCR Kit (Takara, Dalian, China) was used as follows: 0.8 μL enzyme mixture (including reverse transcriptase [RT] and Taq polymerase), 10 μL 2 × One Step RT-PCR buffer III, 0.4 μL of each primer and probe for NA gene, 0.6 μL of each primer for HA gene, 0.6 μL of the universal probe for HA gene (H7-P-W), 0.8 μL of the specific probe for HP-H7 gene (H7-P-M), 0.8 μL RNase free water, and 5 μL RNA (total 20 μL/reaction mixture). The concentration of all the primers and probes was 20 μM. The qRT-PCR assay conditions were as follows: reverse transcription for 5 min at 42 °C; 10 s at 95 °C for reverse transcriptase inactivation and DNA polymerase activation followed by 40 cycles of 5 s at 95 °C and 30 s at 60 °C (annealing-extension step). The data were analyzed using the QuantStudio™ Real-Time PCR Software (Applied Biosystems, Foster City, USA). Commercial qRT-PCR kits for the detection of HP-H7N9 viruses were also used (Mabsky Biotech Co., Ltd., Shenzhen, China; Zhengzhou Zhongdao Biotechnology Co., Ltd., Henan, China) following the manufacturers’ instructions. All samples were analyzed in triplicate with three independent runs.

Clinical samples

Sputum samples were obtained from ten confirmed cases of H7N9 infection in Shenzhen Third People’s Hospital and Yunnan Center for Disease Control and Prevention. Viral RNA was extracted using the QIAamp RNA Viral Kit (Qiagen, Heiden, Germany) according to the manufacturer’s instruction.

Results

Design of the primer-probe set

First, we downloaded and compared the HA genes of the HP- and LP-H7N9 virus. The HA genes of the HP-H7N9 virus possessed either a KRTA, KRIA, or KRAA insertion with a nucleic acid 12 bp in size, 5′-AAA CGG A(G)C(T)T GCG-3′. Thus, we designed the forward (H7-F), reverse (H7-R) primers covering this region, and a probe (H7-P-M) which can specifically recognize the specific insertion. Additionally, a universal probe (H7-P-W) targeting both the HP- and LP-H7N9 within the same region was designed to identify the presence of H7. We then downloaded and compared the NA genes of the H7N9 viruses, selected the forward (N9-F), reverse (N9-R) primers covering the R292K mutation region, and designed a probe (N9-P-M) which can specifically recognize the R292K mutation. Meanwhile, a universal probe (N9-P-W) within the same region was designed to detect the presence of N9 genes. The four probes were labeled with four types of different fluorescence. The oligonucleotide sequences, genome positions, labeled fluorescence of the primers and probes for the multiplex assay are listed in Table 1.

Specificity of the multiplex qRT-PCR assay

The primer-probe set was optimized as a single-well method for H7N9 detection by one-step multiplex qRT-PCR method as described in the Methods section, and the optimized concentrations of the primers and probes are shown in Table 1. To test the specificity of our multiplex qRT-PCR assay, four different H7N9 viruses (LP-H7N9 without NAI-resistance mutation, LP-H7N9 with NAI-resistance mutation, HP-H7N9 without NAI-resistance mutation and HP-H7N9 with NAI-resistance mutation) were used (the identities of viruses used are listed in Table 2). The universal probes of H7 and N9 successfully detected all four phenotypes of H7N9 virus (Fig. 1). Meanwhile, specific probes targeting HP-H7 or N9-K292 specifically recognized the corresponding phenotypes of H7N9 viruses without any nonspecific amplification. In addition, there were also no nonspecific amplification when tested against other influenza viruses (including H1N1, H3N2, H5N6, H6N6 and H9N2 subtype of influenza A and influenza B) (Table 2).
Table 2

The influenza virus strains used in the present study

Types and subtypesReference strainsGISAID NO.HP/LP AIV292R/K in NAVirus titer (TCID50/mL)qRT-PCR assays
H7-WH7-MN9-WN9-M
H7N9SZ/Th003EPI_ISL_250313LPR2 × 10614.38 ± 0.12Uc14.44 ± 0.21U
H7N9SZ/Th004EPI_ISL_250314LPK2 × 10614.37 ± 0.36U15.05 ± 0.2314.15 ± 0.55
H7N9GD/Th005EPI_ISL_250312HPR2 × 10615.61 ± 0.4815.06 ± 0.4915.45 ± 0.19U
H7N9SZ/Th007EPI_ISL_259757HPK2 × 10613.91 ± 0.2413.87 ± 0.5614.45 ± 0.1513.55 ± 0.09
H3N2CAS0001abbaUUUU
H1N1CA04FJ966082bRaUUUU
H5N6Th001EPI_ISL_205503HPRaUUUU
H9N204.15SZBAXQ005EPI_ISL_199448LPRaUUUU
Flu-BVictoriaabbaUUUU
Flu-BYamagataabbaUUUU

anot available

bnot applicable

cundetected

Fig. 1

Validation and optimization of the multiplex qRT-PCR assay using different H7N9 viruses. (a) Representative amplification plot for viral RNAs from LP-H7N9 without NAI-resistance mutation, (b) LP-H7N9 with NAI-resistance mutation, (c) HP-H7N9 without NAI-resistance mutation and (d) HP-H7N9 with NA inhibitor-resistance mutation. H7-W: detection target for universal H7; H7-M: detection target for highly pathogenic H7; N9-W: detection target for universal N9; N9-M: detection target for R292K mutation of N9

The influenza virus strains used in the present study anot available bnot applicable cundetected Validation and optimization of the multiplex qRT-PCR assay using different H7N9 viruses. (a) Representative amplification plot for viral RNAs from LP-H7N9 without NAI-resistance mutation, (b) LP-H7N9 with NAI-resistance mutation, (c) HP-H7N9 without NAI-resistance mutation and (d) HP-H7N9 with NA inhibitor-resistance mutation. H7-W: detection target for universal H7; H7-M: detection target for highly pathogenic H7; N9-W: detection target for universal N9; N9-M: detection target for R292K mutation of N9

Sensitivity of the multiplex qRT-PCR assay

The detection limit of the multiplex qRT-PCR assay was evaluated by quantitative standards from a pGEM-T vector expressing the target sequence of the HP-H7 and N9-K292 genes, or viral RNAs prepared from serial ten-fold dilutions of the four different phenotypes of H7N9 viral stocks. The multiplex qRT-PCR method using DNA standards as template showed that Ct values were similar among the four targets, and the linear range was between 1 × 106 to 1 × 101 molecules, respectively. Moreover, the regression coefficients (R2) values were above 0.99, indicating that the assay was both accurate and precise over this range (Fig. 2). The limit of detection was determined to be 50 genome-equivalent copies per reaction, based on specific amplification curves (Fig. 2a) and the standard curve (Fig. 2b).
Fig. 2

Sensitivity of the multiplex qRT-PCR assay using DNA standards. (a) Representative amplification plot of the different concentrations of plasmids expressing the targeted H7 or N9 genes (10-fold dilutions). (b) Standard curve for ten-fold serial dilutions of the DNA standards. The log numbers of plasmids (Copies/μL) are expressed linearly on the x-axis, whereas Ct values obtained from qRT-PCR are expressed linearly on the y-axis. H7-W, H7-M, N9-W and N9-M are defined the same with Fig. 1

Sensitivity of the multiplex qRT-PCR assay using DNA standards. (a) Representative amplification plot of the different concentrations of plasmids expressing the targeted H7 or N9 genes (10-fold dilutions). (b) Standard curve for ten-fold serial dilutions of the DNA standards. The log numbers of plasmids (Copies/μL) are expressed linearly on the x-axis, whereas Ct values obtained from qRT-PCR are expressed linearly on the y-axis. H7-W, H7-M, N9-W and N9-M are defined the same with Fig. 1 Meanwhile, RNA samples were extracted from ten-fold serial dilutions of four phenotypes of stock H7N9 viruses ranging from 2 × 106 to 2 × 10− 2 TCID50/mL, and were used to test the detection limit (Figs. 3 and 4). Results showed that the detection limit of the multiplex qRT-PCR assay was similar among the four H7N9 viruses (2.8 × 10− 2 TCID50) per reaction, except for LP-H7N9 without NAI-resistance, which was 2.8 × 10− 3 TCID50 per reaction. The titers correlated well with the obtained Ct values (R2 > 0.99) (Figs. 3 and 4).
Fig. 3

Sensitivity of the multiplex qRT-PCR assay using viral RNAs from LP-H7N9 viruses. (a) Representative amplification plot and standard curves for ten-fold serial dilutions of LP-H7N9 without NAI-resistance mutation strain. (b) Representative amplification plot and standard curves for ten-fold serial dilutions of LP-H7N9 with NAI-resistance mutation strain. The log numbers of live H7N9 viruses (TCID50/mL) are expressed linearly on the x-axis, whereas Ct values are expressed linearly on the y-axis. H7-W, H7-M, N9-W and N9-M are defined the same with Fig. 1

Fig. 4

Sensitivity of the multiplex qRT-PCR assay using viral RNAs from HP-H7N9 viruses. (a) Representative amplification plot and standard curves for ten-fold serial dilutions of HP-H7N9 without NAI-resistance mutation strain. (b) Representative amplification plot and standard curves for ten-fold serial dilutions of HP-H7N9 with NAI-resistance mutation strain. The log numbers of live H7N9 viruses (TCID50/mL) are expressed linearly on the x-axis, whereas Ct values are expressed linearly on the y-axis. H7-W, H7-M, N9-W and N9-M are defined the same with Fig. 1

Sensitivity of the multiplex qRT-PCR assay using viral RNAs from LP-H7N9 viruses. (a) Representative amplification plot and standard curves for ten-fold serial dilutions of LP-H7N9 without NAI-resistance mutation strain. (b) Representative amplification plot and standard curves for ten-fold serial dilutions of LP-H7N9 with NAI-resistance mutation strain. The log numbers of live H7N9 viruses (TCID50/mL) are expressed linearly on the x-axis, whereas Ct values are expressed linearly on the y-axis. H7-W, H7-M, N9-W and N9-M are defined the same with Fig. 1 Sensitivity of the multiplex qRT-PCR assay using viral RNAs from HP-H7N9 viruses. (a) Representative amplification plot and standard curves for ten-fold serial dilutions of HP-H7N9 without NAI-resistance mutation strain. (b) Representative amplification plot and standard curves for ten-fold serial dilutions of HP-H7N9 with NAI-resistance mutation strain. The log numbers of live H7N9 viruses (TCID50/mL) are expressed linearly on the x-axis, whereas Ct values are expressed linearly on the y-axis. H7-W, H7-M, N9-W and N9-M are defined the same with Fig. 1

Validation of the multiplex qRT-PCR assay in clinical samples

To validate the assay with clinical samples, we tested 10 sputum specimens obtained from 10 patients confirmed to be infected with influenza A (H7N9) virus during the fifth wave (Table 3). As expected, all samples tested positive for H7N9 viruses with similar Ct values compared to two commercial kits (Table 3). Furthermore, samples from patients SZ05, SZ07 and SZ08 were determined to be HP-H7N9; and samples from patients SZ04, SZ07 and SZ08 were determined to have NAI-resistance mutations. These results were confirmed by Sanger sequencing.
Table 3

Detection of H7N9 virus in the clinical samples

Clinical samplesH7 (HP/LP)aN9 (292R/K)GISAID NO.
Multiplex qRT-PCRKit-1Kit-2Sanger sequencingMultiplex qRT-PCRSanger sequencing
SZ0132.5 (LP)32.46 (LP)33.28 (LP)LPRREPI_ISL_250424
SZ0235.92 (LP)35.85 (LP)35.52 (LP)LPRREPI_ISL_250425
SZ0331.79 (LP)31.26 (LP)31.9 (LP)LPRREPI_ISL_250313
SZ0426.74 (LP)27.16 (LP)27.05 (LP)LPKKEPI_ISL_250314
SZ0526.04 (HP)26.74 (HP)25.28 (HP)HPRREPI_ISL_250312
SZ0626.91 (LP)26.35 (LP)26.43 (LP)LPRREPI_ISL_250315
SZ0728.57 (HP)27.95 (HP)28.91 (HP)HPKKEPI_ISL_259757
SZ0819.81 (HP)20.29 (HP)20.22 (HP)HPKKEPI_ISL_266936
YN0127.35 (LP)28.31 (LP)29.05 (LP)LPRREPI_ISL_250316
YN0236.03 (LP)35.22 (LP)35.13 (LP)LPRREPI_ISL_250317

aThe Ct values of the commercial kits and our developed method for universal H7 were shown

Detection of H7N9 virus in the clinical samples aThe Ct values of the commercial kits and our developed method for universal H7 were shown

Discussion

Previous studies have revealed that the HP-H7N9 virus has caused several outbreaks in poultry farms, in which over 110,000 poultry were found dead in at least 10 provinces [29]. Meanwhile, human infections in rural areas were mostly associated with exposure to sick and dead poultry [8], and the HP-H7N9 variants were also found in the live poultry markets (LPMs) and environment of the human patients [2, 30, 31]. In terms of this situation, the rapid and accurate detection method of HP-H7N9 strains is in urgent need. Recently, one group has developed a duplex qRT-PCR assay to detect both LP-H7 and HP-H7 genes [26]. However, another two novel insertion mutations with “KRIA” or “KRAA” motif in the cleavage site has been found for the HP-H7N9 [2, 8, 11, 30], their probe targeting HP-H7 could not cover all the mutations of HP-H7N9 strains. Furthermore, besides H7, our assay also included the detection target of N9 gene, which could further confirm the presence of H7N9 virus. Except for the broader coverage of probes for HP-H7 and the additional detection target of N9, our assay also possessed an excellent sensitivity. Together, our assay may represent an upgrade of the detection method for HP-H7N9 viruses. The emergence of an NAI-resistance mutation is temporally associated with a rebound of virus load, treatment failure and a poor clinical outcome [16]. Therefore, identification of the NAI-mutation in time may increase the cure rate for H7N9 infections. Resistance to NAIs in particular has important implications, as this class of agent is most widely used for treatment and outbreak control. Accordingly, appropriate laboratory methods for the continuous efforts of laboratory surveillance are of great importance [12]. Currently, the gold standard methods for antiviral resistance screening include phenotypic and genotypic methods using NA-Star® assay and Sanger sequencing, respectively [32, 33]. While both of these methodologies are labor intensive, time-consuming and expensive, suggesting the need for a rapid, high-throughput approach to influenza drug resistance testing. Although an SNP real-time RT-PCR for detection of NAI-resistance mutation has been developed [27], the application may be restricted in its delayed detection after the identification of H7N9 and the limit of detection. As described in our assay, we can directly determine the presence of LP- or HP-H7N9 viruses and simultaneously identify the NAI resistance with higher detection limit, which significantly improve the efficiency and performance of detection.

Conclusions

In conclusion, we developed and validated a rapid, single-reaction, one-step, quadruple real-time qRT-PCR to simultaneously detect the presence of H7N9 and further identify the HP- and NAI-resistance strains with excellent performance in specificity and sensitivity. As the ongoing circulation of H7N9 viruses among poultry, enhanced surveillance is critical to guide prevention and control efforts. This assay will be of great use in monitoring the circulation of HP-H7N9 and NAI-resistant virus strains during AIV surveillance and the treatment of patients with NAIs to prevent persistent viral replication and severe inflammatory reactions.
  30 in total

1.  Influenza antiviral susceptibility monitoring activities in relation to national antiviral stockpiles in Europe during the winter 2006/2007 season.

Authors:  A Meijer; A Lackenby; A Hay; M Zambon
Journal:  Euro Surveill       Date:  2007-04-01

2.  Antiviral resistance among highly pathogenic influenza A (H5N1) viruses isolated worldwide in 2002-2012 shows need for continued monitoring.

Authors:  Elena A Govorkova; Tatiana Baranovich; Patrick Seiler; Jianling Armstrong; Andrew Burnham; Yi Guan; Malik Peiris; Richard J Webby; Robert G Webster
Journal:  Antiviral Res       Date:  2013-02-28       Impact factor: 5.970

3.  Association between adverse clinical outcome in human disease caused by novel influenza A H7N9 virus and sustained viral shedding and emergence of antiviral resistance.

Authors:  Yunwen Hu; Shuihua Lu; Zhigang Song; Wei Wang; Pei Hao; Jianhua Li; Xiaonan Zhang; Hui-Ling Yen; Bisheng Shi; Tao Li; Wencai Guan; Lei Xu; Yi Liu; Sen Wang; Xiaoling Zhang; Di Tian; Zhaoqin Zhu; Jing He; Kai Huang; Huijie Chen; Lulu Zheng; Xuan Li; Jie Ping; Bin Kang; Xiuhong Xi; Lijun Zha; Yixue Li; Zhiyong Zhang; Malik Peiris; Zhenghong Yuan
Journal:  Lancet       Date:  2013-05-29       Impact factor: 79.321

4.  Structural and functional analysis of laninamivir and its octanoate prodrug reveals group specific mechanisms for influenza NA inhibition.

Authors:  Christopher J Vavricka; Qing Li; Yan Wu; Jianxun Qi; Mingyang Wang; Yue Liu; Feng Gao; Jun Liu; Enguang Feng; Jianhua He; Jinfang Wang; Hong Liu; Hualiang Jiang; George F Gao
Journal:  PLoS Pathog       Date:  2011-10-20       Impact factor: 6.823

5.  PCR for detection of oseltamivir resistance mutation in influenza A(H7N9) virus.

Authors:  Wei Wang; Zhigang Song; Wencai Guan; Yi Liu; Xiaonan Zhang; Lei Xu; Jianhua Li; Zhenghong Yuan; Yunwen Hu
Journal:  Emerg Infect Dis       Date:  2014-05       Impact factor: 6.883

6.  Preliminary Epidemiology of Human Infections with Highly Pathogenic Avian Influenza A(H7N9) Virus, China, 2017.

Authors:  Lei Zhou; Yi Tan; Min Kang; Fuqiang Liu; Ruiqi Ren; Yali Wang; Tao Chen; Yiping Yang; Chao Li; Jie Wu; Hengjiao Zhang; Dan Li; Carolyn M Greene; Suizan Zhou; A Danielle Iuliano; Fiona Havers; Daxin Ni; Dayan Wang; Zijian Feng; Timothy M Uyeki; Qun Li
Journal:  Emerg Infect Dis       Date:  2017-08-15       Impact factor: 6.883

7.  Human Infection with Highly Pathogenic Avian Influenza A(H7N9) Virus, China.

Authors:  Changwen Ke; Chris Ka Pun Mok; Wenfei Zhu; Haibo Zhou; Jianfeng He; Wenda Guan; Jie Wu; Wenjun Song; Dayan Wang; Jiexiong Liu; Qinhan Lin; Daniel Ka Wing Chu; Lei Yang; Nanshan Zhong; Zifeng Yang; Yuelong Shu; Joseph Sriyal Malik Peiris
Journal:  Emerg Infect Dis       Date:  2017-08-15       Impact factor: 6.883

8.  Global update on the susceptibility of human influenza viruses to neuraminidase inhibitors, 2015-2016.

Authors:  Larisa V Gubareva; Terry G Besselaar; Rod S Daniels; Alicia Fry; Vicki Gregory; Weijuan Huang; Aeron C Hurt; Patricia A Jorquera; Angie Lackenby; Sook-Kwan Leang; Janice Lo; Dmitriy Pereyaslov; Helena Rebelo-de-Andrade; Marilda M Siqueira; Emi Takashita; Takato Odagiri; Dayan Wang; Wenqing Zhang; Adam Meijer
Journal:  Antiviral Res       Date:  2017-08-10       Impact factor: 5.970

9.  Development of a real-time RT-PCR assay for detection of resistance to oseltamivir in influenza A pandemic (H1N1) 2009 virus using single nucleotide polymorphism probes.

Authors:  Sallene Wong; Kanti Pabbaraju; Anita Wong; Kevin Fonseca; Steven J Drews
Journal:  J Virol Methods       Date:  2011-02-22       Impact factor: 2.014

Review 10.  Clinical Implications of Antiviral Resistance in Influenza.

Authors:  Timothy C M Li; Martin C W Chan; Nelson Lee
Journal:  Viruses       Date:  2015-09-14       Impact factor: 5.048

View more
  5 in total

1.  Longitudinal analysis of antibody dynamics in COVID-19 convalescents reveals neutralizing responses up to 16 months after infection.

Authors:  Yang Yang; Minghui Yang; Yun Peng; Yanhua Liang; Jing Yuan; Yingxia Liu; Jinli Wei; Li Xing; Liping Guo; Xiaohe Li; Jie Li; Jun Wang; Mianhuan Li; Zhixiang Xu; Mingxia Zhang; Fuxiang Wang; Yi Shi
Journal:  Nat Microbiol       Date:  2022-02-07       Impact factor: 30.964

2.  Establishment and evaluation of a quadruple quantitative real-time PCR assay for simultaneous detection of human coronavirus subtypes.

Authors:  Mengchuan Zhao; Yi Xu; Dijun Zhang; Guixia Li; Huixia Gao; Xianping Zeng; Yanqing Tie; Yong Wu; Erhei Dai; Zhishan Feng
Journal:  Virol J       Date:  2022-04-11       Impact factor: 4.099

3.  Severe myocarditis due to influenza A(H1N1)pdm09 viral infection in a young woman successfully treated with intravenous zanamivir: A case report.

Authors:  Maria Mazzitelli; Eugenio Garofalo; Andrea Bruni; Giorgio Settimo Barreca; Angela Quirino; Aida Giancotti; Francesca Serapide; Ciro Indolfi; Giovanni Matera; Paolo Navalesi; Enrico Maria Trecarichi; Carlo Torti; Federico Longhini
Journal:  Clin Case Rep       Date:  2019-10-21

4.  Development of a Multiplex RT-qPCR for the Detection of Different Clades of Avian Influenza in Poultry.

Authors:  Tran Bac Le; Hye Kwon Kim; Woonsung Na; Van Phan Le; Min-Suk Song; Daesub Song; Dae Gwin Jeong; Sun-Woo Yoon
Journal:  Viruses       Date:  2020-01-15       Impact factor: 5.048

5.  Dominant subtype switch in avian influenza viruses during 2016-2019 in China.

Authors:  Yuhai Bi; Juan Li; Shanqin Li; Guanghua Fu; Tao Jin; Cheng Zhang; Yongchun Yang; Zhenghai Ma; Wenxia Tian; Jida Li; Shuqi Xiao; Liqiang Li; Renfu Yin; Yi Zhang; Lixin Wang; Yantao Qin; Zhongzi Yao; Fanyu Meng; Dongfang Hu; Delong Li; Gary Wong; Fei Liu; Na Lv; Liang Wang; Lifeng Fu; Yang Yang; Yun Peng; Jinmin Ma; Kirill Sharshov; Alexander Shestopalov; Marina Gulyaeva; George F Gao; Jianjun Chen; Yi Shi; William J Liu; Dong Chu; Yu Huang; Yingxia Liu; Lei Liu; Wenjun Liu; Quanjiao Chen; Weifeng Shi
Journal:  Nat Commun       Date:  2020-11-20       Impact factor: 14.919

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.