| Literature DB >> 30087611 |
Benjamin Berger1,2, Fabio Bachmann1,2, Urs Duthaler1,2, Stephan Krähenbühl1,2,3, Manuel Haschke4,5.
Abstract
Metoprolol is used for phenotyping of cytochrome P450 (CYP) 2D6, a CYP isoform considered not to be inducible by inducers of the CYP2C, CYP2B, and CYP3A families such as rifampicin. While assessing CYP2D6 activity under basal conditions and after pre-treatment with rifampicin in vivo, we surprisingly observed a drop in the metoprolol/α-OH-metoprolol clearance ratio, suggesting CYP2D6 induction. To study this problem, we performed in vitro investigations using HepaRG cells and primary human hepatocytes (before and after treatment with 20 μM rifampicin), human liver microsomes, and CYP3A4-overexpressing supersomes. While mRNA expression levels of CYP3A4 showed a 15- to 30-fold increase in both cell models, mRNA of CYP2D6 was not affected by rifampicin. 1'-OH-midazolam formation (reflecting CYP3A4 activity) increased by a factor of 5-8 in both cell models, while the formation of α-OH-metoprolol increased by a factor of 6 in HepaRG cells and of 1.4 in primary human hepatocytes. Inhibition studies using human liver microsomes showed that CYP3A4, 2B6, and 2C9 together contributed 19.0 ± 2.6% (mean ± 95%CI) to O-demethylation, 4.0 ± 0.7% to α-hydroxylation, and 7.6 ± 1.7% to N-dealkylation of metoprolol. In supersomes overexpressing CYP3A4, metoprolol was α-hydroxylated in a reaction inhibited by the CYP3A4-specific inhibitor ketoconazole, but not by the CYP2D6-specific inhibitor quinidine. We conclude that metoprolol is not exclusively metabolized by CYP2D6. CYP3A4, 2B6, and 2C9, which are inducible by rifampicin, contribute to α-hydroxylation, O-demethylation, and N-dealkylation of metoprolol. This contribution is larger after CYP induction by rifampicin but is too small to compromise the usability of metoprolol α-hydroxylation for CYP2D6 phenotyping.Entities:
Keywords: CYP induction; CYP2D6; metoprolol; phenotyping; α-OH-metoprolol
Year: 2018 PMID: 30087611 PMCID: PMC6066528 DOI: 10.3389/fphar.2018.00774
Source DB: PubMed Journal: Front Pharmacol ISSN: 1663-9812 Impact factor: 5.810
Gene-specific primers for rt-PCR.
| Target Gene | Organism | Primer Sequence (5′ → 3′) | Length (bp) | |
|---|---|---|---|---|
| CYP2D6 | human | Fw | TGTGCCCATCACCCAGAT | 18 |
| Rev | AAGGTGGAGACGGAGAAGC | 19 | ||
| CYP3A4 | human | Fw | TACACAAAAGCACCGAGTGG | 20 |
| Rev | TGCAGTTTCTGCTGGACATC | 20 | ||
| HPRT1 | human | Fw | GGTCCTTTTCACCAGCAAGCT | 21 |
| Rev | TGACACTGGCAAAACAATGCA | 21 | ||
| GAPDH | human | Fw | AGCCACATCGCTCAGACAC | 19 |
| Rev | GCCCAATACGACCAAATCC | 19 | ||
Metoprolol metabolism by human liver microsomes in the absence (w/o) and presence of inhibitors.
| Metabolite formed | w/o inhibitor fmol/min/pmol CYP | with inhibitor fmol/min/pmol CYP | % residual activity (quinidine) or % inhibition (ketoconazole, ticlopidine, sulfaphenazole, (+)-N-3-benzylnirvanol) |
|---|---|---|---|
| O-demethyl-MTP | 17.5 ± 0.3 | 3.32 ± 0.40 | 19.0 ± 2.1 (2.6) |
| α-OH-MTP | 4.11 ± 0.06 | 0.16 ± 0.06 | 4.0 ± 0.6 (0.70) |
| MTP-phenylacetate | 0.91 ± 0.0.05 | 0 | 0 |
| N-dealkyl-MTP | 2.91 ± 0.06 | 0.22 ± 0.05 | 7.6 ± 1.7 (2.1) |
| O-demethyl-MTP | 26.6 ± 0.0.6 | 22.0 ± 0.0.8 | 17.5 ± 3.4 (4.3) |
| α-OH-MTP | 6.86 ± 0.0.23 | 5.71 ± 0.29 | 16.8 ± 2.4 (3.0) |
| N-dealkyl-MTP | 4.86 ± 0.29 | 4.38 ± 0.23 | 9.9 ± 1.7 (2.1) |
| O-demethyl-MTP | 30.3 ± 3.3 | 24.2 ± 0.34 | 20.2 ± 8.0 (9.9) |
| α-OH-MTP | 7.43 ± 1.14 | 5.71 ± 0.0.29 | 23.2 ± 11.1 (13.7) |
| N-dealkyl-MTP | 4.97 ± 1.03 | 3.74 ± 0.23 | 24.8 ± 12.7 (15.8) |
| O-demethyl-MTP | 27.7 ± 0.40 | 20.3 ± 2.4 | 26.5 ± 10.4 (13.2) |
| α-OH-MTP | 6.40 ± 0.23 | 4.67 ± 0.57 | 27.0 ± 9.8 (12.2) |
| N-dealkyl-MTP | 4.51 ± 0.0.46 | 3.83 ± 0.74 | 15.2 ± 14.5 (18.0) |
| O-demethyl-MTP | 25.8 ± 0.6 | 25.0 ± 1.43 | 3.1 ± 8.4 (10.4) |
| α-OH-MTP | 6.23 ± 0.23 | 6.23 ± 0.0.34 | 0 |
| N-dealkyl-MTP | 4.29 ± 0.17 | 4.29 ± 0.23 | 0 |