Michelle Palacios1, Taryn A Miner1, Daniel R Frederick1, Victoria E Sepulveda1, Joshua D Quinn1, Kimberly A Walker1, Virginia L Miller2,3. 1. Department of Microbiology and Immunology, University of North Carolina, Chapel Hill, North Carolina, USA. 2. Department of Microbiology and Immunology, University of North Carolina, Chapel Hill, North Carolina, USA vlmiller@med.unc.edu. 3. Department of Genetics, University of North Carolina, Chapel Hill, North Carolina, USA.
Abstract
Klebsiella pneumoniae is widely recognized as a pathogen with a propensity for acquiring antibiotic resistance. It is capable of causing a range of hospital-acquired infections (urinary tract infections [UTI], pneumonia, sepsis) and community-acquired invasive infections. The genetic heterogeneity of K. pneumoniae isolates complicates our ability to understand the virulence of K. pneumoniae Characterization of virulence factors conserved between strains as well as strain-specific factors will improve our understanding of this important pathogen. The MarR family of regulatory proteins is widely distributed in bacteria and regulates cellular processes such as antibiotic resistance and the expression of virulence factors. Klebsiella encodes numerous MarR-like proteins, and they likely contribute to the ability of K. pneumoniae to respond to and survive under a wide variety of environmental conditions, including those present in the human body. We tested loss-of-function mutations in all the marR homologues in a murine pneumonia model and found that two (kvrA and kvrB) significantly impacted the virulence of K1 and K2 capsule type hypervirulent (hv) strains and that kvrA affected the virulence of a sequence type 258 (ST258) classical strain. In the hv strains, kvrA and kvrB mutants displayed phenotypes associated with reduced capsule production, mucoviscosity, and transcription from galF and manC promoters that drive expression of capsule synthesis genes. In contrast, kvrA and kvrB mutants in the ST258 strain had no effect on capsule gene expression or capsule-related phenotypes. Thus, KvrA and KvrB affect virulence in classical and hv strains but the effect on virulence may not be exclusively due to effects on capsule production.IMPORTANCE In addition to having a reputation as the causative agent for hospital-acquired infections as well as community-acquired invasive infections, Klebsiella pneumoniae has gained widespread attention as a pathogen with a propensity for acquiring antibiotic resistance. Due to the rapid emergence of carbapenem resistance among K. pneumoniae strains, a better understanding of virulence mechanisms and identification of new potential drug targets are needed. This study identified two novel regulators (KvrA and KvrB) of virulence in K. pneumoniae and demonstrated that their effect on virulence in invasive strains is likely due in part to effects on capsule production (a major virulence determinant) and hypermucoviscosity. KvrA also impacts the virulence of classical strains but does not appear to affect capsule gene expression in this strain. KvrA and KvrB are conserved among K. pneumoniae strains and thus could regulate capsule expression and virulence in diverse strains regardless of capsule type.
Klebsiella pneumoniae is widely recognized as a pathogen with a propensity for acquiring antibiotic resistance. It is capable of causing a range of hospital-acquired infections (urinary tract infections [UTI], pneumonia, sepsis) and community-acquired invasive infections. The genetic heterogeneity of K. pneumoniae isolates complicates our ability to understand the virulence of K. pneumoniae Characterization of virulence factors conserved between strains as well as strain-specific factors will improve our understanding of this important pathogen. The MarR family of regulatory proteins is widely distributed in bacteria and regulates cellular processes such as antibiotic resistance and the expression of virulence factors. Klebsiella encodes numerous MarR-like proteins, and they likely contribute to the ability of K. pneumoniae to respond to and survive under a wide variety of environmental conditions, including those present in the human body. We tested loss-of-function mutations in all the marR homologues in a murinepneumonia model and found that two (kvrA and kvrB) significantly impacted the virulence of K1 and K2 capsule type hypervirulent (hv) strains and that kvrA affected the virulence of a sequence type 258 (ST258) classical strain. In the hv strains, kvrA and kvrB mutants displayed phenotypes associated with reduced capsule production, mucoviscosity, and transcription from galF and manC promoters that drive expression of capsule synthesis genes. In contrast, kvrA and kvrB mutants in the ST258 strain had no effect on capsule gene expression or capsule-related phenotypes. Thus, KvrA and KvrB affect virulence in classical and hv strains but the effect on virulence may not be exclusively due to effects on capsule production.IMPORTANCE In addition to having a reputation as the causative agent for hospital-acquired infections as well as community-acquired invasive infections, Klebsiella pneumoniae has gained widespread attention as a pathogen with a propensity for acquiring antibiotic resistance. Due to the rapid emergence of carbapenem resistance among K. pneumoniae strains, a better understanding of virulence mechanisms and identification of new potential drug targets are needed. This study identified two novel regulators (KvrA and KvrB) of virulence in K. pneumoniae and demonstrated that their effect on virulence in invasive strains is likely due in part to effects on capsule production (a major virulence determinant) and hypermucoviscosity. KvrA also impacts the virulence of classical strains but does not appear to affect capsule gene expression in this strain. KvrA and KvrB are conserved among K. pneumoniae strains and thus could regulate capsule expression and virulence in diverse strains regardless of capsule type.
Klebsiella pneumoniae is a Gram-negative bacterium capable of causing a wide range of infections such as urinary tract infections (UTI), sepsis, liver abscesses, and pneumonia (1–6). Capsule, lipopolysaccharide (LPS), adhesion factors, and siderophores frequently emerge as the primary K. pneumoniae virulence determinants, with capsule being the most extensively studied. Currently, 134 capsule types have been identified in K. pneumoniae (7). One trait strongly associated with virulence in Klebsiella is the overproduction of capsule, which contributes to a hypermucoviscosity (HMV) phenotype (5, 8). HMV strains are “string test” positive and tend to be hypervirulent (hv) (8, 9). Our relatively limited knowledge of conserved virulence determinants and the high diversity of surface polysaccharides pose challenges for developing vaccines and new therapeutics (10–12).While first characterized for its role in antibiotic resistance in Escherichia coli (13, 14), the MarR (multiple antibiotic resistance regulator) family of transcriptional regulators is known to regulate the expression of genes encoding proteins involved in metabolic pathways, stress responses, and virulence factors (14–20). These proteins are characterized by a winged helix-turn-helix DNA binding domain and can both positively and negatively affect gene expression (21, 22). Transcriptional regulation by these proteins often results in modifications of the bacterial cell surface (23), and several MarR family members have been linked to virulence in the Enterobacteriaceae. In Salmonella, SlyA regulates Salmonella pathogenicity island-2 genes and contributes to resistance to oxidative stress, bacterial survival within macrophages, and bacterial survival in a murine model of infection (17, 18, 23–26). RovA, a member of the MarR/SlyA family, regulates expression of inv (an adhesion and invasion factor) in the enteric pathogens Yersiniaenterocolitica and Yersinia pseudotuberculosis (27–29) as well as expression of the psa locus of Yersinia pestis, the causative agent of bubonic and pneumonic plague (30).An in silico comparative study found the copy number of marR-like genes to range from 2 to 11 within the Enterobacteriaceae, with an average of 5.9 genes (22). That same study identified some K. pneumoniae strains that have as many as 11 marR homologues (22). We hypothesize that this high number of marR-like genes contributes to the ability of K. pneumoniae to survive in a wide variety of environments, including the human host, and that a subset of these genes regulates expression of virulence phenotypes.In this report, we describe the contribution of the MarR family to K. pneumoniae virulence in a murinepneumonia model. Strain KPPR1S (31), a derivative of ATCC 43816, was found to contain nine marR-like genes (32). We constructed insertion disruption mutations in each of the marR homologues of strain KPPR1S and tested them in our pneumonia model. Two of these genes, designated kvrA and kvrB, affected virulence. The impact of KvrA and KvrB on virulence in this hv strain is likely due at least in part to their effect on expression of capsule genes and the HMV phenotype. Importantly, these roles were conserved in another hv
K. pneumoniae strain that produces a different capsule type, and kvrA is required for full virulence of a sequence type 258 (ST258) classical strain.
RESULTS
Two marR-like genes contribute to K. pneumoniae virulence.
The MarR family of transcriptional regulators has been implicated in virulence in several members of the Enterobacteriaceae (17, 21, 24, 30, 33, 34). Klebsiella species contain more than the average number of marR-like genes, and we hypothesize that some members of this family are important for adaptation of K. pneumoniae in the mammalian host. Thus, we screened the genome of KPPR1S (wild-type [WT] strain) for putative marR genes and constructed loss-of-function mutants for each of the nine marR homologues identified. Growth curves (determined using optical density at 600 nm [OD600] and CFU counts per milliliter) indicated that none of the mutants displayed a growth defect in vitro in Luria-Bertani (LB) medium (data not shown). To assess the effects on virulence, mice were intranasally (i.n.) infected with the WT strain or with each mutant individually and sacrificed at 48 h postinoculation (hpi) for bacterial enumeration. Two mutants, VK055_0496 and VK055_4504, displayed a decrease in bacterial burden in the lungs of infected mice compared to WT-infectedmice (Fig. 1A). The spleens of mice infected with the WT had nearly 106 CFU/g of tissue, while the VK055_0496 mutant was barely detectable (Fig. 1A).
FIG 1
Members of the marR family contribute to virulence in a mouse model of pneumonia. Mice were inoculated i.n. with 2 × 104 CFU of the indicated strains. At the indicated times, mice were euthanized, and the lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate CFU counts that were below the limit of detection. These data are from an individual representative experiment. The Mann-Whitney test was used for statistical analyses comparing each mutant to the WT. *, P < 0.05; **, P < 0.01. (A) Single-time-point (48 hpi) analyses of screen marR family mutants for virulence defects. (B) Kinetic analyses of the WT, ΔkvrA (VK277), ΔkvrB (VK410), kvrA complemented (VK278), and kvrB complemented (VK417) strains. (C) Single-time-point (90 min postinfection [mpi]) analyses of the WT, ΔkvrA (VK277), and ΔkvrB (VK410) strains.
Members of the marR family contribute to virulence in a mouse model of pneumonia. Mice were inoculated i.n. with 2 × 104 CFU of the indicated strains. At the indicated times, mice were euthanized, and the lungs and spleens were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate CFU counts that were below the limit of detection. These data are from an individual representative experiment. The Mann-Whitney test was used for statistical analyses comparing each mutant to the WT. *, P < 0.05; **, P < 0.01. (A) Single-time-point (48 hpi) analyses of screen marR family mutants for virulence defects. (B) Kinetic analyses of the WT, ΔkvrA (VK277), ΔkvrB (VK410), kvrA complemented (VK278), and kvrB complemented (VK417) strains. (C) Single-time-point (90 min postinfection [mpi]) analyses of the WT, ΔkvrA (VK277), and ΔkvrB (VK410) strains.On the basis of our initial screen, we determined that VK055_0496 and VK055_4504 are important for infection of the lung and named these regulators KvrA and KvrB (
virulence regulator), respectively. Further kinetics experiments using in-frame deletion mutants of kvrA (VK277) and kvrB (VK410) indicated that at 24 hpi, the ΔkvrA mutant was barely detectable in the lung whereas mice infected with the ΔkvrB mutant had ~1-log-lower levels of CFU/g than the WT. By 72 hpi, the bacterial burdens of mice infected with the WT had increased several logs, but the ΔkvrA mutant was undetectable, and the bacterial burden of the ΔkvrB mutant remained comparable to that seen at 24 hpi (Fig. 1B). The spleens of ΔkvrA mutant-infected mice had few recoverable CFU at either 24 or 72 hpi, while the mice infected with the ΔkvrB mutant had splenic burdens that were more than 2 logs lower than the levels seen with the mice infected with the WT at 72 hpi (Fig. 1B). To test if the survival defect of the mutants was due to an inability to reach the lung, mice were infected with the WT or ΔkvrA or ΔkvrB strain and the lungs were harvested at 90 min postinoculation. The three strains displayed comparable bacterial burdens in the lungs at that early time point, suggesting that the ability of the mutants to initially reach the lungs was not impacted (Fig. 1C). Subsequent analysis indicated that the virulence defect of the ΔkvrA and ΔkvrB mutants could be attributed to the loss of KvrA and KvrB, as demonstrated by complementation of the ΔkvrA and ΔkvrB mutants (Fig. 1B). Together, these results demonstrate that KvrA and KvrB contributed to K. pneumoniae virulence in a lung model of infection.
The ΔkvrA and ΔkvrB mutants induced an altered immune response.
Infection with K. pneumoniae is known to induce a significant inflammatory response marked by lung lesions and neutrophil infiltration (35–37). Neutrophils contribute to bacterial clearance of some K. pneumoniae strains but not others (38, 39). Neutrophils are considered important for clearance of ATCC 43816 (i.e., KPPR1S); however, high numbers of neutrophils also may be detrimental to host health (39). Inflammatory monocytes also are considered a primary cell type functioning in defense against K. pneumoniae (38). Consistent with the reduced number of CFU in the lung, infection of mice with the ΔkvrA and ΔkvrB mutants resulted in less inflammation than infection with the WT at 72 hpi (Fig. 2A). To more carefully examine the histological changes following infection, the lungs from mice inoculated with the WT or ΔkvrA or ΔkvrB strain or subjected to mock inoculation (1× phosphate-buffered saline [PBS]) were processed at 24 hpi for flow cytometric analysis. Infection with all three strains resulted in a significant increase in levels of neutrophils compared to the mock infection results (Fig. 2B). Although the infections with the two mutants resulted in elevated levels of neutrophils compared to the mock infection results, the increase in the levels of neutrophils was significantly lower than that seen with the WT. Among the cell populations examined, there was a 3-fold increase in the percentage of inflammatory monocytes in the mice infected with the ΔkvrA mutant compared to the mice infected with the WT (Fig. 2B). Inflammatory monocytes have been implicated in protection from K. pneumoniae (38), and the higher proportion of this cell type may have contributed to the rapid clearance of the ΔkvrA mutants.
FIG 2
Innate immune cell infiltration during K. pneumoniae infection. (A) H&E staining of mouse lungs inoculated with the WT strain, the ΔkvrA (VK277) mutant, or the ΔkvrB (VK410) mutant or PBS at 72 hpi. (B) Lungs were processed 24 hpi and evaluated by flow cytometry to identify innate immune cell populations. These data are from an individual representative experiment. Two-way ANOVA tests were performed for statistical analysis. **, P < 0.01; ***, P < 0.001.
Innate immune cell infiltration during K. pneumoniae infection. (A) H&E staining of mouse lungs inoculated with the WT strain, the ΔkvrA (VK277) mutant, or the ΔkvrB (VK410) mutant or PBS at 72 hpi. (B) Lungs were processed 24 hpi and evaluated by flow cytometry to identify innate immune cell populations. These data are from an individual representative experiment. Two-way ANOVA tests were performed for statistical analysis. **, P < 0.01; ***, P < 0.001.
The ΔkvrA and ΔkvrB mutants showed increased associations with murine BMDMs.
Because of the reduced bacterial burden of the ΔkvrA and ΔkvrB mutants in mice, we wanted to determine if these strains had altered interactions with murine macrophages. The ΔkvrA and ΔkvrB mutants were inoculated onto murine bone marrow-derived macrophages (BMDMs) in culture and were assessed for adherence to and internalization into these host-derived cells. A capsule mutant, manC (VK60), was included as a control as it is known to be more adherent and more readily phagocytosed than the WT (40, 41). Only about 3% of the WT bacteria adhered to the BMDMs, whereas more than 35% of the manC mutant bacteria were cell associated (Fig. 3A). The ΔkvrA and ΔkvrB mutants were 4-to-6-fold more adherent than the WT (19% and 16%, respectively). A similar trend was observed when these strains were assayed for internalization by BMDM in a gentamicin protection assay. About 1% of the WT and 7% of the manC bacteria were internalized, demonstrating the antiphagocytic properties of capsule (Fig. 3B). The ΔkvrA and ΔkvrB mutants were internalized at levels of about 3% and 2%, respectively. These intermediate adherence and internalization phenotypes suggest that the ΔkvrA and ΔkvrB strains have altered interactions with host cells.
FIG 3
Mutations in kvrA or kvrB affect adherence and uptake of K. pneumoniae in BMDMs. BMDMs were inoculated with the WT strain or ΔkvrA (VK277), ΔkvrB (VK410), or manC::Tn (VK060) mutant strain at an MOI of 50. Adherence (A) and internalization (B) were measured as described in Materials and Methods. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. *, P < 0.05; **, P < 0.01; ****, P < 0.0001.
Mutations in kvrA or kvrB affect adherence and uptake of K. pneumoniae in BMDMs. BMDMs were inoculated with the WT strain or ΔkvrA (VK277), ΔkvrB (VK410), or manC::Tn (VK060) mutant strain at an MOI of 50. Adherence (A) and internalization (B) were measured as described in Materials and Methods. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. *, P < 0.05; **, P < 0.01; ****, P < 0.0001.
KvrA and KvrB contribute to capsule production.
During mutant construction, we observed that colonies of the ΔkvrA and ΔkvrB mutants appeared to be less mucoid and less hypermucoviscous. Thus, we hypothesized that capsule production levels would be decreased in the mutants. Glucuronic acid is a key component of many different capsules, including the K2 capsule produced by KPPR1S. Measurement of uronic acid content is therefore frequently used to quantify capsule production (42, 43). We determined the uronic acid concentrations in the ΔkvrA and ΔkvrB mutants along with the WT and the manC mutant. The manC mutant produced about 1.5 µg uronic acid/OD600, which is about 25% of the level produced by the WT (Fig. 4A). The ΔkvrA and ΔkvrB mutants each produced uronic acid at only ~60% of the WT levels, indicating that these mutants produce less capsule than the WT.
FIG 4
Capsule production was reduced in the ΔkvrA and ΔkvrB mutants. WT, ΔkvrA (VK277), ΔkvrB (VK410), or manC::Tn (VK060) cultures were grown in LB for 6 h and subjected to (A) uronic acid quantification and (B) mucoviscosity analysis as described in Materials and Methods. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. ****, P < 0.0001.
Capsule production was reduced in the ΔkvrA and ΔkvrB mutants. WT, ΔkvrA (VK277), ΔkvrB (VK410), or manC::Tn (VK060) cultures were grown in LB for 6 h and subjected to (A) uronic acid quantification and (B) mucoviscosity analysis as described in Materials and Methods. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. ****, P < 0.0001.Mucoviscosity can be measured using a sedimentation assay (44, 45). HMV strains such as KPPR1S do not form tight pellets when centrifuged, and this can be quantified by measuring the OD600 of the supernatant following low-speed centrifugation. The OD600 of the WT was about 0.5, but the manC strain formed a tight pellet and the supernatant was essentially cleared, measuring 0.01 (Fig. 4B). The ΔkvrA and ΔkvrB mutants also formed tight pellets with cleared supernatants. These data, consistent with the reduced uronic acid levels, indicate that the ΔkvrA and ΔkvrB strains have reduced mucoviscosity.
KvrA and KvrB positively regulate capsule gene expression.
Given the observations indicating that ΔkvrA and ΔkvrB have reduced hypermucoviscosity and produce less uronic acid than the WT, it is likely that expression of the capsule locus (cps locus) is reduced in these mutants. We constructed transcriptional gfp fusions to the known capsule promoters located upstream of galF, wzi, and manC (also known as cpsB) (43) and transformed these into the WT and mutant strains (Fig. 5A). The wzi promoter appeared to be affected only minimally by the loss of KvrA or KvrB. However, the levels associated with the galF and manC promoters were significantly decreased (20% to 25% of WT expression) in both the ΔkvrA and ΔkvrB mutants (Fig. 5B to D), indicating that loss of KvrA and KvrB results in a reduction in capsule synthesis gene expression.
FIG 5
KvrA and KvrB regulate expression of capsule gene promoters. (A) Schematic of a cps locus. Gray arrows indicate known promoters, genes indicated in red are highly conserved between different cps loci, and genes indicated in blue are variable between cps loci. The manC gene is also known as cpsB. (B to D) Cultures of the indicated strains containing the galF, wzi, or manC promoter from KPPR1S cloned into pPROBE were grown in LB for 6 h. Fluorescence was measured and normalized to the culture OD600. These data are representative of results from an individual experiment. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. ***, P < 0.001; ****, P < 0.0001.
KvrA and KvrB regulate expression of capsule gene promoters. (A) Schematic of a cps locus. Gray arrows indicate known promoters, genes indicated in red are highly conserved between different cps loci, and genes indicated in blue are variable between cps loci. The manC gene is also known as cpsB. (B to D) Cultures of the indicated strains containing the galF, wzi, or manC promoter from KPPR1S cloned into pPROBE were grown in LB for 6 h. Fluorescence was measured and normalized to the culture OD600. These data are representative of results from an individual experiment. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. ***, P < 0.001; ****, P < 0.0001.KvrA and KvrB are found in most other K. pneumoniae strains, and thus we wanted to determine if KvrA and KvrB have conserved roles in different strains. Because of the high prevalence of the K1 serotype among hv isolates associated with community-acquired liver abscess infections (5, 46), we chose to test NTUH-K2044, which was isolated from a liver abscess (47). We constructed insertional mutations in kvrA (VK606) and kvrB (VK607) and performed quantitative reverse transcription-PCR (qRT-PCR) analysis on galF, wzi, and manC in both the NTUH-K2044 and KPPR1S backgrounds. In the KPPR1S strains, we observed that the levels of expression of the galF and manC genes in the ΔkvrA and ΔkvrB strains were significantly reduced, consistent with the gfp reporter data (Fig. 6A). The levels of the galF and manC genes were also significantly reduced in the NTUH-K2044 kvrA and kvrB mutants (Fig. 6B). This analysis also revealed that wzi expression was significantly reduced in the NTUH-K2044 mutants (Fig. 6B) and appeared to be slightly reduced in the KPPR1S mutants as well, although the results were not statistically significant (Fig. 6A). These data indicate that KvrA and KvrB regulate expression of several promoters in the cps locus from strains with at least two different capsule types, K1 and K2.
FIG 6
qRT-PCR analysis of cps-regulated genes from diverse K. pneumoniae strains. Strains were grown in LB for 2 h, and RNA was isolated and analyzed by qRT-PCR for expression of the galF, wzi, manC, or rmlB gene. Data are presented relative to each individual WT strain. (A) Analysis in KPPR1S (WT, ΔkvrA [VK277], and ΔkvrB [VK410] strains). (B) Analysis in NTUH-K2044 (WT, kvrA::pKAS46 [VK606], and kvrB::pKAS46 [VK607] strains). (C) Analysis in MKP103 (WT, kvrA::Tn [VK402], and kvrB::Tn [VK404] strains). One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.
qRT-PCR analysis of cps-regulated genes from diverse K. pneumoniae strains. Strains were grown in LB for 2 h, and RNA was isolated and analyzed by qRT-PCR for expression of the galF, wzi, manC, or rmlB gene. Data are presented relative to each individual WT strain. (A) Analysis in KPPR1S (WT, ΔkvrA [VK277], and ΔkvrB [VK410] strains). (B) Analysis in NTUH-K2044 (WT, kvrA::pKAS46 [VK606], and kvrB::pKAS46 [VK607] strains). (C) Analysis in MKP103 (WT, kvrA::Tn [VK402], and kvrB::Tn [VK404] strains). One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.Both type K1 and type K2 capsules incorporate mannose, and this is true of ~73% of capsule types; most of the remaining capsule types contain rhamnose, and some contain both mannose and rhamnose (48). Sequence type 258 (ST258) strains have recently been shown to be associated with many nosocomial infections caused by carbapenem-resistant K. pneumoniae, including an outbreak at the NIH (49). One such ST258 clinical isolate, KPNIH1 (49), has a cps locus containing genes that produce a rhamnose subunit, and it harbors kvrA and kvrB. MKP103, a carbapenem-sensitive derivative of KPNIH1, was constructed and was used to generate an ordered library of transposon mutants (50). The effect of kvrA (VK402) and kvrB (VK404) mutations on expression of the galF, wzi, and rmlB genes was tested in the MKP103 strain using qRT-PCR (Fig. 6C). Interestingly, although the galF and wzi promoters are virtually identical among all three strains, KvrA and KvrB did not appear to regulate these promoters in MKP103. One possible explanation is that kvrA or kvrB is not expressed in this strain; we examined this possibility by qRT-PCR and verified that both genes are indeed expressed (data not shown). Thus, these data suggest that the roles of KvrA and KvrB in regulating expression of galF and wzi expression are indirect. The rmlB promoter is quite different from the manC promoter, and KvrA and KvrB did not appear to regulate this promoter in MKP103.In addition to capsule regulation, we analyzed capsule production and mucoviscosity of the NTUH-2044 and MKP103 strains. As with KPPR1S, we found that uronic acid content was significantly reduced in both the NTUH-K2044 kvrA and kvrB mutants to ~60% of the level seen with the parental strain (Fig. 7A). Similarly, both the kvrA and the kvrB mutants of NTUH-K2044 had reduced mucoviscosity (Fig. 7B). Consistent with the qRT-PCR data, KvrA and KvrB affected neither uronic acid content nor mucoviscosity in MKP103 (Fig. 7). However, MKP103 does not produce as much capsule as either KPPR1S or NTUH-K2044 and is not HMV. Together, these data suggest that the role of KvrA and KvrB in capsule production may be conserved in hv strains.
FIG 7
Capsule production in kvrA and kvrB mutants of NTUH-K2044 and MKP103. Assays were performed as described for Fig. 4. (A) Uronic acid quantification. (B) Mucoviscosity. The strains used were the same as those described in the Fig. 6 legend. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. ****, P < 0.0001.
Capsule production in kvrA and kvrB mutants of NTUH-K2044 and MKP103. Assays were performed as described for Fig. 4. (A) Uronic acid quantification. (B) Mucoviscosity. The strains used were the same as those described in the Fig. 6 legend. One-way ANOVA tests were performed for statistical analyses comparing the WT strain to the indicated mutants. ****, P < 0.0001.
Contribution of kvrA and kvrB to virulence in NTUH-K2044 and MKP103.
K. pneumoniae strains display significant genetic heterogeneity, and not all identified virulence factors are conserved between Klebsiella clinical isolates. Furthermore, the relative contributions of virulence factors to infection and pathogenesis can be dependent on the strain background (7, 48, 51, 52). However, kvrA and kvrB homologues are conserved in K. pneumoniae strains and thus could have a conserved role in virulence. We therefore tested the kvrA and kvrB loss-of-function mutants in the NTUH-K2044 and MKP103 strains in a mouse model of pneumonia. As with the KPPR1S strain, the NTUH-K2044 kvrA mutant was strongly attenuated in the lung and did not establish infection in the spleen (Fig. 8A). Similarly to the KPPR1S kvrB mutant, the NTUH-K2044 kvrB mutant initially colonized the lung at levels that were lower than the WT levels but was present at levels similar to the WT levels by 72 hpi (Fig. 8A). In contrast to both of the WT strains and the kvrA mutant, the kvrB mutant was detectable in the spleens of most mice by 24 hpi, and by 72 hpi the burden of the kvrB mutant in the spleen had increased but was still several logs lower than the WT level (Fig. 8A). These data suggest that both KvrA and KvrB contribute to the virulence of hv
K. pneumoniae strains with different types of capsule.
FIG 8
Effect of mutations in kvrA and kvrB in NTUH-K2044 or MKP103 on virulence. Mice were inoculated i.n. with the indicated strains. At various time points, mice were euthanized, and lungs (left panels) and spleens (right panels) were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate CFU counts that were below the limit of detection. Mann-Whitney tests were performed for statistical analyses comparing the WT strain to the respective mutants: **, P < 0.01; ***, P < 0.001. (A) Mice were infected with 2 × 104 CFU of NTUH-K2044, kvrA::pKAS46 (VK606), or kvrB::pKAS46 (VK607) and were sacrificed at 24 or 72 hpi. (B) Mice were infected with 2 × 107 CFU of MKP103, kvrA::Tn (VK402), or kvrB::Tn (VK404) and were sacrificed at 24 hpi.
Effect of mutations in kvrA and kvrB in NTUH-K2044 or MKP103 on virulence. Mice were inoculated i.n. with the indicated strains. At various time points, mice were euthanized, and lungs (left panels) and spleens (right panels) were homogenized and plated for bacterial enumeration. Each symbol represents one mouse. The dotted line indicates the limit of detection, and symbols on the dotted line indicate CFU counts that were below the limit of detection. Mann-Whitney tests were performed for statistical analyses comparing the WT strain to the respective mutants: **, P < 0.01; ***, P < 0.001. (A) Mice were infected with 2 × 104 CFU of NTUH-K2044, kvrA::pKAS46 (VK606), or kvrB::pKAS46 (VK607) and were sacrificed at 24 or 72 hpi. (B) Mice were infected with 2 × 107 CFU of MKP103, kvrA::Tn (VK402), or kvrB::Tn (VK404) and were sacrificed at 24 hpi.Classical strains such as the ST258 strains prevalent in nosocomial outbreaks of carbapenem-resistant strains do not exhibit the same level of virulence in mouse models as the hv strains (39, 53). Nevertheless, when administered at a high dose (107 CFU), these classical isolates can initially colonize the lungs of mice but are then cleared within 48 to 72 hpi (39, 53). Because kvrA and kvrB are part of the core K. pneumoniae genome, we assessed the virulence of the kvrA and kvrB mutants in MKP103. At 24 hpi, the kvrB mutant behaved similarly to the WT strain, whereas the kvrA mutant colonized the lungs of these mice at a significantly reduced level (Fig. 8B). Bacterial burdens in the spleen were very low for all three strains, but the kvrA mutant appeared to be defective for spleen colonization relative to the WT and kvrB strains (Fig. 8B). This trend for the kvrA mutant was significant (P < 0.05) in analyses of only those mice with detectable CFU. C57BL/6 mice were used in these studies, and it is possible that the kvrA mutant, as well as the kvrB mutant, would have a stronger phenotype in a host comparable to the immunocompromised patients that are typically infected with classical strains. Nevertheless, it appears that kvrA is important for the virulence of the representative hv and classical strains tested here.
DISCUSSION
The MarR family of transcriptional regulators has been implicated in regulation of virulence genes in several members of the Enterobacteriaceae (17, 18, 21, 24, 26, 34, 54). This work examines the contribution of the MarR family to K. pneumoniae virulence by first screening loss-of-function mutations in nine marR-like genes in a K2 hv strain (KPPR1S) using a mouse model of pneumonia. Two uncharacterized transcriptional regulators, KvrA and KvrB, were found to be important for virulence in this model. The kvrA mutant was essentially avirulent. Inflammatory monocytes have been shown to be critical for clearance of a K. pneumoniae ST258 strain by producing tumornecrosis factor alpha (TNF-α) that then recruits interleukin-17 (IL-17)-producing innate lymphocytes (38), and IL-17 has also been shown to control infection with ATCC 43816 (55), the strain from which KPPR1S was derived. Thus, the increased number of inflammatory monocytes observed after infection with the ΔkvrA mutant was likely contributing to the rapid clearance of this mutant. Mutations in kvrA and kvrB in a K1 hv strain (NTUH-K2044) also resulted in a virulence defect in this pneumonia model. In addition, mutations in kvrA and kvrB resulted in increased adherence to and uptake of KPPR1S by murine BMDM. These phenotypes are consistent with those of capsule-deficient strains (56), and indeed, KvrA and KvrB were found to regulate capsule gene expression from the galF and manC promoters in KPPR1S and NTUH-K2044. However, kvrA and kvrB mutations in classical ST258 strain MKP103 did not affect expression from the conserved galF promoter. Whether these effects of KvrA and KvrB on expression from the manC and galF promoters are direct or indirect is not known. The lack of an effect on galF expression in the MKP103 kvrA and kvrB mutants suggests that the effect(s) on galF expression in the hv strains may be indirect, acting through a protein present only in hv strains.The contribution of the MarR family to the virulence of K. pneumoniae may be both strain and infection site dependent. Previously, the role of the MarR family protein, PecS, was shown to be important for repressing the type 1 fimbrial gene locus in K. pneumoniae strain CG43 (57). Type 1 fimbriae have been implicated in binding to mannose-containing structures and are important for causing UTI (58). A high-throughput genetic screen for virulence factors that are important for a pneumonic infection found that the pecS mutant was attenuated only modestly in a coinfection experiment (59). The pecS ortholog (geneID VK055_4417) was targeted in our initial screen and found to be dispensable for virulence in the lung. This is consistent with a previous study where an mrk (type 3 fimbrial) mutant and an mrk fim double mutant were not attenuated in a lung model of Klebsiella infection (60) even though they were attenuated in a UTI model (61). While our study demonstrated that PecS is dispensable for KPPR1S infection in the lung, it may serve an important role in other infection sites such as the urinary tract.The bacterial capsule serves a variety of functions, including, but not limited to, protection from the immune response of the host (56, 62–64). Capsule synthesis in K. pneumoniae is homologous to assembly of the Wzy-dependent assembly of group 1 capsules of E. coli (65). Following polymerization, the polysaccharide chains are transported across the outer membrane and are thought to be anchored to the surface via the Wzi lectin (66, 67). E. coli and K. pneumoniae are among the few gammaproteobacteria that encode Wzi proteins (67); in this study, using the sedimentation assay, a wzi mutant was no longer hypermucoviscous.Our study has revealed a role for KvrA and KvrB in regulation of sugar production for capsule synthesis in type K1 and type K2 strains as determined by a reduction in expression of the galF and manC promoters and a reduction in uronic acid levels. Furthermore, hypermucoviscosity, a property associated with hv strains (but not classical strains) and generally associated with more abundant capsule in the literature (5, 9, 68), was significantly reduced in both the kvrA and kvrB mutants in the hv strains. However, it is unclear whether cell-associated capsule or released extracellular polysaccharide or both are responsible for the changes in hypermucoviscosity. The difference between surface-associated and released capsule polysaccharides may reflect a difference in function. For instance, surface-associated capsule can inhibit complement deposits and thus evade the membrane attack complex, and it can block attachment to phagocytic cells (69). Free extracellular capsule may act as a decoy to sequester antimicrobial peptides produced by the host (70). Therefore, it is possible that the reduction in uronic acid and mucoviscosity that we observed may reflect a change in the ratio of free and bacterial-surface-associated saccharides. On the basis of previous studies (67), this change may be mediated by Wzi, as we observed a modest decrease in expression from the wzi promoter. However, it could also be due in part to the reduction in synthesis of precursor sugars via reduced expression from the galF and manC promoters or to altered expression of unknown genes that influence mucoviscosity.The primary sequences of the MarR/SlyA/RovA proteins are highly conserved among different bacteria; however, the degree of similarity between different MarR-family homologues can vary substantially. For instance, while KvrA shares 84% identity with SlyA of Salmonella enterica (71) and KvrB shares 93% identity with EmrR of E. coli (72), KvrA and KvrB share only 31% identity. A consensus DNA-binding sequence has been difficult to identify for many of these family members, and regulation by this class of regulators appears to be largely mediated by derepression of H-NS transcriptional silencing (73). H-NS regulates many horizontally acquired genes, and this regulation has been shown in many instances to be counteracted by regulators of the MarR family (27, 74–76). Thus, the regulons of MarR regulators can differ between closely related bacterial species and even between strains of the same species (28).We found that KvrA and KvrB are necessary for capsule expression, and, given the comparable capsule production defects but different disease phenotypes of kvrA and kvrB mutants, we believe that KvrA and KvrB may be regulating genes in addition to the cps locus, and efforts to define the regulons are currently under way in our laboratory along with studies to examine direct versus indirect regulation. As less than 40% of genes are conserved across different K. pneumoniae strains (52), identifying highly conserved targets affecting growth and survival of K. pneumoniae in the host is essential for overcoming strain heterogeneity as new therapeutics are developed. Current studies are under way to characterize the KvrA and KvrB regulons in order to gain a fuller understanding of how these proteins influence capsule production and virulence.
MATERIALS AND METHODS
Ethical statement.
Mouse experimental procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animal studies were approved by the Institutional Animal Care and Use Committee of the University of North Carolina (UNC) at Chapel Hill. All efforts were made to minimize suffering. Animals were monitored daily following inoculation and were euthanized upon exhibiting signs of morbidity.
Bacterial strains and culture conditions.
Bacterial strains and plasmids used in this study are described in Table 1. The wild-type K. pneumoniae strains used in this study included KPPR1S (31), a streptomycin-resistant (Strepr) derivative of KPPR1 (a rifampin-resistant [Rifr] derivative of ATCC 43816 [77]); NTUH-K2044, a K1 isolate from a liver abscess (47); and MKP103, an ST258 carbapenem-sensitive derivative of KPNIH1 (49, 50). All strains were grown aerobically in Luria-Bertani (LB) medium at 37°C. The following antibiotics were added to the media as appropriate at the indicated concentrations: kanamycin (Kan; 50 µg/ml [Kan50]), Rif (30 µg/ml [Rif30]), and Strep (500 µg/ml).
Bacterial strains and plasmids used in this workCmr, chloramphenicol resistance; Tpr, trimethoprim resistance.
Construction of bacterial mutants.
The primers used for the construction of mutant strains are listed in Table 2. In-frame deletion mutants of kvrA, kvrB, and marR (VK277, VK410, and VK332, respectively) were generated by allelic exchange using pKAS46 as described previously (31, 78). Fragments of ~500 bp upstream and downstream of the targeted gene were amplified by PCR, cloned into pKAS46, and verified by sequencing, and the resulting plasmid was introduced into KPPR1S via conjugation. Transconjugants (Rifr/Kanr) were streaked onto LB-Strep agar plates to select for clones that had lost the vector sequences. The resulting colonies were screened for Kan sensitivity and then for loss of the targeted gene by PCR.
TABLE 2
Primers used in this study
Primer
Sequencea (5′ to 3′)
Descriptionb
MP159
TGACTAGATATCCGACACTCTTAACCAACAGCT
Δ0496 5′ flank F
MP160
TGCATATCTAGACTCCAGGCTAAAGATTAATTC
Δ0496 5′ flank R
MP161
TGCATATCTAGATGGCGATTCCAATTTCATCTC
Δ0496 3′ flank F
MP162
TCGATAGCGGCCGCCATGCGGCAATCAGGGCGACG
Δ0496 3′ flank R
MP228
TGCATATCTAGAGTGCGCACACCTATAAGCGTA
manC promoter F
MP229
CAGTACGAATTCGCTCGCGAGACATCGGCCAGA
manC promoter R
MP232
TGCATATCTAGACGGTAATTGATAATTCATATT
wzi promoter F
MP233
CAGTACGAATTCTGGGCTCCCAGGGAGGAAAGC
wzi promoter R
MP234
TGCATATCTAGACTGTACGACTGCGGTATGTGT
galF promoter F
TM2
CAGTACGAATTCTTTGTGGCCGGCAGCATATGC
galF promoter R
MP251
TGACTAGATATCCACGACACCATCAGGATGGCG
Δ0870 5′ flank F
MP252
TGCATATCTAGAGCTGGTACTTTTCATAATGGT
Δ0870 5′ flank R
MP253
TGCATATCTAGACTCAAGAAGGTCCTGCCGTAA
Δ0870 3′ flank F
MP254
TCGATAGCGGCCGCCAAGAGTACGATAGCTGCGGC
Δ0870 3′ flank R
MP256
TGACTAGATATCGGAACGGTTAAGCAACGCCTC
4417::kan F
MP257
TGCATATCTAGACTGACTAAACCTCAGTATGCG
4417::kan R
MP258
TGACTAGATATCCTCCAGCGCCTTCAGACGATG
4238::kan F
MP259
TGCATATCTAGAGCGGCCAGACCTCGACTGCAG
4238::kan R
MP260
TGACTAGATATCGCTGACGGTGGTGTAATCGCG
1202::kan F
MP261
TGCATATCTAGATCAGCGTAATGAACCAGCCGC
1202::kan R
MP262
TGACTAGATATCCGGCGGTCAGCGTCAGCAGGC
2679::kan F
MP263
TGCATATCTAGAGCCAGTGGCGCGCCATTATTG
2679::kan R
MP274
TGACTAGATATCTCAGCGATACGGGTGGCGTTG
4504::kan F
MP275
TGCATATCTAGACCGCCATGAAGATTTCCCGTT
4504::kan R
MP276
TGACTAGATATCGGCGGTCAATCGTCGGCTGAA
1021::kan F
MP277
TGCATATCTAGAGCAGTCGCTTACGTTTGTCGC
1021::kan R
MP280
TGACTAGATATCGGATCTGTTCAATAAGACCGA
1682::kan F
MP281
TGCATATCTAGAAAGAGCACGTGGAAGGGTTTC
1682::kan R
MP285
TGACTAGATATCCCGATCGAGCGTGACCAGCGG
Δ4504 5′ flank F
MP286
TGCATATCTAGAGAAGGCGTGCTAGCGGACTCT
Δ4504 5′ flank R
MP287
TGCATATCTAGAAAACGAACTATCCATTTGGGT
Δ4504 3′ flank F
MP288
TCGATAGCGGCCGCTCTGCGGGTGTCTGACGGCGC
Δ4504 3′ flank R
KW372
TAATCGACCATCGCCTGAAAC
kvrA 5′ flank F
KW373
GACGGCTGTTCAATACCGATAG
kvrA 3′ flank R
KW374
GCCATGAAGATTTCCCGTTTC
kvrB 5′ flank F
KW375
CGTTAATTCCCTGCGCTTTG
kvrB 3′ flank R
Restriction sites are in bold.
F, forward primer; R, reverse primer.
Primers used in this studyRestriction sites are in bold.F, forward primer; R, reverse primer.Insertional disruption mutants (VK279, VK322, VK323, VK324, VK325, VK280, VK327, and VK328) were constructed as follows. A DNA fragment containing an internal portion of the gene of interest was generated by PCR, cloned into pKAS46, and verified by sequencing, and the resulting plasmid was introduced in KPPR1S via conjugation. The resulting Rifr/Kanr colonies were selected for experimentation. For NTUH-K2044 0496::pKAS46 and NTUH-K2044 4504::pKAS46, transconjugants were selected on LB plates with chloramphenicol (25 µg/ml) and Kan50. Mutants of kvrA and kvrB were identified in MKP103 from a library of transposon mutants and were kindly provided by C. Manoil (50).Chromosomal complementation was done by allelic exchange essentially as described above for in-frame deletions. The plasmids for chromosomal complementation (pKAS46 kvrAcomp and pKAS46 kvrBcomp) were generated by amplifying a single fragment that spanned the same upstream and downstream regions as the deletion constructs using the outermost primers but that contained the full coding sequence. The insertions were cloned into pKAS46 and verified by sequencing. Following conjugation and resolution of the vector sequences, the resulting complemented strains were designated VK278 (kvrAcomp) and VK417 (kvrBcomp).
Murine model of pneumonia.
Five-to-8-week-old female C57BL/6 mice (Jackson Laboratories) were anesthetized with 200 µl of a 0.8 mg/ml ketamine–1.3 mg/ml xylazine cocktail and inoculated intranasally (i.n.) with ~2 × 104 CFU/mouse (KPPR1S and NTUH-K2044) or ~2 × 107 CFU/mouse (MKP103) as described previously (31, 77). Total CFU counts for each inoculum were confirmed by plating dilutions onto LBagar. After 24, 48, or 72 hpi, mice were euthanized by a lethal intraperitoneal injection of 200 µl sodium pentobarbital (52 mg/ml). Organs were removed, homogenized in phosphate-buffered saline (PBS), serially diluted, and plated to quantify the CFU level per gram of tissue.
Histopathology.
Groups of two or three mice were inoculated i.n. as described above. The mice were sacrificed at 72 hpi, and lungs were inflated with 1 ml of 10% neutral buffered formalin for at least 24 h. The lungs were transferred to PBS for 2 h and then immersed in 70% ethyl alcohol and embedded in paraffin. Three 5-µm sections (spaced 200 µm apart) per lung were stained with hematoxylin-eosin (H&E) for examination. Histology services were provided by the University of North Carolina (UNC) Center for Gastrointestinal Biology and Disease Histology Core.
Flow cytometry and antibodies.
The lungs from K. pneumoniae-infected or mock-infectedmice were minced into fine pieces with two surgical steel razor blades and then digested in 5.66 mg collagenase II (Gibco, Carlsbad, CA)–4 ml PBS–5% serum for 1 h at 37°C. Following digestion, the lung homogenates were triturated with an 18-gauge needle (three passages) and then passed through a 100-µm-pore-size filter to generate a single-cell suspension.For flow cytometry staining, approximately 107 cells were counted from red blood cell (RBC)-lysed lung samples. Each sample was incubated with an anti-CD16/32 antibody cocktail (Fc Block; Tonbo Biosciences, San Diego, CA) for 5 min at room temperature. Then, cellular markers were surface labeled by adding a 1:200 dilution of each antibody for 20 min at 4°C. The following antibodies/dyes were used to immunophenotype the cellular infiltrates: Ly-6C-BV786 (clone HK1.4) and anti-CD64-phycoerythrin (PE) (clone X54-5/7.1) from BioLegend (San Diego, CA); anti-CD45-vf450 (clone 30-F11), anti-CD11b-fluorescein isothiocyanate (FITC) (clone M1/70), anti-F4/80-PE/Cy7 (clone BM8.1), and anti-CD19-rf710 (clone 1D3) from Tonbo Biosciences; and anti-Ly-6G-ef660 (clone RB6-8C5) and ef780 fixable viability dye (used at a 1:100 dilution) from Affymetrix EBioscience (San Diego, CA). Flow cytometry data were analyzed using FlowJo version 9.9.4 software (TreeStar, LLC). Cell populations were determined after gating on CD45+ CD19− non-B-cell leukocytes, Ly6G+/CD11b+ neutrophils, and Ly6C+ CD11b+ CD64+ inflammatory monocytes.
Adherence and internalization assay.
Bone marrow-derived macrophages (BMDM) were prepared as follows. Femurs from C57BL/6 mice were harvested and rinsed thoroughly with Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad, CA) to extract immature bone marrow cells. The marrow cells were then strained through a 70-µM-pore-size filter and collected. For each mouse used, the marrow was resuspended to 60 ml of DMEM supplemented with 10% fetal bovine serum (FBS) and 10% L-929 cell supernatant. The cell suspension was then divided into aliquots and placed in 6 untreated 100-mm-diameter petri dishes (10 ml each). The cells were allowed to differentiate for 6 to 7 days, with feeding occurring every 72 h. To verify differentiation, fluorescence-activated cell sorter (FACS) analysis was used to ensure that the levels of F4/80 and CD11b expression were greater than or equal to 90%.BMDMs were seeded into 24-well plates at a density of 500,000 cells per well and incubated overnight at 37°C and 5% CO2. Bacterial cultures were grown in 2 ml LB with Rif30 for 16 to 17 h at 37°C. Prior to the assays, the macrophages were rinsed and fresh DMEM–10% FBS was added. For the adherence assay, cells were pretreated for 1 h with 2 µM cytochalasin D (Sigma, St. Louis, MO) to inhibit internalization of bacteria; this step was omitted for the internalization assays. Macrophages were then inoculated with the desired K. pneumoniae strains at a multiplicity of infection (MOI) of 50. After 1 h, the wells were gently rinsed with sterile phosphate-buffered saline (PBS) three times and then lysed with 0.5% saponin–PBS. The lysate was diluted and plated on LBagar to determine the number of CFU. Data are presented as percentages of the inoculum.For the internalization assay, cells were seeded and treated as described above, omitting the cytochalasin D treatment. Following a 1-h incubation with K. pneumoniae at an MOI of 50, the cells were rinsed with PBS three times, and then DMEM–10% FBS–200 µg/ml gentamycin (Gibco) was added and the reaction mixture was incubated 30 min to kill extracellular bacteria. Following the gentamicin treatment, the cells were lysed with 0.5% saponin–PBS, diluted, and plated on LBagar to determine the number of CFU. Data are presented as percentages of the inoculum.
Construction of reporter fusions and measurement of promoter activity.
DNA fragments containing the promoter region of manC, galF, and wzi from KPPR1S were amplified by PCR using Pfu Turbo and cloned into the gfp reporter plasmid pPROBE-tagless (79). The resulting plasmids, pPROBE-manC, pPROBE-galF, and pPROBE-wzi, were confirmed by restriction digest analysis and sequencing. All primers used for these clones are listed in Table 2.To examine capsule gene expression in vitro, pPROBE-tagless, pPROBE-manC, pPROBE-galF, or pPROBE-wzi was introduced into KPPR1S, VK277, and VK410 by electroporation. These strains were grown overnight at 37°C in LB–Kan50, subcultured to an OD600 of 0.2, and grown for 6 h. All strains were assayed in triplicate, and each assay was performed multiple times. Relative fluorescent units (RFU) were measured using a Synergy HT plate reader (Biotek Instruments, Winooski, VT), and the measurements were normalized to the culture OD600.
Mucoviscosity assay.
The mucoviscosity of the capsule was determined using the sedimentation assay as previously described (31, 80). Briefly, overnight cultures grown in LB were subcultured to an OD600 of 0.2 in fresh media and grown at 37°C. After 6 h, the cultures were normalized to an OD of 1.0/ml and centrifuged for 5 min at 1,000 × g. The supernatant was gently removed without disturbing the pellet for OD600 measurement.
Extraction and quantification of capsule.
Uronic acid content was extracted and quantified as previously described (31). Briefly, cultures were grown for 6 h as described above; 500 µl was mixed with 100 µl 1% zwittergent–100 mM citric acid, incubated for 20 min at 50°C, and centrifuged; and 300 µl of supernatant was precipitated with 1.2 ml 100% ethanol. Following centrifugation, the pellet was dried and resuspended in 200 µl distilled water (dH2O), and then 1.2 ml sodium tetraborate–concentrated H2SO4 was added and the reaction mixture was subjected to vortex mixing, boiled for 5 min, and placed on ice for 10 min. Uronic acid was detected by addition of 20 µl of 0.15% 3-phenylphenol (Sigma-Aldrich)–0.5% NaOH. After a 5-min incubation at room temperature, the absorbance at 520 nm was measured. The glucuronic acid content was determined from a standard curve of glucuronate lactone (Sigma-Aldrich, St. Louis, MO) and expressed as micrograms per OD600.
RNA extraction and qRT-PCR analysis.
Overnight cultures of each K. pneumoniae strain were subcultured to an OD600 of 0.05 and grown for 2 h in LB (with antibiotics, when necessary). A volume of 3 ml was mixed with 600 µl 1% zwittergent–100 mM citric acid in 2 microcentrifuge tubes and incubated for 10 min at room temperature to facilitate pelleting (81). Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions, with the following additional step. A volume of ~100 µl 0.1-mm-diameter silica beads (BioSpec Products, Bartlesville, OK) was added with the Trizol reagent, and the samples were placed in a Precellys 24 homogenator (Bertin Technologies) for 3 min at 5,300 rpm prior to chloroform addition to facilitate lysis. Contaminating DNA was removed with DNA-free Turbo using the manufacturer’s rigorous protocol and 1-h incubations. CDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) with 1 µg RNA as the template in a 20-µl reaction volume, and then the samples were diluted 10-fold with RNase-free dH2O. PCR was performed in a 20-µl reaction volume containing 5 µl cDNA, a 500 nM concentration of each primer, and 10 µl SsoAdvance SYBR green Supermix (Bio-Rad) using a CFX96 RealTime system (Bio-Rad). The relative transcript levels for the target genes were normalized to the gyrB gene and calculated using the threshold cycle (2−ΔΔCT) method (82). The data represent results from an average of 6 biological replicates; 3 of each were grown and processed on separate days.
Statistical analysis.
Statistical analyses were performed using GraphPad Prism, version 7.0 (San Diego, CA). Mouseinfection data were analyzed using the Mann-Whitney test. For all other experiments, ordinary one-way analysis of variance (ANOVA) tests (Dunnett’s multiple-comparison tests) were applied.
Authors: Jason S Cathelyn; Seth D Crosby; Wyndham W Lathem; William E Goldman; Virginia L Miller Journal: Proc Natl Acad Sci U S A Date: 2006-08-28 Impact factor: 11.205
Authors: Huizhong Xiong; James W Keith; Dane W Samilo; Rebecca A Carter; Ingrid M Leiner; Eric G Pamer Journal: Cell Date: 2016-03-31 Impact factor: 41.582
Authors: Gareth McVicker; Lei Sun; Baljinder K Sohanpal; Krishna Gashi; Richard A Williamson; Jacqueline Plumbridge; Ian C Blomfield Journal: J Biol Chem Date: 2011-07-15 Impact factor: 5.157
Authors: P Ye; F H Rodriguez; S Kanaly; K L Stocking; J Schurr; P Schwarzenberger; P Oliver; W Huang; P Zhang; J Zhang; J E Shellito; G J Bagby; S Nelson; K Charrier; J J Peschon; J K Kolls Journal: J Exp Med Date: 2001-08-20 Impact factor: 14.307
Authors: Michael A Bachman; Paul Breen; Valerie Deornellas; Qiao Mu; Lili Zhao; Weisheng Wu; James D Cavalcoli; Harry L T Mobley Journal: MBio Date: 2015-06-09 Impact factor: 7.867
Authors: Rebecca J Silver; Michelle K Paczosa; Anne L McCabe; Joan-Miquel Balada-Llasat; James D Baleja; Joan Mecsas Journal: Antimicrob Agents Chemother Date: 2019-07-25 Impact factor: 5.191
Authors: Punyawee Dulyayangkul; Wan Ahmad Kamil Wan Nur Ismah; Edward J A Douglas; Matthew B Avison Journal: Antimicrob Agents Chemother Date: 2020-06-23 Impact factor: 5.191
Authors: Ines Bleriot; Rocío Trastoy; Lucia Blasco; Felipe Fernández-Cuenca; Antón Ambroa; Laura Fernández-García; Olga Pacios; Elena Perez-Nadales; Julian Torre-Cisneros; Jesús Oteo-Iglesias; Ferran Navarro; Elisenda Miró; Alvaro Pascual; German Bou; Luis Martínez-Martínez; Maria Tomas Journal: Microb Genom Date: 2020-04-29