It has previously been demonstrated that miRNA (miR)‑647 exhibits an important role in various cancers, and is aberrantly expressed in gastric cancer (GC). However, the exact role of miR‑647 in GC still remains unclear. The present study aimed to investigate the functional significance of miR‑647 and its target gene in GC. TargetScan and Miranda databases were used to predict the putative targets, and the prediction was validated by Dual‑luciferase Reporter Assays. To investigate whether miR‑647 affects GC cell behavior, a stable miR‑647‑overexpression/low‑expression cell line was generated by transfection with miR‑647 mimic/inhibitor. MTT, Flow Cytometry and Transwell invasion assays were performed to investigate the proliferation, cell apoptosis, migration and invasion properties of MGC‑803 cells. Additionally, reverse transcription‑quantitative polymerase chain reaction and western blot analysis were performed to detect the mRNA and protein expression levels of the apoptosis‑associated genes. The results suggested that tumor protein P73 (TP73) is a target gene of miR‑647. TP73 was markedly decreased following miR‑647 overexpression and significantly increased following miR‑647 inhibition. Following overexpression of miR‑647, the proliferation, migration and invasion of MGC‑803 cells were significantly increased, whereas the percentage of apoptotic cells decreased. Conversely, the proliferation, migration and invasion of MGC‑803 cells were significantly declined, and the percentage of apoptotic cells increased following miR‑647 inhibition. In addition, the B cell lymphoma (Bcl)‑2 Associated X, Apoptosis Regulator/Bcl‑2 ratio was markedly decreased when miR‑647 was overexpressed by miRNA mimics, and significantly increased when miR‑647 expression was inhibited via an miRNA inhibitor. Overall, miR‑647 functions as a tumor promoter in GC by repressing TP73.
It has previously been demonstrated that miRNA (miR)‑647 exhibits an important role in various cancers, and is aberrantly expressed in gastric cancer (GC). However, the exact role of miR‑647 in GC still remains unclear. The present study aimed to investigate the functional significance of miR‑647 and its target gene in GC. TargetScan and Miranda databases were used to predict the putative targets, and the prediction was validated by Dual‑luciferase Reporter Assays. To investigate whether miR‑647 affects GC cell behavior, a stable miR‑647‑overexpression/low‑expression cell line was generated by transfection with miR‑647 mimic/inhibitor. MTT, Flow Cytometry and Transwell invasion assays were performed to investigate the proliferation, cell apoptosis, migration and invasion properties of MGC‑803 cells. Additionally, reverse transcription‑quantitative polymerase chain reaction and western blot analysis were performed to detect the mRNA and protein expression levels of the apoptosis‑associated genes. The results suggested that tumor protein P73 (TP73) is a target gene of miR‑647. TP73 was markedly decreased following miR‑647 overexpression and significantly increased following miR‑647 inhibition. Following overexpression of miR‑647, the proliferation, migration and invasion of MGC‑803 cells were significantly increased, whereas the percentage of apoptotic cells decreased. Conversely, the proliferation, migration and invasion of MGC‑803 cells were significantly declined, and the percentage of apoptotic cells increased following miR‑647 inhibition. In addition, the B cell lymphoma (Bcl)‑2 Associated X, Apoptosis Regulator/Bcl‑2 ratio was markedly decreased when miR‑647 was overexpressed by miRNA mimics, and significantly increased when miR‑647 expression was inhibited via an miRNA inhibitor. Overall, miR‑647 functions as a tumor promoter in GC by repressing TP73.
With the poor efficiency of early diagnosis, high incidence and high mortality rate, gastric cancer (GC) is the fifth most frequently occurring cancer in the world. In Eastern Asia, the highest incidence of gastric cancer is in China (1). Although the incidence of GC is now in a declining trend, GC-associated mortalities remain high in various developing countries (2–6). The imbalance of proto-oncogene and oncogene expression, which is controlled by microRNAs (miR/miRNA) is associated with the development of GC (7). Therefore, miRNAs may exhibit a critical role in GC progression.miRNA is a type of endogenous, conservative, small non-coding RNA molecule ~22 nucleotides in length, which incompletely binds to the 3′untranslated region (UTR) of multiple target mRNAs, promoting mRNA degradation and inhibiting translation, and post-transcriptionally regulating gene expression. Numerous studies indicate that abnormal expression of miRNAs are associated with the occurrence and progression of GC by regulating the expression of their target genes, including oncogenes and tumor suppressor genes (8–13). miR-647 has been reported to be a predictive biomarker for prostate cancer recurrence and a prognostic factor for Taxol-sensitive ovarian cancerpatients (14,15). In addition, Rawlings-Goss et al (16) demonstrated that miR-647 is associated with numerous cancer types (breast, testicular, colon, germ cell and gastric cancer) and may represent a biomarker for GC (16). Furthermore, previous studies have also suggested that miR-647 exerts anti-tumorigenic effects in vitro and in vivo, and may represent a promising therapeutic agent against GC (17). In addition, a previous study revealed that the expression of miRNA-647 significantly alters during the process of the development of GC (18), however its role in the development of GC and the underlying molecular mechanisms remain unclear.The present study aimed to investigate the role of miRNA-647 in GC progression, clarify its association with the various biological characteristics of GC, and to clarify the mechanism of its role in the pathogenesis of the disease.
Materials and methods
Materials
The humangastric cancer cell line MGC-803 was purchased from American Type Culture Collection (Manassas, VA, USA); the RPMI-1640 medium, fetal bovine serum (FBS) and polyvinylidene fluoride (PVDF) membrane were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany); the primary antibodies [B cell lymphoma (Bcl)-2, Bcl-2 Associated X, Apoptosis Regulator (Bax), tumor protein P73 (TP73) and GAPDH] and the secondary antibody were purchased from Cell Signaling Technology Inc., (Danvers, MA, USA); the MTT assay kit was purchased from Eli Lilly and Company (Indianopolis, IN, USA); the miR647 mimic/inhibitor were purchased from Sigma-Aldrich; Merck KGaA, and the cell transfection kit were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).
Cell culture
MGC-803 cells were cultured in RPMI-1640 supplemented with 10% FBS, and incubated in a humidified atmosphere of 95% air and 5% CO2, in an incubator at 37°C. Cells were passaged until they reached 90% confluence.
The mRNA expression level of miR-647 in MGC-803 cells was verified by using RT-qPCR. The gene expression levels were calculated using the 2−ΔΔCq method (19). Total RNA was extracted from the cells using TRIzol reagent® (Takara Bio, Inc., Otsu, Japan) following the manufacturer's protocol. The RNA was quantified using NanoDrop 2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA) at a wavelength of 260 nm according to the manufacturer's protocol. Then, the RNA was reverse transcribed to cDNA using the PrimeScript™ RT reagent kit (Takara Bio, Inc.) according to the manufacturer's protocol, and subsequently, qPCR using SYBR® Premix Ex Taq™ II (Tli RNaseH Plus; Takara Bio, Inc.) and a ROX Plus reagent kit (Takara Bio, Inc.) was performed to determined mRNA or miRNA expression. Amplification conditions were: Initial activation at 95°C for 10 min, followed by 40 amplification cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 60 sec and extension at 72°C for 15 sec. The primers used for the PCR procedure are presented in Table I.
Table I.
Primer sequences for reverse transcription-quantitative polymerase chain reaction.
Gene
Sequence (5′-3′)
Bcl-2
Forward
ATGTGTGTGGAGAGCGTCAA
Reverse
ACAGTTCCACAAAGGCATCC
Bax
Forward
GGCCCACCAGCTCTGAGCAGA
Reverse
GCCACGTGGGCGTCCCAAAGT
TP73
Forward
AACGCTGCCCCAACCACGAG
Reverse
GCCGGTTCATGCCCCCTACA
miR-647
Forward
GTGTTGGCCTGTGGCTG
Reverse
CTGACCCTCCCTCCTGC
GAPDH
Forward
CTTTGGTATCGTGGAAGGACTC
Reverse
GTAGAGGCAGGGATGATGTTCT
TP73, tumor protein P73; Bcl-2, B cell lymphoma-2; Bax, Bcl-2 Associated X, Apoptosis Regulator; miR, microRNA.
Bioinformatics analysis
The target genes of miR-647 were analyzed using the miRecords resource from three independent databases: PicTar (http://pictar.mdc-berlin.de/), TargetScan (http://www.targetscan.org/vert_71/) and miRBase (http://www.mirbase.org/search.shtml).
Dual luciferase reporter assay
MGC-803 cells were seeded in 24-well plates (5×104 per well). Following an incubation period of 24 h, cells were then transiently co-transfected with TP73 3′UTR pmirGLO plasmid (Promega Corporation, Madison, WI, USA) and a miR-647 mimic or its negative control (hsamiR-NC) vector using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) transfection reagent according to the manufacturer's protocol. A total of 48 h following transfection, the luciferase activity was assessed using the Dual-Luciferase Reporter Assay System (Promega Corporation) and the normalized luciferase activity was expressed as the mean ratio of firefly luciferase to Renilla luciferase activity.
Cell transfection
The negative control, miR-647 mimics (cat. no. HMI0878; sequence not available) and miR-647 inhibitors (cat. no. HLTUD0878; sequence not available) were purchased from Sigma-Aldrich; Merck KGaA. The cells were plated in a six-well plate the day prior to transfection. MGC-803 cells were transfected with 50 nM miR-647 mimics (50 nM) and miR-647 inhibitor (100 nM) using 30 µl Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. A total of 24 h following transfection, the transfected cells were used for further experimental analysis, and cells were harvested for protein analysis at the correct time points. Transfection efficiency was observed under a fluorescent microscope.
Western blot analysis
Total cellular protein was extracted using a radioimmunoprecipitation assay buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, and 1% sodium deoxycholate) and samples were resolved by using SDS-PAGE analysis. A bicinchoninic acid protein quantitative kit (Thermo Fisher Scientific Inc.) was used for protein concentration determination. Each lane was loaded with protein samples (25 µg) and then resolved by 10% SDS-PAGE gel and transferred onto a PVDF membrane (EMD Millipore, Billerica, MA, USA) and blocked with Tris-buffered saline with 0.1% Tween-20 containing 5% non-fat milk for 1 h at room temperature and then blotted overnight at 4°C with primary antibodies against TP73 (1:1,000; cat. no. N2C1; GeneTex, Inc., Irvine, CA, USA), Bcl-2 (1:1,000; cat. no. ab59348) and Bax (1:1,000; cat. no. ab32503) or GAPDH (1:2,000; cat. no. ab8245; all Abcam, Cambridge, UK), and incubated with HRP-conjugated anti-rabbit IgG antibody (1:2,000; cat. no. 7074; Cell Signaling Technology Inc., Danvers, MA, USA) at room temperature for 1 h. Protein bands were observed using enhanced chemiluminescence (SuperSignal West Pico Chemiluminescent substrate; Thermo Fisher Scientific, Inc.) and then analyzed using ImageJ software (version 1.46; National Institutes of Health, Bethesda, MD, USA).
Cell proliferation assay
The present study detected the proliferation rate of MGC-803 cells by using an MTT assay. miR-647 mimics, miR-647 inhibitor and their negative controls were transfected into MGC-803 cells for 24 h. Subsequently, the transfected cells were trypsinized by 0.25% trypsin and reseeded onto 96-well plates at a density of 2.5×103 cells per well. MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoliumbromide] was added to the culture medium at specified intervals for 24 h, and formazan crystals were then dissolved using dimethylsulfoxide. The absorbance at a wavelength of 490 nm was measured using a spectrophotometer. Experiments were repeated in triplicate.
Apoptosis analysis assay
MGC-803 cells were transfected with miR-647 mimics, miR-647 inhibitor or their negative control, and 24 h following transfection, 2×106 trypsinized cells were fixed with 70% ethanol at room temperature for 15 min and then stored at 4°C for 12 h. Following this, cells were incubated with 200 ng/ml RNase at 37°C for 30 min. Cells were then labeled with 50 µl/ml Annexin V-FITC and propidium iodide (PI; Cell Signaling Technology Inc.) according to the manufacturer's protocol. Following incubation in the dark for 30 min at room temperature, an additional 400 µl 1X binding buffer (Biomiga Inc., San Diego, CA, USA) was added. The results were analyzed using a flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). WinMDI software (version 2.5; Scripps Research Institute, La Jolla, CA, USA) was used for data analysis. Tests were repeated three times.
Cell migration and invasion assay
Transwell assays were performed to measure cell migration and invasion abilities. MGC-803 cells were transfected with miR-647 mimics, miR-647 inhibitor or their negative control until they reached 60% confluence. Following 24 h, 3×105 cells were trypsinized and resuspended in serum-free medium, and then cells were seeded into the upper chamber with/without Matrigel-coated membrane matrix. The culture medium supplemented with 10% FBS was added to the lower chamber as a chemoattractant. The cells were incubated for an additional 48 h for the migration assay and 72 h for the invasion assay. At the end of the experiments, the non-migrating cells or non-invading cells on the upper surface were scraped off using a cotton swab. The cells on the underside surface were fixed and stained with a 1:5 dilution of Giemsa stain at room temperature for 30 min. Stained cells were observed under a light microscope. Each experiment was independently performed three times.
Statistical analysis
Data are presented as the mean ± standard error of the mean. SPSS statistical software, version 16.0 (SPSS, Inc., Chicago, IL, USA) was used for all statistical analyses. Statistical comparisons between groups were made using a Student's t-test, or analysis of variance followed by Student-Newman-Keul's post-hoc test. P<0.05 was considered to indicate a statistically significant difference.
Results
TP73 is a direct target gene of miR-647
To elucidate the mechanism of miR-647 functioning in GC, the PicTar, TargetScan and miRBase were used for miRNA target gene prediction. The present study first hypothesized that miR-647 may bind to the TP73 gene at the 3′-UTR nucleotide site. To verify whether miR-647 targets TP73, the luciferase reporter gene assay was used. The miR-647-TP73-wild type (WT) or miR-647-TP73-mutated (MUT) reporter plasmid were co-transfected into 293 cells with miR-647 or negative control, and the results demonstrated that the luciferase activity was significantly declined in the 293 cell co-transfection of miR-647 with miR-647-TP73-WT, however co-transfection of miR-647 with miR-647-TP73-MUT did not result in this same effect (Fig. 1). These data suggested that miR-647 inhibited expression of transcripts containing an miR-647 binding site, and indicated that TP73 was a direct target gene of miR-647.
Figure 1.
TP73 is a direct target of miR-647. (A) Interaction between miR-647 and 3′UTR of TP73 was predicted using TargetScan. (B) Luciferase activity of a reporter containing a wild-type TP73 3′UTR or a mutant TP73 3′UTR are presented in the bar graph. All data are presented as the mean ± standard error of the mean of three independent experiments. **P<0.01 vs. miR-c. TP73, tumor protein P73; UTR, untranslated region; miR, microRNA; miR-c, miR negative control; TP73 Mut 3′UTR, TP73 3′UTR with a mutation in the miR-647 binding site; TP73 WT 3′UTR, TP73 3′UTR with wildtype miR-647 binding site.
miR-647 inhibits TP73 expression
To explore whether miR-647 acts as an inhibitor of TP73 protein expression, miR-647 mimics, miR-647 inhibitor or their negative controls were transfected into MGC-803 cells, respectively. Then, 24 h following the transfection, the mRNA and protein expression levels of TP73 were detected by RT-qPCR and western blotting respectively. Compared with the negative control, it was demonstrated that the mRNA and the protein levels of TP73 were significantly decreased in the miR-647 mimics groups, and were increased in the miR-647 inhibitor groups (Fig. 2). The results indicated that miR-647 exhibited an important role in the suppression of TP73 protein expression.
Figure 2.
miR-647 inhibits TP73 expression. (A) Reverse transcription-quantitative polymerase chain reaction analysis demonstrated the mRNA expression levels of TP73 in the MGC-803 cell lines transfected with the miR-647 mimics, miR-647 inhibitor or NC. Data were normalized against the mRNA expression level of GAPDH. (B) Western blot analysis was used to detect the protein expression levels of TP73 in the MGC-803 cell lines transfected with the miR-647 mimics, miR-647 inhibitor or NC. *P<0.05 vs. NC. NC, negative control; TP73, tumor protein P73; miR, microRNA.
miR-647 promotes GC cell proliferation
To investigate whether miR-647 affects GC cell behavior, a stable miR-647-overexpression/low-expression cell line was generated by transfection with miR-647 mimics/inhibitor. As presented in Fig. 3, the relative mRNA expression level of miR-647 was significantly increased in miR-647 mimic transfected MGC-803 cells, and decreased in cells transfected with miR-647 inhibitor. To investigate the role of miR-647 in GC proliferation, miR-647 mimics, miR-647 inhibitor or their negative controls were transfected into MGC-803 cells, and an MTT assay was conducted to detect the cell proliferation ability. The results demonstrated that compared with the negative control group, overexpression of miR-647 significantly promoted the MGC-803 cell proliferation, whereas, downregulation of miR-647 inhibited the cell proliferation (Fig. 3). This indicated that miR-647 promoted the cell proliferation of MGC-803 cells.
Figure 3.
miR-647 promotes proliferation in MGC-803 cells. Total level of miR-647 in MGC-803 cells transfected with (A) miR-647 mimics, (B) miR-647 inhibitor or respective NC were detected. Cell proliferation was analyzed by MTT assay in the MGC-803 cells transfected with (C) miR-647 mimics, (D) miR-647 inhibitor. All data are presented as the mean ± standard error of the mean of three independent experiments. **P<0.01; *P<0.05 vs. NC. TP73, tumor protein P73; miR, microRNA; NC, negative control.
miR-647 reduces the apoptosis of GC cells
To investigate the effect of miR-647 on cell apoptosis, 24 h following MGC-803 cell transfection with miR-647 mimics, miR-647 inhibitor or their negative controls, the apoptosis rate was measured by flow cytometry assay. A total of 24 h following transfection with miR-647 mimics, the apoptosis rate of MGC-803 cells was significantly decreased compared with cells transfected with NC. The apoptosis rate of MGC-803 cells transfected with miR-647 inhibitor was significantly increased compared with cells transfected with NC (Fig. 4).
Figure 4.
miR-647 reduces the apoptosis of MGC-803 cells. Flow cytometry was performed to detect cell apoptosis. MGC-803 cells were transfected with miR-647 mimics, miR-647 inhibitor or NC. A total of 24 h following transfection, cells that stained positive for FITC-Annexin V and negative for PI were scored as exhibiting early apoptosis. Experiments were performed in triplicate. *P<0.05 vs. NC. miR, microRNA; PI, propidium iodide; NC, negative control.
To further explore the mechanism of the cell apoptosis, the apoptosis-associated proteins Bax and Bcl-2 expression levels were detected by western blotting. The results suggested that the pro-apoptotic protein Baxof cells transfected with miR-647 mimics was markedly decreased and transfected with miR-647 inhibitor was markedly increased compared with cells transfected with NC. As expected, the anti-apoptotic protein Bcl-2 of cells transfected with miR-647 mimics was markedly increased and transfected with miR-647 inhibitor was markedly decreased compared with NC transfected cells (Fig. 5). All these results suggested that miR-647 reduced the apoptosis of GC cells through altering Bax/Bcl-2 protein ratio.
Figure 5.
Expression levels of Bcl-2, Bax and TP73 in MGC-803 cells. MGC-803 cells were transfected with miR-647 mimics, miR-647 inhibitor or NC. A total of 24 h following the transfection, Bcl-2, Bax and TP73 expression levels were measured using reverse transcription-quantitative polymerase chain reaction and western blotting. Relative mRNA expression levels of Bcl-2, Bax and TP73 in MGC-803 cells transfected with (A) miR-647 mimics and (B) miR-647 inhibitor. (C) Protein expression levels of Bcl-2, Bax and TP73 in transfected MGC-803 cells. Data are presented as the mean ± standard error of the mean of three independent experiments. *P<0.05 vs. NC. TP73, tumor protein P73; miR, microRNA; Bcl-2, B cell lymphoma-2; Bax, Bcl-2 Associated X, Apoptosis Regulator.
miR-647 facilitates GC cell migration and invasion
The impact of miR-647 on migration and invasion of MGC-803 cells was evaluated in vitro, and Transwell assays were performed. It was demonstrated that MGC-803 cells transfected with miR-647 mimics migrated and invaded faster compared with those transfected with NC. The results additionally demonstrated that low-expression of miR-647 in MGC-803 cells significantly inhibited the migration and invasion abilities compared with the NC transfected cells (Fig. 6). The data indicated that miR-647 facilitated GC cell migration and invasion.
Figure 6.
miR-647 facilitates the migration and invasion of MGC-803 cells. The migration and invasion ability of the MGC-803 cells was detected using Transwell assays at 24 h following the transfection of miR-647 mimics, miR-647 inhibitor or NC (magnification, ×200). Experiments were performed in triplicate. NC, negative control. miR, microRNA.
Discussion
Numerous studies have indicated that miRNAs exhibit a vital role in the development of cancer (20–23). However, knowledge of the abnormal expression and function of miRNAs in GC still remains largely unclear. Therefore, identification of tumor-associated miRNAs and their targets is critical for understanding their roles in the tumorigenesis and may be important for developing novel targets for GC therapy. The present study focused on the role of miR-647 in GC.It has previously been demonstrated that miR-647 is important in various cancers and is upregulated in GC (14,15,18). However, the exact role of miR-647 in GC remains to be determined. In the present study, it was hypothesized that the target gene of miR-647 was TP73, and the 3′UTR its interaction site, and it was subsequently verified that the TP73 gene acts as a direct target of miR-647 via use of the Dual luciferase reporter assay. As the target gene of miR-647, TP73 (p73) target gene is a member of the p53 family of transcription factors and was first discovered in 1997. Due to its structural and functional homologies with p53, p73 in addition to p53 may become of primary research interest. p73 exhibits tumor-suppressive activities though binding and transactivation of p53-responsive genes and inducing of apoptosis and cell arrest (24). In addition, p73 is important in neuronal progress and differentiation, metabolic control, spermatogenesis and the maintenance of male fertility (24–26). The present study investigated whether p73 expression levels were affected by miR-647 activation/inhibition in MGC-803 cells. The results suggested that both the protein and mRNA expression levels of p73 were significantly decreased when miR-647 was overexpressed, however markedly increased when miR-647 expression was downregulated. This indicated that miR-647 exhibited an important role in suppressing TP73 gene expression in MGC-803 cells.miR-647 was hypothesized to have a critical role in regulating the behavior of the GC cells. For cell proliferation detection, an MTT assay was performed. The results demonstrated that overexpression of miR-647 significantly promoted the MGC-803 cell proliferation and its downregulation inhibited the cell proliferation. A cell apoptosis assay was performed using flow cytometric analysis, and the results suggested that miR-647 reduced the apoptosis of MGC-803 cells. Furthermore, cell migration and invasion ability were measured by using Transwell assays, and as expected, it was demonstrated that miR-647 facilitated the migration and invasion ability of the MGC-803 cells.To further investigate the underlying mechanism of the regulation of cell apoptosis by miR-647, the expression levels of various apoptosis-associated genes were detected. When miR-647 was overexpressed, Bcl-2 protein expression levels increased, whereas the protein expression levels of Bax declined in the MGC-803 cell line. Conversely, when miR-647 expression was downregulated, Bcl-2 protein expression levels declined, whereas the protein expression levels of Bax increased in the MGC-803 cell line. The mRNA expression levels of both Bcl-2 and Bax exhibited similar trends. The findings demonstrated that miR-647 reduced the apoptosis of GC cells through altering the Bax/Bcl-2 protein ratio, which indicated that miR-647 was able to regulate the mitochondrial apoptosis pathway (27,28). Therefore, miR-647 was hypothesized to reduce apoptosis through the TP73/Bax mitochondrial apoptosis pathway.In conclusion, the results of the present study demonstrated that miR-647, which is a tumor promoter, exhibits a key role in the regulation of GC cell behavior. Furthermore, the findings verified that TP73 is the target gene of miR-647 in GC. miR-647 may therefore be used as a novel therapeutic target in the treatment of GC in the future.
Authors: I Casciano; K Mazzocco; L Boni; G Pagnan; B Banelli; G Allemanni; M Ponzoni; G P Tonini; M Romani Journal: Cell Death Differ Date: 2002-03 Impact factor: 15.828