Literature DB >> 30106084

Hypoxic preconditioned bone mesenchymal stem cells ameliorate spinal cord injury in rats via improved survival and migration.

Weiheng Wang1, Xiaodong Huang2, Wenbo Lin2, Yuanyuan Qiu3, Yunfei He2, Jiangming Yu2, Yanhai Xi2, Xiaojian Ye2.   

Abstract

The unique hypoxic inflammatory microenvironment observed in the spinal cord following spinal cord injury (SCI) limits the survival and efficacy of transplanted bone mesenchymal stem cells (BMSCs). The aim of the present study was to determine whether hypoxic preconditioning (HP) increased the therapeutic effects of BMSC on SCI. BMSCs were pretreated with cobalt chloride (CoCl2) in vitro, and the proliferative apoptotic and migratory abilities of these hypoxic BMSCs (H‑BMSCs) were assessed. BMSCs and H‑BMSCs derived from green fluorescent protein (GFP) rats were transplanted into SCI rats in vivo. The neurological function, histopathology, inflammation, and number and migration of transplanted cells were examined. HP significantly enhanced BMSC migration (increased hypoxia inducible factor 1α and C‑X‑C motif chemokine receptor 4 expression) and tolerance to apoptotic conditions (decreased caspase‑3 and increased B‑cell lymphoma 2 expression) in vitro. In vivo, H‑BMSC transplantation significantly improved neurological function, decreased spinal cord damage and suppressed the inflammatory response associated with microglial activation. The number of GFP‑positive cells in the SCI core and peripheral region of H‑BMSC animals was increased compared with that in those of BMSC animals, suggesting that HP may increase the survival and migratory abilities of BMSCs and highlights their therapeutic potential for SCI.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30106084      PMCID: PMC6192716          DOI: 10.3892/ijmm.2018.3810

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Spinal cord injury (SCI), an unresolved problem in medicine, is characterized by high morbidity and mortality (1). With the development of the modern transportation and construction industries, the incidence of SCI has increased annually (2). Patients with SCI often exhibit severe motor and sensory paralysis and have a poor prognosis, resulting in heavy familial and societal burdens (3,4). In previous decades, cell transplantation has become a promising therapy for a number of diseases. Transplantation of stem cells, including bone mesenchymal stem cells (BMSCs), is a promising therapy for SCI (5). Stem cells are pluripotent and/or multipotent; they also possess the capabilities for self-renewal and differentiation into specific cell lineages. BMSC transplantation for the treatment of traumatic brain injury (6) and SCI (5) has achieved good results in animal and preclinical studies. The mechanism of BMSC treatment may be based on the principle of BMSC trans-differentiation to replace damaged cells, generation of growth factors (7,8), and regulation of the immune response (9). In addition, BMSCs maintain the resting phenotype of microglia and suppress microglial activation (10). The activated microglia release excessive inflammatory cytokines and increase the degree of SCI (10). These functions of BMSCs are critical for SCI repair. Therefore, stem cells have significant potential for SCI regenerative therapy. Although stem cell transplantation for SCI treatment has exhibited encouraging effects in animal models, there are a number of obstacles to overcome prior to widespread use in clinical practice (11). Firstly, the survival of transplanted stem cells is low, and the differentiation ability of transplanted stem cells is significantly decreased compared with original cells. There is a contradiction between the best cell transplantation time and the special harmful microenvironment in the spinal cord lesion on acute and subacute phase of SCI. At present, the majority of animal experiments indicate that the best time for stem cell transplantation is the acute phase of SCI (12,13). BMSC transplantation exhibits markedly positive effects during the acute and subacute phases of SCI but has little effect during the chronic phase of SCI (14). Oxidative stress (15,16), inflammation (17) and apoptosis (18) are observed in the microenvironment in SCI lesions, particularly during the acute phase of SCI. This harmful microenvironment may increase the severity of SCI and decrease the survival, secretory and differentiation abilities of transplanted cells (19). An additional problem is the ineffectiveness and poor migratory and homing abilities of transplanted stem cells (20-22). The different types of transplantation for SCI lesions include intralesional transplantation (23), intrathecal transplantation (ICT) (24) and intravenous transplantation (25). Cell delivery by ICT is safer, simpler and more effective compared with the other methods (24,26). However, the delivery rate of BMSCs to the injured spinal cord by ICT is as low as 4.1% at 4 days and 3.4% at 21 days (27), which markedly limits the therapeutic effect. An alternative way to enhance the migration, homing and neurogenesis capabilities of BMSCs for the treatment of SCI is urgently required. Hypoxic preconditioning (HP) is a powerful, endogenous and protective mechanism that was identified in vivo (28,29). HP stem cells have been studied for their ability to promote the efficacy of transplanted cells in certain diseases (20–22). HP has the demonstrated benefit of improving stem cell survival and function in myocardial (30) and cerebral infarction (20) animal models. The potential mechanisms of time- and concentration-dependent HP include regulating intracellular transduction, increasing cell resistance to injury, upregulating migration and differentiation, and enhancing growth factor secretion (21,31-33). Based on these proposed mechanisms, we hypothesized that HP may be a feasible and effective means to improve the therapeutic effect of BMSCs for the treatment of SCI. In the present study, the appropriate conditions for HP were determined. Migration and apoptotic resistance in BMSCs and the associated molecular changes in vitro were also assessed. HP BMSCs (H-BMSCs) were transplanted into a SCI rat model via ICT to verify the therapeutic effect in vivo, and it was demonstrated that H-BMSCs can ameliorate spinal cord injury in rats via improved survival and migration.

Materials and methods

Animals

A total of 120 female SD rats (9-10 weeks, 200-220 g, Shanghai Lingchang BioTech Co., Ltd., China) and 10 green fluorescent protein (GFP)-transgenic female SD rats [50-60 g, SD-Tg (CAG-enhanced GFP) CZ-004Osb, Sina-British SIPPR/BK Lab, Animal Ltd., China] were purchased from the Experimental Animal Center of Shanghai Second Military Medical University (Shanghai, China). The rats were housed in an animal room (20-22°C, 12-h light/dark cycle, 50-60% relative humidity) and had ad libitum access to food and water for 1 week prior to the experiment to adapt to the environment. All experimental procedures were approved by the Experimental Animal Management Ethics Committee of Shanghai Second Military Medical University (approval no. 20165001119). All experiments were performed in accordance with the National Institutes of Health (NIH) guidelines for the care and use of experimental animals (NIH publication no. 80–23).

BMSC culture and identification

BMSCs were obtained from GFP-transgenic rats according to a previously described method (34). GFP expression in these rats is driven by the chicken-β-actin promoter and cytomegalovirus enhancer CAG promoter (35); the BMSCs from these rats were confirmed to be GFP-positive in a previous study (36). The rats were euthanized by pentobarbital sodium overdose (150 mg/kg, intraperitoneal injection). The marrow cavity was rinsed with Dulbecco's modified Eagle medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) from a 20-gauge needle. BMSCs were centrifuged (200 × g at 20°C for 5 min) and resuspended in complete medium containing 10% fetal bovine serum (FBS; ScienCell Research Laboratories, Inc., San Diego, CA, USA), DF-12 (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The purity of passage 3 (P3) BMSCs was assessed with CD29/CD90-positive and CD31/CD45-negative staining. The BMSCs was resuspended in PBS, (1×107 cells/ml for verification tests). Subsequently the antibodies CD29 fluorescein isothiocyanate (FITC; 1:500; cat. no. 13-0291-80; eBioscience; Thermo Fisher Scientific, Inc.), CD90 phycoerythrin (PE; 1:500; cat. no. 03013-60-500; Biogems; PeproTech, Inc., Rocky Hill, NJ, USA), CD45-allophycocyanin (APC; 1:500; cat. no. 17-0461-82; eBioscience; Thermo Fisher Scientific, Inc.) and CD31 PE (1:500; cat. no. 25-0310-80; eBioscience; Thermo Fisher Scientific, Inc.) were added and mixed and incubated at room temperature for 15 min. All flow cytometric analyses were complete within 1 h using a flow cytometer (FAC500; Beckman Coulter, Inc., Brea, CA, USA). Osteogenic and adipogenic differentiation media (ScienCell Research Laboratories, Inc.) were added to P3 BMSCs and replaced every 3 days. After 3 weeks, the cells were fixed using 4% formaldehyde for 10 min in room temperature, then stained with alizarin red by 0.1% Alizarin Red-Tris-HCL stain (pH 8.3, Guge Biotechnology Co., Ltd., Wuhan, China) for 30 min at room temperature to examine their osteogenic properties. The oil red O (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) stock solution was mixed with water (3:2), then the cells were stained for 15 min at room temperature, then 60% ethanol differentiation for 10 min and hematoxylin staining for 10 min at room temperature to examine their adipogenic properties. The osteogenic and adipogenic differentiation abilities of BMSCs were evaluated under a light microscope.

BMSC proliferative activity and apoptosis rate induced by HP

P3 BMSCs were subjected to HP induced by 100 µM cobalt chloride (CoCl2) as described previously (37,38). Following pretreatment of BMSCs with HP for 0, 6, 12, 24 and 48 h, the proliferative activity of the cells was measured by Cell Counting Kit-8 (CCK-8; Beyotime Institute of Biotechnology, Haimen, China), and the apoptosis rate was examined by using a flow cytometer (FAC500; Beckman Coulter, Inc., Brea, CA, USA) with an Annexin V-Propidium iodide Apoptosis Detection kit (BD Biosciences, Franklin Lakes, NJ, USA) according to the manufacturer's protocol. The results were used to select the best hypoxic pretreatment condition. The experiment was repeated in triplicate, with 3 replicates per condition.

Detection of the effect of HP on BMSC tolerance to serum-deprived medium (SDM) by FCM

According to the results from the cell proliferation and apoptosis rate analysis, 100 µM CoCl2 for 24 h was selected as the pretreatment condition. P3 BMSCs were seeded in 6-well plates at a density of 1×105 cells/well, then cultured in normal medium and cultured in medium containing 100 µM CoCl2 for 24 h in 37°C. Subsequent to challenge with SDM for 24 h, the apoptosis rates of the cells were detected by FCM to examine BMSC tolerance to SDM. The experiment was repeated in triplicate, and 3 replicates were used each time.

Migration of hypoxic BMSCs (H-BMSCs) detected by the Transwell method

In this experiment, polycarbonate inserts (pore size 8.0 µm) were used to establish a migration model in a Transwell system. P3 BMSCs were pretreated with 100 µM CoCl2 for 24 h. Next, 5×104 cells/well were cultured in a Transwell system with complete medium, and migration was observed after 6,12 and 24 h at 37°C. The BMSCs were divided as follows: BMSC and H-BMSC groups. The Transwell method was conducted according to the manufacturer's protocol (EMD Millipore, Billerica, MA, USA). At the end of the different time points, Transwell inserts were removed, and the culture medium in the upper and lower chambers was aspirated. The cells were washed with 0.01 M PBS 3 times and fixed with 4% paraformaldehyde for 30 min at room temperature. After drying at room temperature, non-migrated cells in the upper chamber were gently wiped off with a cotton swab. The cells were stained with 0.1% crystal violet (Guge Biotechnology Co., Ltd.) for 20 min at room temperature. Images were captured with a light microscope (Olympus Corporation, Tokyo, Japan) at 400× magnification. A total of 5 fields of view were randomly selected for cell counting. The experiment was repeated in triplicate with 3 replicates used each time.

Apoptosis-associated genes [caspase-3 and B-cell lymphoma 2 (Bcl-2)] and migration-associated genes [hypoxia inducible factor 1α (HIF-1α) and C-X-C motif chemokine receptor 4 (CXCR4)] in BMSCs detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR)

P3 BMSCs were seeded in a 6-well plate at a density of 1×105 cells/well and cultured for 24 h with 0 or 100 µM CoCl2. Adherent cells were digested with 0.25% trypsin (pre-warmed to 37°C; Gibco; Thermo Fisher Scientific, Inc.) at 37°C for 2-3 min and collected by centrifuged at 150 × g for 5 min at 20°C, and the effect of HP on the mRNA expression levels of BMSC migration-associated genes (HIF-1α and CXCR4) were examined. Then, to assess the effect of HP on the mRNA expression levels of BMSC apoptosis-associated genes (caspase-3 and Bcl-2), P3 BMSCs were seeded in a 6-well plate at a density of 1×105 cells/well and cultured for 24 h with 0 or 100 µM CoCl2. Next, the BMSCs were challenged with SDM for 24 h, followed by the collection of adherent cells by centrifugation at 150 × g for 5 min at 20°C. Total mRNA was extracted using ISOGEN according to the manufacturer's protocols (Nippon Gene Co., Ltd., Tokyo, Japan). RNA samples were then reverse transcribed into cDNA, followed by specific amplification of specific genes (caspase-3, Bcl-2, HIF-1α and CXCR4) and electrophoretic separation. A total of 1 µg total RNA samples were reverse transcribed to cDNA using a Generay Biotech RT kit (Generay Biotech Co., Ltd., Shanghai, China) in a 20 µl volume according to the following temperature protocol: 37°C for 15 min, 85°C for 5 sec, followed by 5 min at 4°C. PCR was conducted using Maxima™ SYBR-Green/ROX qPCR Master Mix (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol, using the Stratagene mx3000P real-time PCR system (Agilent Technologies, Inc., Santa Clara, CA, USA). The thermocycling conditions were: 95°C for 5 min, then 40 cycles of 95°C for 10 sec and 60°C for 34 sec. PCR products were separated on a 1.2% agarose gel and visualized using ethidium bromide staining. The resultant gel image was analyzed using the AlphaImager gel analysis system (AlphaImager 2000; ProteinSimple, San Jose, CA, USA). The mRNA expression of target genes was calculated using the 2−ΔΔCq method (39), and the mRNA expression of target genes was normalized to that of GAPDH. The experiment was repeated in triplicate with 3 replicates. The primers were synthesized by Shanghai Shenggong Biology Engineering Technology Service Ltd., (Shanghai, China), and are listed in Table I.
Table I

Primer sequences.

GeneForward primer (5′-3′)Reverse primers (5′-3′)
GAPDHGCAAGTTCAACGGCACAGGGCCCCTCCTGTTGTTATGG
HIF-1αCACTGCACAGGCCACATTCATAAGCAGGTCATAGGCGGTTTC
CXCR4TCCGTGGCTGACCTCCTCTTCAGCTTCTCGGCCTCTGGC
Bcl-2TCCTTCCAGCCTGAGAGCAACCCGACGGTAGCGACGAGAGAAG
Caspase-3GCGGTATTGAGACAGACAGTGGAACGCGGTAGAGTAAGCATACAGGAAGT

HIF-1α, hypoxia inducible factor 1α; CXCR4, C-X-C motif chemokine receptor 4; Bcl-2, B-cell lymphoma 2.

Rat SCI model and BMSC administration

Rat were anesthetized with pentobarbital sodium (50 mg/kg, intraperitoneal injection) and fixed in a bayonet-type rat fixator. Thoracic (T)10 was served as the central site for removal of the corresponding spinous processes and lamina. A standardized, improved Allen SCI model of contusion was used with modifications, as previously described (40,41). A 10-g weighted hammer fell from a height of 50 mm and impinged on the rat T9-11 vertebrae. For the first 3 days following surgery, 50,000 U conventional penicillin was delivered via intramuscular injection to prevent infection. The rats received abdominal massages every 6 h after the procedure to assist with urination, until they were capable of independent urination. The rats received BMSC transplantation by ICT immediately following SCI at lumbar vertebrae L3-5, as previously described (27). A 30-gauge needle was used to inject 1×106 BMSCs suspended in 20 µl PBS. The cells were injected over 5 min to prevent cell leakage. A total of 120 female SD rats were randomly assigned to 4 equal groups: Sham, SCI, BMSC and H-BMSC groups (n=30). A total of 60 rats were sacrificed 72 h after SCI, while the remaining 60 rats were sacrificed 28 days after SCI. The rats in the sham group underwent the surgical procedures without the hammer drop. The rats in the SCI, BMSC and H-BMSC groups received SCI and ICT. The SCI group received 20 µl PBS (0.01 M) via ICT, the BMSC group received BMSCs-GFP (1×106) via ICT, and the H-BMSC group received HP BMSCs-GFP (1×106) suspended in 20 µl PBS (0.01 M) via ICT.

Histopathology

Rats in which SCI modeling failed and those that succumbed were excluded (n=6). At 72 h and 28 days after cell transplantation, total 10 rats were anesthetized with pentobarbital sodium (50 mg/kg, intraperitoneal injection) and perfused with 0.01 M PBS for 10 min, followed by 4% paraformaldehyde for 20 min. The lamina was the opened, and a segment was removed 3 mm above and below the damaged spinal cord (n=5 from each rat). The removed spinal cord was fixed in 4% paraformaldehyde for 4 h at room temperature, then dehydrated in 70,85,95 and 100% alcohol (Guge Biotechnology Co., Ltd.) at room temperature for 4 h, embedded in paraffin, cut into 5-µm-thick sections and stained with hematoxylin for 5 min and eosin for 3 min at room temperature. A total of 5 slices of each spinal cord were observed under a light microscope at magnification ×200 (Olympus Corporation, Tokyo, Japan).

Detection of tumor necrosis factor α (TNF-α), interleukin (IL)-1β and IL-6 levels in the spinal cord by ELISA

A total of 20 rats were sacrificed 72 h after cell transplantation by pentobarbital sodium overdose (150 mg/kg, intraperitoneal injection), and the lamina was quickly opened. A segment 3 mm above and below the damaged spinal cord was harvested (n=5). Spinal cord tissue collected from each group was weighed and homogenized immediately in 1 ml normal saline at 4°C. The homogenate was centrifuged at 2,000 × g for 15 min at 4°C. The spinal cord supernatant was collected, and an ELISA kit (R&D Systems, Inc. Minneapolis, MN, USA) was used to measure the levels of TNF-α (R&D Systems, Inc.; cat. no. RTA00), IL-1β (R&D Systems, Inc.; cat. no. RLB00), IL-6 (R&D Systems, Inc.; cat. no. R6000B) in the spinal cord in accordance with the manufacturer's protocol (ELx800, BioTek Instruments, Inc.). The absorbance was measured at 450 nm, according to the standard curve to used calculate the sample content by using CurveExpert 1.3 software and plotted in dose-response curves.

Immunofluorescence staining

Injured spinal cords were harvested and processed for immunohistochemistry to detect the expression levels of GFP and allograft inflammatory factor 1 (Iba-1). The spinal cord 3 mm above and below the affected segment was harvested and perfused with precooled PBS for 10 min. Spinal cord tissues were fixed in 4% paraformaldehyde for 4 h at room temperature, dehydrated by 20% sucrose for 2 days at room temperature and processed in Tissue-Tek® Optimum Cutting Temperature compound (4583; Tissue Tek; Sakura Finetek USA, Inc., Torrance, CA, USA). A freezing microtome (LEICA CM 1950; Leica Microsystems GmbH, Wetzlar, Germany) was used to obtain 10-µm-thick coronal sections. The sections were rinsed 3 times with PBS; blocked with 10% donkey serum (Guge Biotechnology Co., Ltd.) for 30 min at room temperature; and incubated overnight with rabbit anti-GFP (1:200; Cell Signaling Technology, Inc., Danvers, MA, USA) and goat anti-Iba-1 (1:500; cat. no. ab5076; Abcam, Cambridge, UK) primary antibodies at 4°C. The sections were then washed three times with PBS, followed by an incubation with the corresponding secondary antibody (1:500; cat. no. ab6880; Abcam) for 2 h at room temperature. Nuclei were stained with DAPI (HZB0778; Harveybio; Haiwei gene technology Co., Ltd., Beijing, China; https://china.guidechem.com/trade/pdetail963512.html#f_1) for 5 min at room temperature. The observation of spinal cord sections was performed using a fluorescence microscope at magnification ×100 (Olympus Corporation), and 10 fields of view were randomly selected. For quantification, the percentage of positive cells was calculated as (number of positive cells)/(total number of cells in the field of view) × 100%.

Hind limb motor and sensory function

Hind limb motor and sensory function was examined in four groups of 60 rats (sham/SCI/BMSC/H-BMSC; n=15 in each). Prior to SCI, and at 1, 3, 7, 10, 14, 21 and 28 days after SCI, the rats received an abdominal massage to assist in emptying their bladders prior to scoring at 8:00 a.m. The Basso Beattie Bresnahan (BBB; 0-21) grading method (42) was used to observe the recovery of hind limb motor function, and the Reuter score (0-11) (43,44) was used to evaluate sensory function in the four groups. A total of 2 experienced observers (The Second Military Medical University, Shanghai, China) performed the reevaluation tests. The observers had no knowledge of the rat groupings prior to the experiment.

Statistical analysis

Figures were generated by using GraphPad Prism 6 software (GraphPad Software, Inc., La Jolla, CA, USA). SPSS 21.0 software (IBM Corp., Armonk, NY, USA) was used to analyze data using repeated measures analysis of variance and Fisher's Least Significant Difference post-hoc test. Values were expressed as the mean ± standard error of mean (the data of hind limb motor and sensory function) or standard deviation (the rest of the data). P<0.05 was considered to indicate a statistically significant difference.

Results

BMSC characterization

Optical microscopy demonstrated that BMSCs were uniform, spindle-shaped or irregularly refractive with high cell purity (Fig. 1A). As detected by FCM, the positive rate of CD29 and CD90 was >90%, and the positive rate of CD31 and CD45 was <2%, indicating that the purity of P3 BMSCs was high (data not shown). After 3 weeks in culture, purified BMSCs exhibited osteogenic and adipogenic differentiation (Fig. 1B and C), indicating that the obtained, high-purity BMSC-GFP cells exhibited differentiation abilities and were suitable for cell therapy. BMSC-GFP cells exhibited 100% overlap of GFP and blue nuclei under a fluorescence microscope (Fig. 1D-F).
Figure 1

Identification of BMSC morphology and differentiation functions. (A) BMSCs were observed under a microscope at magnification ×100. (B) BMSCs cultured in osteogenic medium for 3 weeks. Dark brown calcium nodules stained by alizarin red were observed at magnification, ×400. (C) BMSCs cultured in adipogenic medium for 3 weeks. Brown lipid droplets stained by oil red O were observed at magnification, ×400. BMSCs-GFP cells exhibited (D) blue nuclei stained by DAPI and (E) GFP labeled actin cytoskeleton under a fluorescence microscope at magnification, ×400. (F) Merged of (D) and (E) indicates 100% overlap between GFP (green) and DAPI (blue). BMSC, bone mesenchymal stem cells; GFP, green fluorescence protein.

HP modulates BMSC viability and cell apoptosis rate in vitro

CCK-8 results indicated that 100 µM CoCl2 did not block cell proliferation, but did decrease the cell proliferation rate. Compared with the BMSC group, the H-BMSC group indicated a significant decrease in cell viability at 6, 12, 24 and 48 h (Fig. 2A; P<0.05). The overall apoptosis rate was the sum of the early apoptosis and late apoptosis rates. CoCl2 regulated the apoptosis rate of BMSCs in a time-dependent manner (Fig. 2B). FCM detection results demonstrated that after 48 h of 100 µM CoCl2 preconditioning, the apoptosis rate of the H-BMSC group was ~27.5±2.8%, which was increased significantly compared with that of the BMSC group, particularly the late apoptosis rate (Fig. 2B; P<0.05). The apoptosis rate of H-BMSCs was significantly increased in the 24 h group, and the apoptosis rate was 12.2±2.7%. Based on cell viability and apoptosis rate results, 100 µM CaCl2 for 24 h was selected as the experimental model of chemical HP of BMSCs. Under this condition, HP exerted a significant effect on BMSC proliferation and apoptosis rate. To determine the vulnerability of H-BMSCs to SDM, BMSCs were cultured with 100 µM CoCl2 for 24 h and challenged with SDM for 24 h. The FCM detection results indicated that HP significantly increased BMSC tolerance to SDM (Fig. 2C; P<0.05).
Figure 2

HP modulates BMSC viability and cell apoptosis rate in vitro. (A) Cell proliferation in the BMSC and H-BMSC groups after 0, 6, 12, 24 and 48 h of HP or normal conditions. (B) BMSC apoptosis rate after 6, 12, 24 and 48 h of HP. (C) The apoptosis rate after 24 h of SDM in the BMSC and H-BMSC groups. *P<0.05 vs. BMSC group; #P<0.05 vs. 6-h group; &P<0.05 vs. 24-h group. Data are presented as the mean ± standard deviation (n=9). HP, hypoxic preconditioning; BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC; SDM, serum-deprived medium.

HP increases BMSC migration

The Transwell experiment revealed that HP significantly increased BMSC migration rates. When BMSCs were cultured for 6 h in the Transwell system, only a small number of BMSCs in the BMSC group passed through the 8 µm membrane. Compared with the BMSC group, the H-BMSC group exhibited a significantly increased number of BMSCs passing through the membrane (Fig. 3A and B; P<0.05). With increased culture times, significantly more cells passed through the membrane in the two groups, and the number of H-BMSCs was significantly increased compared with that of BMSCs after 12 h in culture (Fig. 3C and D; P<0.05). After 24 h in culture, an increased number of cells passed through the membrane in the two groups, but the difference was nonsignificant (Fig. 3E and F; P>0.10), indicating that the majority of the cells had passed through the membrane in the two groups at 24 h. Therefore, HP significantly increased the rate of BMSC migration.
Figure 3

Hypoxic preconditioning improves BMSC migration. Bright dots represent the 8.0 µm pore size polycarbonate inserts, and the cells stained by crystal violet were the migrated cells. Cell migration in the (A) BMSC group and (B) H-BMSC group at 6 h, (C) BMSC group and (D) H-BMSC group at 12 h and (E) BMSC group and (F) H-BMSC group at 24 h. (G) The number of migrated cells in the two groups at different times. Data are presented as the mean ± standard deviation. *P<0.05 vs. BMSC group (n=9). BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC.

HP decreases the expression of caspase-3 mRNA and increases the expression of Bcl-2, HIF-1α and CXCR4 mRNA in BMSCs

The mRNA expression levels of caspase-3, Bcl-2, HIF-1α and CXCR4 in BMSCs was determined using RT-qPCR. HIF-1α and its downstream gene CXCR4 are the key factors involved in BMSC migration and homing (45,46). The expression of HIF-1α and CXCR4 was studied in BMSCs to determine how HP affected migration and homing. After 24 h of HP, the expression of HIF-1α and CXCR4 in H-BMSCs was markedly increased (Fig. 4A; P<0.05). As caspase-3 and Bcl-2 activation is a key step in apoptosis, the mRNA content of caspase-3 and Bcl-2 was analyzed to determine whether HP affected apoptosis through the regulation of the caspase-3/Bcl-2 pathway. Compared with the BMSC group, the H-BMSC group indicated a significant increase in mRNA expression of Bcl-2 (P<0.05), and a significant decrease in caspase-3 levels (Fig. 4B; P<0.05). These results indicated that HP may improve BMSC tolerance to SDM by regulating Bcl-2 and caspase-3 mRNA expression, and increase BMSC migration by upregulating HIF-1α and CXCR4 mRNA expression.
Figure 4

(A and B) Hypoxic preconditioning upregulates the mRNA expression of Bcl-2, HIF-1α and CXCR4 and suppresses the expression of caspase-3 in BMSCs. Data are presented as the mean ± standard deviation. *P<0.05 vs. BMSC group (n=9). Bcl-2, B-cell lymphoma 2; HIF-1α, hypoxia inducible factor 1α; CXCR4, C-X-C motif chemokine receptor 4; BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC.

H-BMSCs improves hind limb motor and sensory function following SCI

The recovery of hind limb motor function was evaluated by the BBB score, and sensory function was evaluated by the Reuter score 1 day prior to and 1, 3, 7, 14, 21 and 28 days after SCI (Fig. 5). SCI is able to notably decrease the BBB score and increase the Reuter score (47). The BBB and Reuter scores exhibited progressive increases in all groups over time, particularly during the first 2 weeks, indicating natural hind limb motor and sensory function improvement following SCI in rats. Administration of BMSCs significantly increased BBB scores and decreased Reuter scores (P<0.05). The BBB score in the H-BMSC group was significantly increased compared with that in the BMSC group at 28 days (P<0.05), whereas the Reuter score in the H-BMSC group was significantly decreased compared with that in the BMSC group at 28 days (P<0.05). The BBB and Reuter scores indicated that HP may significantly increase BMSC-mediated improvement in motor and sensory function recovery in SCI rats.
Figure 5

H-BMSCs improve hind limb motor and sensory function following SCI. (A) The BBB score following SCI. (B) The Reuter score following SCI. All data are expressed as the mean ± standard error of the mean (n=15). *P<0.05 vs. SCI group; #P<0.05 vs. BMSC group. BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC; SCI, spinal cord injury; BBB, Basso Beattie Bresnahan.

Histopathological analysis

At 72 h after cell transplantation, HE staining revealed hemorrhage, liquefaction and inflammatory cell infiltration in the middle of the spinal cord lesion in the SCI group. The spinal cord boundary between gray and white matter was unclear. The spinal cord tissue exhibited disordered nerve fibers with a large number of necrotic neuronal cells and atrophy. Granular and vacuolar degeneration was observed in the cytoplasm of neuronal cells (Fig. 6A). In the BMSC group, local hemorrhage and a few infiltrating inflammatory cells were observed in the injured spinal cord site. Some neuronal cells exhibited vacuolar degeneration and inflammatory cell infiltration (Fig. 6B). The number of neuronal and inflammatory cells in the H-BMSC group was decreased compared with that in the BMSC group (Fig. 6C). At 28 days after cell transplantation, the spinal cord cavity was observed in the SCI group. The spinal cord boundary between gray and white matter was unclear, with inflammatory cell infiltration (Fig. 6D). In the BMSC and H-BMSC groups, the spinal cord cross-sectional cavity area was smaller, with less inflammatory cell infiltration (Fig. 6E and F). Administration of BMSCs decreased the rate of cell death, hemorrhage and inflammatory cell infiltration at the spinal cord lesion site. The cross-sectional cavity area in the H-BMSC group was smaller compared with that in the BMSC group. Histopathological results indicated that HP may significantly improve the ability of BMSCs to repair spinal cord tissue in SCI rats.
Figure 6

H-BMSC treatment attenuates hemorrhage, inflammatory cell infiltration (72 h) and syringomyelia (28 day) in the spinal lesion site. The spinal cord at 72 h after cell transplantation in the (A) SCI, (B) BMSC and (C) H-BMSC groups. The spinal cord at 28 days after cell transplantation in the (D) SCI, (E) BMSC and (F) H-BMSC groups. All images at magnification, ×200. BMSC group. BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC; SCI, spinal cord injury.

H-BMSCs suppress microglial activation-associated inflammation

IL-1β, TNF-α and IL-6 content was detected at 72 h after cell transplantation to determine the level of spinal cord inflammation by ELISA (Fig. 7E-G). As major indicators of inflammation, the levels of TNF-α, IL-1β and IL-6 in SCI rats were significantly increased compared with those in sham rats (P<0.05). TNF-α, IL-1β and IL-6 content was significantly decreased following treatment with BMSCs and significantly decreased in the H-BMSC group compared with in the BMSC group (P<0.05). BMSCs regulate the immune response by suppressing immune cell proliferation and inflammation in a number of diseases, including cerebral ischemia and SCI (10). The activation of microglia serves a critical role in the pathological development of SCI (48). To study the role of H-BMSCs in inflammation, microglia in spinal cord lesions were examined using immunofluorescence 72 h after cell transplantation (Fig. 7A-D). The number of Iba-1-positive microglia in the SCI group was increased compared with that in the sham group (P<0.05). The number of microglia in the BMSC and H-BMSC groups was significantly decreased compared with that in the SCI group (Fig. 7H; P<0.05). Therefore, microglial activation following SCI was inhibited by BMSCs and H-BMSCs, but the inhibitory effect of H-BMSCs was more marked compared with that of BMSCs. This result supported the hypothesis that HP may reinforce the anti-inflammatory ability of BMSCs.
Figure 7

H-BMSCs suppresses microglial activation associated with inflammation. (A-D) Immunofluorescence staining for Iba-1 positive cells (microglia, red) 72 h after cell transplantation in the (A) blank, (B) SCI, (C) BMSC and (D) H-BMSC groups. Magnification, ×100. The spinal cord inflammatory content of (E) IL-1β, (F) TNF-α and (G) IL-6 determined by ELISA 72 h after cell transplantation. (H) The quantitative data for Iba-1-positive microglia in the spinal cord. *P<0.05 vs. sham group; #P<0.05 vs. SCI group; &P<0.05 vs. BMSC group (n=5). BMSC group. BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC; Iba-1, Allograft inflammatory factor; IL-1β, interleukin 1β; TNF-α, tumor necrosis factor α; IL-6, interleukin 6; SCI, spinal cord injury.

HP improve BMSC survivability and migration in spinal cord lesions

The number and migration rates of BMSCs into the damaged spinal cord were observed and measured 72 h after cell administration (Fig. 8). GFP-positive cells were used to identify engrafted BMSCs in the spinal cord lesion. The number and migratory capabilities of BMSCs were significantly increased by HP in the early stage of BMSCs administration (P<0.05). These results suggested that HP may enhance BMSC survival and migration in the early stage of BMSCs administration in spinal cord lesions.
Figure 8

Hypoxic preconditioning improves BMSC survival and migration in spinal cord lesions. (A) Nuclei staining by DAPI, (B) GFP-positive cells and (C) merged image of the BMSC group at magnification, ×200. (D) Nuclei staining by DAPI, (E) GFP-positive cells and (F) merged image of the H-BMSC group at magnification, ×200. (G) GFP-cell counts. *P<0.05 vs. sham group; &P<0.05 vs. BMSC group (n=5). GFP, green fluorescent protein; BMSC, bone mesenchymal stem cells; H-BMSC, hypoxic BMSC; SCI, spinal cord injury.

Discussion

The aim of present study was to validate the hypothesis that HP may increase the migration rate of transplanted BMSCs into the injured spinal cord and facilitate functional recovery. To select a suitable hypoxic treatment condition at the cellular level, BMSCs were pretreated with 100 µM CoCl2 for different periods of time. Cell viability by HP was detected by CCK-8, and cell apoptosis was detected by FCM. Based on the proliferation and apoptosis of BMSCs, it was determined that pretreatment with 100 µM CoCl2 for 24 h significantly improved cell migration and SDM tolerance; therefore, this pretreatment was selected for the HP condition. The molecular mechanism of the effect of HP on BMSCs was then studied, and it was identified that HP may regulate the expression of caspase-3 and Bcl-2, which are involved in a key cell apoptosis pathway. Previous studies of migration-associated pathways indicated that HP may improve the migration of BMSCs by promoting the expression of HIF-1α and CXCR4 (45,46). The effect of HP on BMSC migration and apoptosis in vitro provided the theoretical basis for using H-BMSCs in the treatment of SCI in vivo. To study H-BMSC transplantation by ICT in SCI rats, hind limb motor function recovery, spinal cord histopathology, BMSC survivability and migration, inflammation and microglial activation in the damaged spinal cords were assessed. BMSC transplantation by ICT effectively treated SCI, and this result was consistent with previous studies (24,26,27). In the in vivo study, the effects of H-BMSC treatment on SCI was better compared with that of BMSC treatment, which is consistent with the results in vitro. Transplantation of H-BMSCs by ICT improved motor function in SCI rats by improving the migration of implanted cells and neurogenesis in vivo. Stem cell treatment of SCI has been widely studied and has created new possibilities for regenerative medicine in previous decades. Stem cells may provide an inexhaustible source of neurons and glia and exert neuroprotective effects on host tissue (49-52). Several stem cells are considered candidates for the treatment of SCI, including embryonic stem cells (53), olfactory ensheathing glial cells (54), Schwann cells (55) and BMSCs (51). BMSCs are able to be isolated, easily expanded in vitro and differentiated into chondrocytes, osteocytes, muscle cells and adipocytes. As BMSCs are multipotent and plastic, they are attractive cells for use in regenerative medicine, particularly for the development of neuroprotective and neurorestorative treatment. BMSCs were selected as the seed cells in the present study. The majority of previous animal studies used intralesional transplantation, which is an invasive technique that compromises the injured spinal cord, although it delivers cells into the hostile environment of the acutely injured cord. Studies in animal models have indicated that the best method for cell delivery in SCI is ICT, which is safer, simpler and more effective (24,26,27). Therefore, the present study elected to graft BMSCs by ICT. With ICT, BMSCs are indirectly transplanted into the cerebrospinal fluid by lumbar puncture. Clinical trials (no. NCT00695149) have confirmed the safety of clinical transplantation of cells by ICT (56,57). Although cells are safely transplanted by ICT, the effectiveness of cell delivery to the injured spinal cord is as low as 4.1% at 4 days and 3.4% at 21 days (27). Therefore, the limited, ineffective delivery of cells via ICT requires signifi-cant improvement. In addition, the greatest barrier to cell transplantation is the contradictory information regarding the optimal cell-transplantation time and unique environment of acute SCI (58). Primary traumatic SCI induces the release of reactive oxygen species (ROS) and inflammatory factors that may result in the activation of microglia. Microglia located throughout the central nervous system (CNS) are special glial cells with various important functions in response to environmental changes in the spinal cord. Excessive microglial activation releases ROS and inflammatory cytokines, which may lead to more serious secondary SCI (59) and decrease the survival rate, secretory and differentiation abilities of transplanted cells (12). To the best of our knowledge, there has only been one previous study examining HP of BMSC for SCI, which identified that HP effectively increased the protective effects of BMSCs on neurological function, tissue damage and inhibited apoptosis following SCI (22). However, the authors did not examine the survival and migration of transplanted cells and associated molecular mechanisms. In the present study, the capability of strategies involving HP combined with BMSC to improve the survival, migratory and homing abilities of transplanted cells were assessed in an SCI model. Transplantation of H-BMSCs improved SCI rat motor function by enhancing the survival and migration rates of implanted cells in vivo and in vitro. The use of female rats as an animal model of spinal cord injury in this experiment is due to the severe voiding dysfunction commonly observed following spinal cord injury in rats (60-63). This severe urinary dysfunction may increase the mortality rate and affect behavior of rats (60-63). As the urethra of female rats is shorter compared with that of male rats, urination recovery and abdominal massage may be easier following SCI in female rats. Therefore, female rats were selected as an animal model of spinal cord injury to minimize the experimental error caused by urinary dysfunction that occurred when not using female rats alone, as observed in previous studies (47,64,65). In the early stage of spinal cord injury (1 week) in the present study, the rats received abdominal massages every 6 h to assist with emptying their bladders until independent urination was possible. The effect of the rat estrous cycle on the recovery of neurological function following spinal cord injury is a notable and worthwhile question. A study regarding the role of gender factors in the recovery of nerve function following spinal cord injury in rats has been conducted (66). The results indicated that the recovery of motor function in female rats is improved compared with that in male rats. The reason for this improved recovery in female rats is probably due to the relatively high level of estrogen, which may inhibit cell apoptosis and reduce secondary injury (66). Therefore, it remains unclear whether urethral length or gender exhibits a greater effect on the rats following SCI. CoCl2 is a traditional chemical hypoxia inducer (67-70). The hypoxic mechanism of CoCl2 involves the replacement of Fe2+ by Co2+ in hemoglobin, changing hemoglobin to a deoxi-dized state. In this state, the cells appear hypoxic in a normoxic environment (71). The hypoxic environment induced by CoCl2 is widely used due to of the advantages of simple use and easy, precise control of treatment conditions. Therefore, CoCl2 was used to establish HP in vitro. However, a CoCl2-induced, low-oxygen environment has certain limitations. While there is no evidence that CoCl2 accumulates in cells, BMSCs may be affected by residual cobalt salts in vitro and in vivo when CoCl2 is used. Therefore, following hypoxic pretreatment of BMSCs, the cells were repeatedly rinsed with normal medium to minimize the effect of residual CoCl2 in the culture medium on the results. The mechanism of CoCl2-induced hypoxia is the expression of HIF and its regulatory gene expression in Co2+-induced cells (72). In addition, as a stable activator of the HIF pathway, CoCl2 stimulation increases the expression of CXCR4 and other downstream products of HIF-1 (73). CXCR4, a downstream gene of HIF-1, and its ligand stromal cell-derived factor 1 are considered key factors for BMSC migration (74). The homing ability of BMSCs is affected by cell culture conditions, and directly-injected fresh BMSCs may migrate well to damaged sites (75). If the cells are cultured for 24 h in normoxic conditions, the migration and homing ability of BMSCs markedly decreases (75). Concurrently, the number of adhesion molecules on the surface of BMSCs, including CXCR4, gradually decrease, and the ability to respond to chemokines also decreases (75). Therefore, the conventional culture process in vitro may decrease the migration and homing of BMSCs, which were transplanted into the SCF, to the injured spinal cord. Hypoxia promotes high expression of CXCR4 in tumor cells and leads to deterioration of tumor metastasis. HP may promote BMSC migration, homing and colonization to the spinal cord lesion by increasing the expression of CXCR4 on the surface of BMSCs through the HIF-1 pathway, which was preliminarily confirmed in the present study. The optimal HP condition should follow the principle that HP should exert a slight effect on cell viability, improve migration and significantly increase cell tolerance to damage (76). Based on the cell viability and apoptosis rate results from the present study, exposure to 100 µM CoCl2 in culture for 24 h was selected as the optimal choice for HP. On the one hand, problems including cell differentiation and aging due to long pretreatment and culture may be prevented by reducing the hypoxia pretreatment time (76,77). Conversely, the dose-dependent HP efficiency of CoCl2 may be improved by increasing the concentration of CoCl2 (78). It may be more appropriate to select a higher concentration of CoCl2 for a shorter period of time. In addition, appropriate HP should not significantly decrease cell viability or increase cell apoptosis. Hypoxia not only affects cell viability and function, but also affects stem cell differentiation by regulating the expression of HIF-1α and other hypoxia-associated mRNAs (79,80). The results of the present study demonstrated HP induced adaptive metabolic changes in BMSCs that improved their migratory and healing abilities. H-BMSCs improved migratory and anti-injury abilities by regulating migration-associated genes (HIF-1α and CXCR4) and apoptosis-associated genes (caspase-3 and Bcl-2). These data were initially confirmed in the present study, but the specific mechanisms require additional investigation. In conclusion, H-BMSCs provide an effective method of improving SCI treatment by promoting BMSC migration and neuronal differentiation. The mechanisms of these therapeutic benefits are multifaceted and include improved migration rates by increasing the expression of HIF-1α and CXCR4 and decreased apoptosis rates by regulating the expression of caspase-3 and Bcl-2. HP may improve the migratory and neurogenerative abilities of BMSCs to repair SCI and promote their therapeutic potential for the treatment of SCI. Concomitantly, the survival and differentiation of transplanted H-BMSCs after 28 days will be investigated in future studies.
  79 in total

1.  [Effects of electro-acupuncture on neuronal apoptosis and associative function in rats with spinal cord injury].

Authors:  Chang-ming Li; Shang-ju Xie; Tuo Wang; Wei-bin Du; Zhong-bao Yang; Ren-fu Quan
Journal:  Zhongguo Gu Shang       Date:  2015-08

2.  Trends in Traumatic Spinal Cord Injury.

Authors:  Shalini Selvarajah; Edward R Hammond; Eric B Schneider
Journal:  JAMA       Date:  2015-10-20       Impact factor: 56.272

Review 3.  Alternatively activated macrophages in spinal cord injury and remission: another mechanism for repair?

Authors:  Taekyun Shin; Meejung Ahn; Changjong Moon; Seungjoon Kim; Ki-Bum Sim
Journal:  Mol Neurobiol       Date:  2013-01-16       Impact factor: 5.590

Review 4.  Transplantation and gene therapy: combined approaches for repair of spinal cord injury.

Authors:  M Murray; I Fischer
Journal:  Neuroscientist       Date:  2001-02       Impact factor: 7.519

5.  Grafting of human bone marrow stromal cells into spinal cord injury: a comparison of delivery methods.

Authors:  Courtney Paul; Amer F Samdani; Randal R Betz; Itzhak Fischer; Birgit Neuhuber
Journal:  Spine (Phila Pa 1976)       Date:  2009-02-15       Impact factor: 3.468

6.  Minimally invasive delivery of stem cells for spinal cord injury: advantages of the lumbar puncture technique.

Authors:  Ajay Bakshi; Corey Hunter; Sharon Swanger; Angelo Lepore; Itzhak Fischer
Journal:  J Neurosurg Spine       Date:  2004-10

7.  Bone Marrow Stromal Cell Intraspinal Transplants Fail to Improve Motor Outcomes in a Severe Model of Spinal Cord Injury.

Authors:  John H Brock; Lori Graham; Eileen Staufenberg; Eileen Collyer; Jacob Koffler; Mark H Tuszynski
Journal:  J Neurotrauma       Date:  2015-11-13       Impact factor: 5.269

Review 8.  Bone marrow stromal cells (BMSCs) in bone engineering: limitations and recent advances.

Authors:  Anna R Derubeis; Ranieri Cancedda
Journal:  Ann Biomed Eng       Date:  2004-01       Impact factor: 3.934

Review 9.  Bone marrow stromal cells for spinal cord repair: a challenge for contemporary neurobiology.

Authors:  J Vaquero; M Zurita
Journal:  Histol Histopathol       Date:  2009-01       Impact factor: 2.303

Review 10.  Points regarding cell transplantation for the treatment of spinal cord injury.

Authors:  Chizuka Ide; Kenji Kanekiyo
Journal:  Neural Regen Res       Date:  2016-07       Impact factor: 5.135

View more
  8 in total

Review 1.  Enhancing the Therapeutic Potential of Mesenchymal Stem Cells with the CRISPR-Cas System.

Authors:  Daniel Mendes Filho; Patrícia de Carvalho Ribeiro; Lucas Felipe Oliveira; Ana Luiza Romero Terra Dos Santos; Ricardo Cambraia Parreira; Mauro Cunha Xavier Pinto; Rodrigo Ribeiro Resende
Journal:  Stem Cell Rev Rep       Date:  2019-08       Impact factor: 5.739

2.  Hypoxia-Preconditioned Placenta-Derived Mesenchymal Stem Cells Rescue Optic Nerve Axons Via Differential Roles of Vascular Endothelial Growth Factor in an Optic Nerve Compression Animal Model.

Authors:  Heejung Kwon; Mira Park; Sarmila Nepali; Helen Lew
Journal:  Mol Neurobiol       Date:  2020-06-10       Impact factor: 5.682

3.  Hypoxia preconditioning promotes bone marrow mesenchymal stem cells survival by inducing HIF-1α in injured neuronal cells derived exosomes culture system.

Authors:  Zucheng Luo; Fangfang Wu; Enxing Xue; Linlin Huang; Ping Yan; Xiaoyun Pan; Yulong Zhou
Journal:  Cell Death Dis       Date:  2019-02-12       Impact factor: 8.469

4.  Hypoxia-Inducible Factor 1α (HIF-1α) Counteracts the Acute Death of Cells Transplanted into the Injured Spinal Cord.

Authors:  Brian T David; Jessica J Curtin; David C Goldberg; Kerri Scorpio; Veena Kandaswamy; Caitlin E Hill
Journal:  eNeuro       Date:  2020-05-11

5.  Exosomes Derived from Baicalin-Pretreated Mesenchymal Stem Cells Alleviate Hepatocyte Ferroptosis after Acute Liver Injury via the Keap1-NRF2 Pathway.

Authors:  Shuxian Zhao; Mengxin Huang; Lili Yan; Hao Zhang; Chenchen Shi; Jing Liu; Shousong Zhao; Hongbo Liu; Baogui Wang
Journal:  Oxid Med Cell Longev       Date:  2022-07-21       Impact factor: 7.310

Review 6.  The Comparative Effects of Mesenchymal Stem Cell Transplantation Therapy for Spinal Cord Injury in Humans and Animal Models: A Systematic Review and Meta-Analysis.

Authors:  Louis D V Johnson; Mark R Pickard; William E B Johnson
Journal:  Biology (Basel)       Date:  2021-03-16

Review 7.  Regulatory Role of Mesenchymal Stem Cells on Secondary Inflammation in Spinal Cord Injury.

Authors:  Qi-Ming Pang; Si-Yu Chen; Sheng-Ping Fu; Hui Zhou; Qian Zhang; Jun Ao; Xiao-Ping Luo; Tao Zhang
Journal:  J Inflamm Res       Date:  2022-01-26

Review 8.  Neuroprotective effects and mechanisms of ischemic/hypoxic preconditioning on neurological diseases.

Authors:  Jia Liu; Yakun Gu; Mengyuan Guo; Xunming Ji
Journal:  CNS Neurosci Ther       Date:  2021-08       Impact factor: 5.243

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.